5 g/L yeast extract, 20 g/L tryptone, 0.6 g/L NaCl, 0.2 g/L KCl, after autoclavation 10 mM MgCl₂, 10 mM MgSO₄ and 20 mM glucose were aseptically added, in ddH₂O

2xTY

10 g/L yeast extract, 16 g/L tryptone, 5 g/L NaCl, dissolved in ddH₂O

Buffers and solutions

50 mM phosphate buffer PB pH 6.0

6.8 mM Na₂HPO₄, 43.2 mM NaH₂PO₄, in ddH₂O

50 mM phosphate buffer PB pH 6.5

17.9 mM Na₂HPO₄, 32.1 mM NaH₂PO₄, in ddH₂O

Phosphate buffered saline PBS

137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH₂PO₄, in ddH₂O

50 mM TRIS buffer

38.4 mM TRIS-HCl, 11.6 mM TRIS base, adjust pH to 7.6, add 500 mM imidazol for elution buffer

TRIS buffer for Polyacrylamide gel

1.5 M TRIS-HCl, add NaOH to pH 8.8 in ddH₂O

0.5 M TRIS-HCl, add NaOH to pH 6.6 in ddH₂O

Sodium dodecyl sulfate

10 % SDS in ddH₂O

Ammoniumperoxodisulfate

10 % APS in ddH₂O

12.5 % Polyacrylamide gel

separating gel: 2.5 mL 30 % acryl amide, 1.5 mL 4x TG buffer, 1.94 mL H₂O, 60 µL 10 % APS, 6 µL TEMED

staking gel (4 %): 260 µL 30 % acryl amide, 500 µL 4x TG buffer, 1.22 mL H₂O, 40 µL 10 % APS, 4 µL TEMED

For higher separating gel percentage, increase the amount of acryl amide.

4x Tris-Glycine buffer

12 g Tris base, 57.6 g glycine, ad 1000 mL H₂O

2x Laemmli loading buffer

62.5 mM Tris/HCl pH 6.8, 3 % (w/v) SDS, 5 % (w/v) β-Mercaptoethanol, 10 % (v/v) glycerol, 0.025 mg/mL bromphenol blue

Coomassie staining solution

0.5 % (w/v) Coomassie Brilliant Blue R250, 50 % (v/v) ethanol, 7 % (v/v) acetic acid, 42.5 % (v/v) H₂O

Coomassie destaining solution

40 % (v/v) ethanol, 10 % (v/v) acetid acid, 50 % (v/v) H₂O

Chloramphenicol

Stock solution: 25 mg/mL Chloramphenicol in EtOH
Dilution of 1:1000 in media

Kanamycine

Stock solution: 50 mg/mL kanamycine in ddH₂O
Dilution of 1:1000 in media

Ampicillin

Stock solution: 100 mg/mL ampicillin in ddH₂O
Dilution of 1:1000 in media

Reagent solution for chitosan assay

14 mL 0.2 M borate buffer, pH 8.9
+ 500 µL 0.11 M o‑phthalaldehyde (in ethanol)
+ 500 µL 0.071 M N‑acetyl cysteine (in ethanol)

Tyrosinase

25 kU lyophylized tyrosinase dissolved in 10 mL 50 mM PB pH 6

Tyrosine

2 mM L-Tyrosin in 100 mL ddH₂O

Chitosan

1.6 % (w/v) chitosan (MW: 100.000-200.000 g/mol) in 50 mM PB pH 6, add 2 M HCl to pH 2

Silver staining

Fixative:

20 mL methanol, 18.2 mL formaldehyde-solution (37% v/v), 11.8 mL ddH₂O

Sodium thiosulfate solution 0.02 % (w/v):

0.05 g Na₂S₂O₃, ad 250 mL ddH₂O

Silver nitrate solution 0.1% (w/v):

0.25 g AgNO₃, ad 250 mL ddH₂O

Developer solution:

7.5 g Na₂CO₃, 125 µL formaldehyde-solution (37% v/v), 200 µL Sodium thiosulfate solution (0.02 % w/v), ad 250 mL ddH₂O

Stop solution:

18.6 g EDTA, ad 1 L ddH₂O

Marker for SDS-PAGE

Roti®-Mark TRICOLOR 10-245 kDa (Carl Roth)

Marker for Agarosegel

1 kb Plus DNA Ladder (NEB)

Enzymes

Enzymes provided by New England Biolabs^® Inc.:

