Team:UofGuelph/Notebook
Notebook
THURSDAY, 5/17/2018
Media Prep
LB Broth
In a 500mL Kimax bottle, added:
- 500mL ddH2O
- 12.5g Difco LB Broth Shook well to combine
Autoclaved in CRSC 4th Floor Common Lab P15 (15 minute exposure liquids cycle)
LB Agar
In a 1L Erlenmeyer flask, added:
- 1000mL ddH2O 40g Difco LB Agar Stir bar
Allowed to mix on stir plate for 30 minutes
Autoclaved in CRSC 4th Floor Common Lab P15 (15 minute exposure liquids cycle) Returned to stir plate to cool until just comfortable to the touch
Added:
- 1mL 35mg/mL Chloramphenicol stock (prepared 16 May 2018 by Jehoshua Sharma) Mixed for 6 minutes
Poured 3 plates (single green stripe)
Added:
- 820-825μL 50mg/mL Kanamycin stock (prepared 30 August 2017 by Danielle Rose) Mixed for 6 minutes
Poured ~46 plates Chlor+ Kan (green and blue stripe)
Poured 6 double thick plates Chlor + Kan (double green double blue stripe) Packaged and stored in the fridge.
SATURDAY, 5/19/2018
Making Competent Cells
Day 1
BL21 (DE3) pLysS strains from Georgina Cox were inoculated into 5 ml of LB-Cham (5 ml of LB, 5uL of Chloramphenicol).
DH5a strains from Georgina Cox were inoculated into 5 ml of LB.
They were placed in the warm room on third floor, shaking (275 rpm) at 37°C to be grown overnight.
Day 2
5 mL seed culture of cells were grown in LB medium to saturation.
Culture was diluted back into 25–50 mL fresh LB in a 250 mL Erlenmeyer flask.
Seed culture was diluted by at least 1/100. Diluted culture was grown to an OD600 = 0.4 - 0.5
Eppendorf tubes were put on ice so they were cold when the cells were aliquotted into them later.
TSS was chilled.
The culture was split into two 50 mL falcon tubes and incubated on ice for 10 min.
All subsequent steps were carried out at 4°C and the cells were kept on ice wherever possible
Cells were centrifuged for 10 min at 3000 rpm and 4°C.
Supernatant was removed and any remaining media was pipetted out.
Cells were resuspended in 2.5 mL of chilled TSS buffer (5% of initial volume).
Cells were chilled on ice for 15 minutes.
50-200 μL aliquots were added to the chilled eppendorfs and and flash frozen with liquid nitrogen.
Cells were stored at -80°C.
Bacterial Transformations
pET-28a-Pst1
Oxc-EcoRI-pst1 @10.9ng/ul
Frc-EcoRI-pst1 @ 11.5ng/uL
These plasmids were from last year's iGEM freezer box and each of them were transformed into DH5a competent cells using the following protocol.
The competent cells were taken out of the freezer and were sat on ice for 10 minutes.
The cells were lightly vortexed on the lowest setting for 10 seconds.
15 uL of the transformed plasmid DNA was added directly to the microtube containing the competent cells and pipetted to mix.
The microtube was incubated on ice for 30 minutes.
The microtube was heat shocked at 42°C for exactly 30 seconds.
The cells were then put back on ice for another 5 minutes.
950uL of SOC media (from the Shapiro lab) was added into each tube.
The tubes were placed in an epitome holder and then grown in a 250 rpm shaker for 1 hr.
While the tubes were on the shaker for 1 hr, the LB - Kan (50 ug/mL) plates were taken out and warmed up in a 37°C static incubator for 1 hr.
The cells were taken out of the shaker and then transferred to the LB-Kan plate using a pipette and sterile glass beads. The plates were incubated overnight at 37°C
TUESDAY, 5/22/2018
Patch Plates
Inoculated one LB-Kan plate with 6 patches of pET28a-PstI(2) from source plate "J.S. 20 May 2018"
Sealed and incubated at 37C.
