Team:NPU-China/Public Engagement

menu

DNA Time Capsule

——Applying DNA to record kids’ dreams and motivating them to keep dreaming
Introduction
There is such a plot in the novel "The Three Body Problem"：in the future, under the threat of outer space forces, human beings begin to study how to save important information for a longer time, only to find that Quantum Memory, which shows the best storage performance, merely lasts for two thousand years due to the decay of the internal substances thus cannot be read. What if we need to save information for 100 million years, or even more? The only way, according to the novel, is to engrave the words on the stones. Whereas we wonder whether there is any method with long storage time and small size in reality? Actually, there does exist, which lies squarely in our body - DNA, a medium that stores genetic information of life, and can also be utilized to store other sorts of information. Extraordinarily impressive should best describe the storage capacity of DNA. It only needs 1KG of DNA dry powder to store all the information in the world[1], and then keeping the information stable for more than a million years shall be made possible by burying it in the frozen soil in the Antarctic or the Himalayas.
Objective
This year, our project mainly focuses on the use of genetic synthesis technology to create an artificially designed mitochondrial genome. We hope to show the society a very tangible application of gene synthesis technology - data storage. Then we begin to ponder what sort of information we shall store with DNA? How about "Dream"? It is a more feasible and meaningful practice to store kids’ dreams in DNA, which we name “Time Capsule.”
Collecting dreams
With this exciting and bracing idea, we came to Mawu Primary School in Chang'an District, Xi'an. First of all, we did a science activity with the children in Mawu Primary School to introduce them to some basic biological knowledge. To our surprise, the pupils have learned a lot about biological knowledge beforehand
Then we familiarized them with the idea of DNA Time Capsule. The children were full of curiosity about such novel technology, showing great interest and prodigious enthusiasm, irrespective of the fact that they didn't completely understand the principles of binary, quaternary and other coded message expertise as well as the details of materials science involving micro-nano scales. The kids were remarkably willing to share their dreams and write them down on the sheets later adhered to the blackboard. We promised to the children to record their dreams with DNA and reserve for them. When they grow up, they shall come back to us and see their dreams at that time by sequencing and decoding.
Encoding the “dreams” into DNA
We converted Chinese characters into binary codes through ASCII and encoded them into DNA sequences. (link: DNA coding software). The sequence was synthesized and then constructed in pSB1C3 backbone and transformed into E.coli. Then we cultured the strain, extracted the plasmid and freeze-dried it into powder that is convenient for long-term preservation, which was then sealed in a vacuum glass vial and placed in the laboratory. Store the information in a freezer to achieve long-term stable storage
Being of a small molecule scale, DNA is difficult to display. In order to achieve a better effect and let children virtually see their "DNA time capsule", we used the website to simulate the secondary structure of these single-stranded RNAs carrying the DNA sequences of those "dreams". (link: http://rna.urmc.rochester.edu/RNAstructure.html) And then we printed them on the paper which were put into the photo frames. We brought these frames along with the souvenirs to these little “dreamers”
It was a sheer elation for the children to receive the presents. Taking one of the children's dream DNA secondary structure diagram as an example, we familiarized the kids with the whole process of transcoding their dreams into DNA and employing software to simulate. We introduced them, in more detail, to DNA storage technology and gene synthesis technology. Although they could not particularly understand the secondary structure of DNA, we do believe that they have gripped our aspiration for them to stick to their dreams. Together we pledged to open their childhood dreams in the future when they bring the DNA secondary structure of their dreams to our school.
The following are some of the students' dreams and their corresponding DNA sequences along with simulated images of the secondary structure.
Name: Dai Ruoying
Dream:
Being a teacher in the future
DNA sequence:
TAGATCCCTAGGGGTGTAGATTTCTCCATAAGTACGTCTTTACATGGGGTAATAGTTCAGGTGTTAACTGATGTCGTTTGGGACGGATTAGGGGCGTAAATATTTAATTTGTTCAGGTGTGTCCGTACGTGGTTATTCAGGTCCGTACTATTTCACGGCTGTCATTATTCCATCGGTAGGTACTTATTTGGTTAATTATGGTCCTACATATGTCAGGGATGTGGTCATGGAGTAGATTCAGTCATTGG