PstI
PstI-HF
XbaI
SpeI
MscI
NheI-HF

Enzymes provided by Thermo Fisher Scientific:

BpiI

Enzymes provided by Sigma-Aldrich^®:

tyrosinase

Protocols Chitosan

Pre-culture

3 mL SOB media + antibiotics inoculate with one colony from agar plate

incubate at 37 °C, 180 rpm, over night

Culturing

Inoculate 1:200 with pre-culture, incubate at 30 °C or room temperature, 180 rpm, over night

Harvest cells by full speed centrifugation at 4 °C

resuspend the pellet in phosphate buffer

store at -20 °C until cell disruption or proceed directly

Induction

Grow of culture to OD₆₀₀ = 0.6

add 1 mM IPTG or 10 mM arabinose to induce production of COD or NodC/NodB

Digestion

1 µg	DNA
5 µL	10x buffer
1 U	enzyme 1
1 U	enzyme 2
ad 50 µL	ddH₂O

Double-digest the DNA at 37 °C for 1 h
Load sample to an 1 % agarose gel containing ethidium bromide
Run electrophoresis at 90 V, 1 h
For gel purification cut out respective bands
Purification of DNA with Zymoclean^TM Gel DNA Recovery Kit (Zymo Research)

Ligation 3:1

50 ng	vector
25 ng	insert
1 µL	10x ligation buffer
1 µL	T4 ligase
ad 10 µL	ddH₂O

Ligate the vector and insert at 4 °C over night

Transformation

Organisms used: E. coli DH5α or BL21 (DE3)

Add 10 µL ligation approach or 100 ng purified DNA to 100 µL competent cells
Incubate on ice for 15 min
Heatshock (30 s, 42 °C)
2 min on ice
Add 900 µL SOB medium, incubate at 37 °C, 180 rpm for 1 h
Plate 100 µL to a LB-plate containing antibiotics, incubate at 37 °C over night
Check for colonies the next day

Miniprep

Spin down 1.5 mL of pre-culture, full speed, 2 min
Purify plasmids with Monarch^® Plasmid Miniprep Kit from New England Biolabs^® Inc. (NEB)

His-tag PCR

To improve BBa_K2380043 and BBa_K2380044 (COD, Darmstadt 2017) PCR using Q5 High-Fidelity DNA Polymerase (NEB) was performed to add a C-terminal His-tag.

Primers

VF2: 5'‑tgccacctgacgtctaagaa‑3'
COD_rev+His₆+SpeI: 5'‑GCCGCTACTAGTATTAGTGGTGATGGTGATGATGcagagcagtaaacagcgtattctggg‑3'

5x Reaction Master Mix
dd H₂O	78.75 µL
Q5 Reaction Buffer (5x)	25 µL
Primers (10 µM)	6.25 µL each
dNTPs (10 mM each)	2.5 µL
Q5 DNA Polymerase (2 U/µL)	1.25 µL

Add 24 µL Master Mix to a fresh PCR tube and add 1 µL template DNA (1‑2 ng/µL).

Run PCR using the following profile:

Temperature	Duration
98 °C	2 min
98 °C	10 s	25 cycles
67 °C	30 s
72 °C	1 min
72 °C	3 min

Check PCR products by agarose gel electrophoresis, expected fragment size = 1522 bp.

colonyRCA

For quick analysis of the orientation of the insert COD + His-tag in the vector BBa_K2380002 (NodC), a colonyRCA was conducted.

Reaction was prepared as described in the TempliPhi^TM Kit from GE Health care
Digest the sample with MscI
Load the digested sample to a 1 % agarose gel with ethidium bromide
Run electrophoresis at 100 V, 1 h
Check the bands to identify the right colonies

Cell disruption

Cell disruption was conducted with the EmulsiFlex C5 (Avestin) for purification with HisTrap column (GE Healthcare). Cells were resuspended in 50 mL phosphate buffer containing 2 mM EDTA. Lysis was processed in 3 cycles at 1000 bar.

Purification of His-tag proteins by affinity chromatography (ÄKTA)

Load cell lysate to a 5 mL His-trap column (GE Healthcare)
Elution with 50 mM TRIS-HCl, 250 mM imidazol
Collect protein fraction and check by SDS-PAGE

SDS-PAGE

Load 20 µL of samples (diluted with 2x loading buffer)
Run 12.5 % polyacrylamide-gel at 100 V, 90 min
Stain the gel with Coomassie staining solution for at least 1 h
Destain the gel until you can see protein bands (eventually over night)

UDP-Glo assay

Verification of NodC activity was done with the UDP‑Glo assay. Solutions were used from the UDP‑Glo kit from Promega. UDP‑GlcNAC was used as a substrate for NodC. Luminescense was measured with TECAN Microplate reader, integration time was 1 s.

