Team:SHSU China/Experiments

ExoBlood SHSU_China

Experiments

How We Got Exhausted in The Lab

Project

Experiments

Jiuqi Shen
A Detailed Protocol

We've made countless errors and has spent enormous amount of energy and time to develop the methods we've used, and many of them are never done before. We've put great effort in making this protocol, so that others can have a more pleasant journey and can spend more time in thinking and designing.

Link to Latest version

1:PCR from cDNA library and template:

1-1 CD63

CD63 is synthesized using template Homo Sapiens CD63 variant 1 to remove the BamHI restriction site to prevent future problem when submitting parts using pSB1C3, the following primers are used to add HindIII and XbaI restriction sites for constructing pRK-7 plasmid:

'''CD63-Forward:''' CCCAAGCTTATGGCGGTGGAAGGAGGAA

'''CD63-Reverse:''' GCTCTAGACATCACCTCGTAGCCACTTCTGAT

Figure 1: PCR results of CD63 From De Novo Synthesized Template 1-2 Hemoglobin

We first designed primer to get human hemoglobin DNA sequence, but due to time and continuous negative result, we decided to use Vitreoscilla haemoglobin from BBa_K1321200, which is in this year’s distribution kit. The following primer is designed to add the EcoRI and BamHI sites to the Vhb sequence for constructing the pRK7 plasmid:

'''Vhb-Forward:''' CGGGATCCTTTACAGCTAGCTCAGTCCTAGGTATTATG

'''Vhb-Reverse:''' CGGAATTCTTATTCTGCATCCTGTGCATACAGA

Figure 2: PCR results of Vhb from BBa_K1321200 1-3 WW Tag 3 and WW Tag 4

We used sequence of WW domain 3 and 4 from Human Nedd4 sequence and added HindIII and XbaI when designing the sequence. The following primers are used to sequence the Tags:

'''WW Tag-Forward:'''CCGGAATTCCCCAAGCTTCGTCGTGCCT

'''WW3-Reverse:'''TGCACTGCAGGCTCTAGACGGAATTTTCAGACGCGGATCTT

'''WW4-Reverse:''' TGCACTGCAGGCTCTAGACACGTTTTCCAGACGCGGA

1-4 Ndfip1

We cloned the Ndfip1 gene from borrowed HEK 293T cDNA library using designed primer with EcoRI and BamHI sequences. The Primer sequence are as follows:

'''Ndfip1-Forward:''CCCAAGCTTATGGCGTTGGCGTTGG

'''Ndfip1-Reverse:'''GCTCTAGAATAAATAAAGAGAACTCTGGTCCTGGG

Figure 3: PCR result of Ndfip1 from cDNA library.

2: Plasmid construction:

pRK7-N-Flag plasmid is used to add the Flag Tag to the protein. The following plasmids are constructed:

Figure 4: Our designed plasmids.

Sequencing of plasmid is used to conform the correct sequence of parts.

3: Cell culture and exosome identification:

HEK 293T cells are used in our experiments. After using sequencing to conform the sequence of the fplasmids, 2ug of vecter is transfected to 60mm plates using lipofectamine 2000. Exosomes are extracted from the 4ml culture media using total exosome isolation kit (from cell culture media) from Invitrogen. Cells and exosomes are lysed using Ripa.

Figure 5: Exosome Isolation

First, normal exosomes are lysed and SDS-PAGE is performed. The gel is dyed with Coomassie Blue. The bands correctly match the key protein in exosomes, which first conforms the successful extraction of exosomes from cell medium.

Figure 6: Protein Content of Normal Exosomes.

Plasmid transfection are performed as follows. Two group of cells are transfected to test the effect of adding hemin into the culture:

Table 1: Plasmid Transfection

Next, Western blot is performed using Flag antibody to identify the expression of plasmid in cell:

Figure 7: Vhb, CD63-Vhb Fusion Protein, WWTag3-Vhb and Ndfip are expressed in the cells(Lane 1,2,3,5). Cells that transfected PNW4V plasmids (Lane 5,7) didn’t show any bands, the samples or the cells could be contaminated, or it may be a man-made error.

Exosomes are then lysed and blotted to identify the existence of Vhb, CD63-Vhb or WW3-Vhb:

Figure 8: No trace of Vhb is found. Clear bands of CD63-Vhb can be seen. WW3-Vhb can be barely seen with or without Ndfip1.

4: TEM on Exosomes.

Negative staining is used to stain the exosomes for transmission electron microscope, the concentration and size distribution for different samples can be calculated using TEM results. The calculated results show that a 60mm plate can produce 10^10 quantity of exosomes.

Figure 9: TEM results of engineered exosomes. All samples besides those containing WW4 has correct shape and size of exosomes.

5: Functional test

A functional test is performed to test the chemical oxygen demand of our exosomes. HACH COD testing kit is used and the OD620 of reacted sample is tested,then the oxygen demand of each sample is calculated:

Figure 10: COD value of selected sample. A difference can be seen between regular, PNV transfected and PNCV transfected exosomes. WW3 transfected does not show a statistical difference.

This template is made with by Colorlib