Name: Mao Zhaohan
Dream:
Hi, Mao Zhaohan from the future, will you have become a scientist or explorer. Bear in mind that you must devote yourself into the benefit of humanity.
DNA sequence:
TAGATCCCTAGGGGTGTAGATTTCTCCATAAGTACGTCTTTACATGGGGTAATAGTTCAGGTGTTAACTGATGTCGTTTGGGACGGATTAAATGAATAGATAGTTAGAGGGTGTGAGGATTCCATGTAGTGTTCGTTCCGTACTTCATTAATTCAGGGGGGTCGGGGATCAGGTGTTACATGATTCCTGGACGTTATACTGGATGGTAGTTATCAGTATTTCCCTAATGTAAGTGGTATCGTTATCAGTCACGGCTGTTTTACGGTGATTCGTCAGGTGTTAACTAGTTAGCTATTGTCCGTACGTTGGGTCTCAGTCACTAGGTACTGTAGGTGTTAGGTACTTACATGATGGATGGTAGTGGGGTCTCCCTCCTTAATGGGTGTCCTACAGTTCTGCTTAGGTAAATAAAGTCATATGGTCAGGATGGTAGTGGTAATTACATGATGGATGTGGGTGGGGTCTCCCTCCTTAATGGGT
Name: Zhang Xinyuan
Dream:
Being a compere when growing up
DNA sequence:
TAGATCCCTAGGGGTGTAGATTTCTCCATAAGTACGTCTTTACATGGGGTAATAGTTCAGGTGTTAACTGATGTCGTTTGGGACGGATTAGGGGCGTAAATATTTAATTTGTTCAGGTGTGTCCGTACGTGGTTATTCAGGTCCGTACTATTTCACGGCTGTCATTATTCCATCGGTAGGTACTTATTTGGTTAATTATGGTCCTACATATGTCAGGGATGTGGTCATGGAGTAGATTCAGTCATTGG
Name: Kang Zenan
Dream:
Being an explorer when growing up
DNA sequence:
TAGATCCCTAGGGGTGTAGATTTCTCCATAAGTACGTCTTTACATGGGGTAATAGTTCAGGTGTTAACTGATGTCGTTTGGGACGGATGTTATCAGTATTTCCCTATAGTTCTAATTTGTTCAGGTGTTATGGGGGGTATTAGCTAGGTACTTATTTGGTTAATTATGGTCCTACATATGTCAGGGATGTGGTGGCGGGGTCCATTATGTTTGTCC
Reflection and experience
In recent years, the development of synthetic biology has been extremely rapid, and multitudes of interesting and practical applications have come into being. DNA synthesis techniques and applications using DNA as a functional material are also more frequently reported, such as information storage, DNA origami, DNA circuits, etc. The boundaries between life and machine are no longer as opposed as before, machines are getting more intelligent, and life is becoming more engineered. Our understanding of some traditional biological terms is also going broader and deeper, just like DNA, perceived as genetic material, can surprisingly be used to store information, serve as a target drug carrier or even as a practical circuit. How to present the latest progress of these sciences or industries to the public and the primary and middle school students who are currently fast sensing the world is a problem that all scientists should lavish attention on, which is related to the understanding and acceptance of technology and the inheritance and expansion of science. It has seemed to be an old fashion to just impart children with the skill of painting a culture dish. Therefore, we selected the form of storing "dream" with DNA to let children specifically touch the "future". We are the first team to adopt this form, and we have witnessed the light of curiosity and aspiration from the eyes of those innocent children. When we saw the DNA secondary structure of these "dreams", we were also moved, realizing that "dream" can be not merely a tedious text of words, but also a painting which can be touched and perceived. Thanks to this event, making it possible for us to touch the soft side of DNA synthesis technology.
Simultaneously, the understanding of “life” seems much more diverse to us.
When we think of DNA purely as a substance that stores "life information," we wonder why it is "quaternary"? and why not "binary" of 0 and 1or other systems? Of course, but this requires us to explain it in the future. Plus, when we first saw the secondary structure of the DNA sequence that recorded the "dreams", we felt very familiar with it, which is virtually identical as the symbol used by the aliens in "Arrival". The form of the circle may be a fixed "grammatical structure", with the surrounding branches expressing the specific meaning. This also makes us wonder whether there are really aliens who use DNA as a material to store information and use its two-dimensional or even three-dimensional structure as a specific symbol. This event, admittedly, allows us to broaden our understanding and imagination of the words "DNA" and even "life" and "civilization" from different angles. It is just simply novel and interesting.
Introducing Synthetic Biology to Lanzhou University Social Practice Team
We met the Social Practice Team of Lanzhou University at the Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences. The theme of their social practice was energy conservation and emission reduction. Our advisor Zhuo Bingzhao introduced the future prospectives and the role that synthetic organisms play in energy conservation and emission reduction from six aspects: renewable energy, green energy, green chemistry, agricultural industrialization, air pollution detection and air pollution prevention. They expressed their interest in synthetic biology and decided to know more about synthetic biology when they returned to school.
Reference:
[1] Erlich, Yaniv, and Dina Zielinski. "DNA Fountain enables a robust and efficient storage architecture." Science 355.6328 (2017): 950-954.