Chitosan assay

To detect produced chitosan in cell extracts an assay by Larionova et al. [C.1] was tested.

1 mL sample in 0.25 M NaCl
add 1 mL reagent solution (freshly prepared)
incubate 60 min at room temperature
measure absorbance at 340 nm

Standard curves for chitosan and BSA were recorded using the following stock solutions:

chitosan: 1 mg/mL in 0.01 M HCl
BSA: 1 mg/mL in 0.2 M borate buffer, pH 8.9

Reaction Scheme
c [mg/mL]	0.9	0.8	0.6	0.4	0.2
stock [µL]	900	800	600	400	200
buffer [µL]	0	100	300	500	700
2.5 M NaCl [µL]	100	100	100	100	100

Protocols Nisin

PCR

Amplification of the different constructs was performed using Q5 polymerase (Table 2) or ready‑to‑use Q5 High-Fidelity 2X Master Mix (Table 3). The standard program in Table 1 was used.

Table 1: Standard PCR program.

Table 2: Reaction components for PCR amplicifation using Q5 polymerase.

Table 3: Reaction components for PCR amplicifation using Q5 High-Fidelity 2X Master Mix.

The conditions and used primers for successful amplification of our constructs is shown in table 4.

Table 4: PCR conditions for successful amplification.

Primers (5'-3') used for successful amplification:

Vector_gib_ara_f: TACTAGTAGCGGCCGCTG
Vector_gib_ara_r: CTAGTAGTCTTCTTTCTCCTCTTTGCTAGTAG
araBAD_NisA_YL_f: GCAAAGAGGAGAAAGAAGACTACTAGATGTATGCGGCGTATCATC
araBAD_NisA_r: TGCAGCGGCCGCTACTAGTATTATTTGCTTACGTGAATACTACAATG
araBAD_NisA_LY_f: GCAAAGAGGAGAAAGAAGACTACTAGATGAGTACAAAAGATTTTAACTTGGATTTG
araBAD_NisA_r: TGCAGCGGCCGCTACTAGTATTATTTGCTTACGTGAATACTACAATG
araBAD_NisA_LY_f: GCAAAGAGGAGAAAGAAGACTACTAGATGAGTACAAAAGATTTTAACTTGGATTTG
araBAD_NisA_B_overhang_r: CTAACAAAATACTATCCTTTGATTTGGTTATTTGCTTACGTGAATACTACAATG
araBAD_NisBTCIP_f: CCAAATCAAAGGATAGTATTTTGTTAG
araBAD_NisBTCIP_r: TGCAGCGGCCGCTACTAGTACATTACTTCATTATACCATTCATTCTG

Templates we used in the PCRs listed above to get our constructs:

Vector-ara-pBAD-RBS: BBa_K2848000

Nis-YL: gblock_Promoterlong__YAAY_leader_his6_NisA

GATTCTAGAGAGACATACTTGAATGACCTAGTCTTATAACTATACTGACAATAGAAACATTAACAAATCTAAAACAGTCT
TAATTCTATCTTGAGAAAGTATTGGTAATAATATTATTGTCGATAACGCGAGCATAATAAACGGCTCTGATTAAATTCTG
AAGTTTGTTAGATACAATGATTTCGTTCGAAGGAACTACAAAATAAATTATAAGGAGGCACTCAAAATGTATGCGGCGTA
TCATCATCATCATCATCATAGTACAAAAGATTTTAACTTGGATTTGGTATCTGTTTCGAAGAAAGATTCAGGTGCATCAC
CACGCATTACAAGTATTTCGCTATGTACACCCGGTTGTAAAACAGGAGCTCTGATGGGTTGTAACATGAAAACAGCAACT
TGTCATTGTAGTATTCACGTAAGCAAATAaACTAGTTAG