Plate Check
Parafilmed all plates in 4C fridge
THURSDAY, 5/24/2018
Created Schemas specific to plasmids, oligos (primers), DNA sequences, bacterial strains, and yeast strains. Can be found under the "Registry" tab
Created registered plasmid pGEM001 (AKA pSB1C3) - the standard plasmid backbone for submission of BioBrick parts to iGEM HQ
Created registered basic DNA sequences dGEM001 (AKA OXC_Basic), dGEM002 (AKA FRC_Basic) and dGEM003 (AKA oxIT_Basic)
Each of these are the BASIC DNA sequences only; these will likely not ever be present in a physical form, as we will have them synthesized with the appropriate RE sites and other modifications on either end
These are to be treated as basic reference sequences only
New registered versions of each will be created upon ordering and receipt of synthesized sequences
Making 1000x Kanamycin
50 mg/mL tubes of Kanamycin were made using 50 mg of Kan added to 1 mL of water in epitomes and stored at -20°C
Miniprep of PET-28a-PstIDay 1
PET-28a-PstI-DH5a strains from Sunday 20th May Transformations were inoculated into 5 ml of LB-Kan, using the following protocols.
One Kanamycin epitube was removed from the freezer, then warmed by hand and vortexed until the Kan was completely resuspended in liquid solution.
5 μL of Kan was added to 5 mL of LB, then vortexed.
50 μL of pET-28a-PstI strains were inoculated into the LB-Kan solution.
Tubes were vortexed, then placed in the warm room on third floor, shaking (275 rpm) at 37°C to be grown overnight.
MONDAY, 5/28/2018
Miniprep of Pet-28a-PstI
PstI culture was dispensed into 1 mL aliquots in 1.5 mL epitubes (total of 4 tubes). The tubes were centrifuged at 3000 rpm for 5 min.
Supernatant was discarded. Another 1 mL of PstI culture was added to the tubes. They were centrifuged again at 3000 rpm for 5 min, and the supernatant was discarded.
250 μL of resuspension solution (from GeneJET miniprep kit) was added. The bacteria were completely resuspended by pipetting up and down until solution was clear.
250 μL of lysis solution from kit was added. The mixture was mixed thoroughly by inverting the tube 4-6 times, then incubated for 5 min at room temperature.
350 μL of neutralization solution from kit was added, then mixed by inversion and incubated for 5 min at room temperature.
Tube centrifuged for 5 min at 12000 rpm to pellet cell debris and chromosomal DNA.
Supernatant was transferred to GeneJET spin column (in collection tube) by pipetting, avoiding disturbing or transferring the precipitate.
Spin column was centrifuged for 1 min at 12000 rpm. Flow-through was discarded and the column was placed back in the same collection tube.
500 μL of wash solution (pre-diluted with ethanol) from kit was added to spin column. Column was centrifuged for 1 min at 12000 rpm and flow-through was discarded again.
The previous step was repeated using another 500 μL of wash solution.
Flow-through was discarded and column was centrifuged for an additional 1 min to remove residual wash solution.
Spin column was transfered to a fresh 1.5 mL microcentrifuge tube. 50 μL of elution buffer from kit was added to center of the membrane, taking care not to touch the membrane with the pipette tip. Column was incubated for 2 min at room temperature, then centrifuged for 2 min at 12000 rpm.
Column was discarded.
The miniprep of PstI was nanodropped using the elution buffer as the blank
The results were:
○ Tube 1: 20.6 ng/uL A260/A280: 1.86
○ Tube 2: 19.5 ng/uL A260/A280: 1.84
○ Tube 3: 21.2 ng/uL A260/A280: 1.92
○ Tube 4: 18.4 ng/uL A260/A280: 1.87
Tubes 1, 2, and 4 of purified plasmid DNA was stored at -20C.
Tube 3 was digested by double digestion.
Double Digestion:
The digest was incubated at 37°C for 1 hour and then run on a gel.