NisA-LY and NisA-LY-NisB-overhang: gblock_Promoter-long_leader_YAAY_his6_NisA

GATTCTAGAGAGACATACTTGAATGACCTAGTCTTATAACTATACTGACAATAGAAACATTAACAAATCT
AAAACAGTCTTAATTCTATCTTGAGAAAGTATTGGTAATAATATTATTGTCGATAACGCGAGCATAATAAACGGCTCTGA
TTAAATTCTGAAGTTTGTTAGATACAATGATTTCGTTCGAAGGAACTACAAAATAAATTATAAGGAGGCACTCAAAATGA
GTACAAAAGATTTTAACTTGGATTTGGTATCTGTTTCGAAGAAAGATTCAGGTGCATCACCACGCATCTATGCGGCGTAT
CATCATCATCATCATCATATTACAAGTATTTCGCTATGTACACCCGGTTGTAAAACAGGAGCTCTGATGGGTTGTAACAT
GAAAACAGCAACTTGTCATTGTAGTATTCACGTAAGCAAATAaACTAGTTAG

NisBTCIP: Lactococcus lactis NZ9700 gDNA

Agarose gel electrophoresis

For testing which amplification was successful, agarose gel electrophoresis in horizontal chambers was used. The electrophoresis was performed using 1% TAE agarose (Agarose LE, Genaxxon) gels with ethidium bromide in 1x TAE buffer. The gel was loaded with 4 µL of the amplification product and 1x Gel Loading Dye Purple (NEB). As marker served the Quick-Load Purple 1 kb Plus DNA Ladder (NEB). The running conditions were between 4-5 V/cm. The results were documented with the DIANAII raytest DARKROOM system.

Gibson assembly

The final constructs were built using Gibson assembly. For that purpose, the amplicons of vector and inserts with their overhangs respectively were purified using Monarch PCR & DNA Cleanup Kit (NEB) following manufacturer's protocol. For Gibson assembly 10 µL Gibson Assembly Master Mix 2x (NEB) with 100 ng vector and insert(s) in 3x molar excess to vector was used. The reaction was done in a total volume of 20 µL. The mix was then incubated at 50 °C for 1 h.

Transformation

For heat shock transformation chemically competent E. coli DH5α or BL21 (DE3) were used. 5 µL of the Gibson reaction were added to 50 µL of competent cells. The mix was then incubated on ice for 30 min. Subsequently the cells were heat shocked for exactly 30 s at 42 °C and placed on ice for 5 min. The transformation mix was then resuspended in SOB medium incubated at 37 °C, 180 rpm for 1 h. The whole mix was then plated on LB_Cm-plates and incubated at 37 °C for 24 h.

Cultivation

For pre-culture 2 mL LB_Cm medium was inoculated with single colonies and incubated at 37 °C for 20-24 h.

Mini prep

Pre-culture was used for mini prep with Monarch Plasmid Miniprep Kit (NEB) following manufacturer's protocol and concentrations were measured using NanoDrop.

Sequencing

To check successful cloning of the final constructs, 5 µL of each purified plasmid DNA with concentrations ranging from 70-100 ng/µL were sequenced with 5 µL of sequencing primers (5 µM) in a total volume of 15 µL using LightRun (GATC, Eurofins).

Primers used for sequencing:

VF2: 5'‑TGCCACCTGACGTCTAAGAA‑3'
VR: 5'‑ATTACCGCCTTTGAGTGAGC‑3'

Generation of basic BioBrick

For generation of the basic BioBrick our composite BioBrick BBa_K2848004 was source. 1 µg BBa_K2848004 was digested with 1 µL XbaI (NEB) and BbsI respectively in 1x Buffer G (both from Thermo Fisher) at 37 °C for 1 h. The digest was checked with agarose gel electrophoresis (as described above). The upper band was cut out and cleaned up with Zymoclean Gel DNA Recovery Kit (Zymogen). Afterwards 2 µL of the cleaned up fragment was ligated with 2 µL T4 DNA Ligase in 1x T4 Buffer (both NEB) in a total volume of 20 µL. The mix was incubated for 45 min at room temperature and 5 µL were transformed, plasmid-DNA purified and sequenced as described above, resulting in our basic BioBrick BBa_K2848003.

Nisin expression

BBa_K2848004 was transformed into chemically competent E. coli DH5α. A single colony was inoculated in 2 mL LB_Cm and did grow for 1 h. This was used as inoculum for 200 mL SOB_Cm and 200 arabinose (1 g/L) was added to induce Nisin expression. This was cultivated at 37 °C and 180 rpm over night.

SDS-PAGE

Load 20 µL of samples (diluted with 5x loading buffer)
Run 8 % polyacrylamide-gel at 100 V, 120 min
Stain the gel with Coomassie staining solution for at least 1 h
Destain the gel until you can see protein bands (eventually over night)

Western-Blot

Clean polyacrylamide gel with ddH₂O
Blotting:
- Add 3 Whatman-paper soaked in blot-buffer to the blotting machine
- Soak nitrocellulose membrane in blot-buffer and add on top of the Whatman-Paper
- Add polyacrylamide gel
- Add 3 Whatman-paper soaked in blot-buffer
- Remove airbubbles with roller
Run blotting machine (110 mA per gel, 10-12 V)
Block the nitrocellulose membrane in Roche-Block Solution for 30 min
Incubate membranes with antibody in Roche-Block Solution for 1 hour
Wash in wash-buffer 3 x 3 min

Silver-staining

15 min incubation of the gel in fixative
Wash two times with ddH₂O for 5 min
Incubate in sodium thiosulfate solution for 1 min
Wash three times with ddH₂O for 20 s
Incubation in silver nitrate solution for 10 min
Wash three times with ddH₂O for 20 s
After the washing steps incubate in developer solution until protein bands are visible
Stop the reaction immediately with stop solution

Protocols Rhamnolipid

Pre-culture: of Pseudomonas putida K2440 and E. coli storage in 50 % glycerol stocks

Transformation: of Biobricks rhlA (BBa_K1331001, Plate 5 Well 9L), rhlB (BBa_K1331002, Plate 5 Well 9N), araC (BBa_K808000, Plate 2 Well 7E), mRFP (BBa_J04450) as well as rhlC (pVLT33) in E. coli DH5α as described in the iGEM Protocol:

Resuspend the DNA and add to the competent cells
Incubate on ice for 30 min, heat shock at 42 °C for 45 s and again incubate on ice for 5 min
Add YT media and incubate at 37 °C for 1 h
Pipette 100 µL onto petri plates
Spin down the cells for 3 min, discard the supernatant and resuspend the cells in remaining 1
Again pipette onto petri plates and incubate everything overnight (14-18 h) at 37 °C

Cultivation: of each transformation in LB media by picking a single colony and cultivate overnight at 37°C

Miniprep: for plasmid cleanup (Jena Bioscience)

Centrifuge overnight culture and resuspend
Add Lysis Buffer, invert and incubate for 1-2 min
Add neutralization buffer, invert and centrifuge for 5 min
Activate the Binding column with activation buffer
Transfer supernatant on the activated column, shortly centrifuge, add wash buffer (with Ethanol) and centrifuge again
Wash again, centrifuge and put column in a clean 1.5 mL microtube
Add Elution Buffer or dd-H₂O, incubate, centrifuge for 1 min and store at -80 °C

PCR: using a Q5 polymerase

Primer concentration of 10 µM, amount of DNA between 1 pg*µL^-1 and 3 ng*µL^-1

Program as described below:

98 °C for 1 min 30 s
cycle: 35 times in a row
98 °C for 10 s
Temperature gradient starting 5 degree below T_m for 45 s
72 °C for 60 s
72 °C for 2 min

Protocols Linkage

Chemical linkage

The experiments for chemical linking of rhamnolipids to chitosan were conducted following protocols established by Hinner et al. 2016 [L.1] and personal communication with the first author.

All reactions are carried out at a 80 °C in ionic liquid 1-ethyl-3-methyl-imidazolium acetate ([EMIM]OAc) under continuous stirring.

General procedure:

Dissolve 1 % (w/v) Chitosan in [EMIM]OAc at 80 °C for 30 min
Add rhamnolipid to the chitosan and dissolve for 30 min
To start the reaction, add the divinyladipate to the mixture
Stop the reaction by adding H₂O after 2 h
The product precipitated overnight at 4 °C
Afterwards, dialyze the polymer overnight against 1 L of PBS
Antimicrobial effects can be examined by antimicrobial assay

Antimicrobial assay:

Inoculate overnight cultures of E. coli, C. glutamicum, L. lactis, B. subtilis and S. cerevisiae in 5 mL appropriate medium (LB or Yeast medium).
Plate 100 µL of overnight culture on LB agar plates
Divided the plate into different areas (e.g. control, TAGC, foil, ...) and place the substances in the plate
After incubation, evaluate the growth of the microorganisms
Remove the tested surfaces and incubate the plates again
Afterwards, check the plate for growth of new colonies on previous covered spots

It was first planned to analyze the reaction product by IR spectometry. During the experiments, the IR spectometry had not proved as an appropriate method for analyzing. We were not able to identify the successful ester formation in the spectograph. Therefore, different reaction controls were investigated.

The reaction was optimized to yield the best polymer properties and antimicrobial effect. Therefore, the molecular ratios between AGU (anhydro glucose unit), divinyladipate and rhamnolipids were varied (1:1:1, 1:2:1, 1:2:2).

Enzymatic linkage

There exist diverse publications (e.g. Freddi et al. (2006) [L.2], Chen et al. 2003 [L.3]), describing the linkage of proteins to chitosan by tyrosinase. Hereby, the tyrosinase oxidizes tyrosine residues from the proteins. The oxidized tyrosine residues can react with the amino group of the chitosan by formation of a covalent bond.

Tyrosinase activity assay:

The tyrosinase was ordered CAS: 9002-10-2 and tested for activity by enzyme assay.

Dilute tyrosine solution in a 96-well plate to different final concentrations (2, 1, 0.5, 0.25, 0.125 mM) with 50 mM phosphate buffer pH 6.0.
Start the reaction by adding 100 µL of tyrosinase (1 U) to the 100 µL tyrosine in the well
Measure the absorbance at 280 nm with a plate reader every minute for 30 min in total
Plot the data and calculate the reaction parameters

Linkage of GFP to chitosan:

To establish the linkage of proteins to chitosan by tyrosinase in our lab, the experiments were conducted with GFP as protein. Our antimicrobial peptide posesses no tyrosine residue in it's native form. Two different protocols were tested for linkage, according to the publications above.

Protocol 1:

Dilute chitosan stock solution 1:2 in phosphate buffer pH 6.5 and adjust pH to 6.5 with 0.5 M NaOH
Add 0.5 mL GFP (14 mg/mL) and 100 µL tyrosinase to 4 mL chitosan solution
Incubate the mixture at room temperature under continuous shaking for 3 days (open vessel for oxygen!)
Take samples at different time points (start, 24 h, 48 h, end)
Centrifuge samples and analyze supernatant by PAGE

Protocol 2:

Dilute chitosan stock solution 1:2 in phosphate buffer pH 6.0 and adjust pH to 5.8 with 0.5 M NaOH
Add 50 µL tyrosinase to 500 µL GFP and incubate for 3 days at room temperature, shaking (open vessel for oxygen!)
Afterwards, add 2 mL of chitosan solution (mentioned above) to the batch. Incubate the mixture subsequently for 3 more days
Take samples at different time points
Centrifuge samples and analyze supernatant by PAGE

GFP purification:

Defrost GFP containing E. coli filtrated cell suspension and resuspend in PBS
Disrupt cells by high-pressure homogenizer (3 cycles)
Centrifuge to separate protein containing supernatant from debris
Purificate GFP by his-tag chromatography(ÄKTA). Use TRIS buffer (50 mM, pH 7.6) was for equilibration, loading and washing steps. Bound protein can be eluted by 50 mM TRIS-buffer pH 7.6 containing 500 mM imidazole
Subsequently, dialyze the GFP containing fraction against 3 L phosphate buffer (50 mM, pH 6.5) overnight
Determine protein concentration by nano drop

References

[C.1] Colorimetric assay of chitosan in presence of proteins and polyelectrolytes by using o-phthalaldehyde. N.I. Larionova, D.K. Zubaerova, D.T. Guranda, M.A. Pechyonkin, N.G. Balabushevich. Carbohydrate Polymers. 2009. 75, Issue 4, pp 724-727, doi.org/10.1016/j.carbpol.2008.10.009.

[L.1] Homogeneous vinyl ester-based synthesis of different cellulose derivatives in 1-ethyl-3-methyl-imidazolium acetate. L. P. Hinner , J. L. Wissner , A. Beurer , B. A. Nebel and B. Hauer. Green Chemistry. 2016. Volume 18, pp 6099-6107.

[L.2] Tyrosinase-catalyzed modification of Bombyx mori silk fibroin: grafting of chitosan under heterogeneous reaction conditions. G. Freddi, A. Anghileri, S. Sampaio, J. Buchert, P. Monti, P. Taddei. Journal of Biotechnology. 2006. Volume 125, Issue 2, pp 281-294.

[L.3] Enzyme-catalyzed gel formation of gelatin and chitosan: potential for in situ applications. T. Chen, H.D. Embree, E.M. Brown, M.M. Taylor, G.F. Payne. Biomaterials. 2013. Volume 24, Issue 17, pp 2831-2841.

Team:Stuttgart/Experiments

Experiments

Media