PCR Conditions:
OXC Primers
CCCGAATTCATGAGTAACG
TTTCTGCAGCTATTATTTCTTGCC
Results for Platinum SuperFi DNA polymerase - Thermofisher
FRC Primers
GGGGAATTCATGGGTAGCAAAGC
GGGCTGCAGTCATTATTTCGCTTTTTTCGG
Results for Platinum SuperFi DNA polymerase
The gel of the digestion was run with no visible bands seen and so the the digestion will have to be repeated.
The gel of the PCR had no bands and the annealing temperature may have been the reason for this.
Two new 5 mL cultures of pSTI-LB-Kan were prepared, and placed in the warm room on the 3rd floor to incubate overnight, shaking at 375 rpm.
TUESDAY, 5/29/2018
Miniprep of PstI
Minipreps of DH5a-pET28a-PstI were prepared as described under the heading "Miniprep of Pet-28a-PstI" on May 28th using the PstI-LB-Kan cultures prepared the previous night, with the exception that in step (1), the entirety of the culture was only dispensed into two epitubes instead of four. The tubes were centrifuged, discarding the supernatant, a total of five times so that the number of cells placed in each epitube was equivalent to the number of cells present in 5 mL of LB-Kan culture.
Once completed, the optical density of the minipreps was measured using the Nanodrop, with the elution buffer used in the miniprep procedure as the blank. The results were as follows:
Tube 1: 55.5 ng/μL A260/A280: 1.88
Tube 2: 49.9 ng/μL A260/A280: 1.88
Tube 2 was stored overnight at -20C.
Restriction enzyme double digestion
20 μL of plasmid DNA from Tube 1 was digested using the following procedure (the remaining DNA in Tube 1 was stored overnight at -20C):
- 20 μL of DNA from Tube 1 was pipetted into a new epitube.
- 1 μL of EcoRV was added to the tube.
- 1 μL of PstI was added to the tube.
- 2.5 μL of Cutsmart buffer was added.
- 0.5 μL of water was added.
Contents were mixed by light vortexing, and tube was incubated overnight at 37C.
FRIDAY, 6/1/2018
Restriction Enzyme Double Digestion
A miniprep was prepared to the following expectations:
- 20uL plasmid DNA was placed into a new epitube
- 1uL EcoRV was added
- 1uL PSTI was added
- 2.5uL Cutsmart buffer was added
- 0.5uL water was added.
However, the liquids were loaded on to the side of the tube, so a second miniprep was created 2nd Miniprep was prepared to the following expectations:
- Approx. 8uL of plasmid DNA was placed into a new epitube
- 1uL EcoRV was added
- 1uL PSTI was added
- 2.5uL Cutsmart buffer was added
- 5.5uL water was added
Running the Gel of 3 Days Double Digest
There was 2uL of dye and 5uL of DNA combined
7uL of ladder was used
The layout of the gel was 1% 40mL gel therefore 0.4 agarose
The layout was L-JSdd-L-NWdd-b-b-b-[L?]
It was run at 93V for 1 hr.
The results were imaged using Gel Dock and the results were positive, meaning that both the restriction sites (PST1 and ECOR1) were inside the plasmid.
SATURDAY, 6/2/2018
Gel Run of Double Digests
First attempt was unsuccessful, we think it ran off the end of the gel. We re-ran the gel with modified amounts.
PCR Purification
PCR samples of FRC and OXC as prepared by Jehoshua Sharma were purified.
The 4th purple sample from the PCR strips of each were used
25uL of each sample was available, and processed according to the standard protocol.
Tubes were labelled as "FRC PCR Pure" and "OXC PCR Pure"
Tubes were stored at -20C in Freezer Box 1
SUNDAY, 6/3/2018
Ligation
Completed according to the following protocol: DNA Ligation (Anza T4 DNA Ligase Mastermix - Invitrogen)
Labelling of tubes, each with respective FRC or OXC as prepared by Jehoshua Sharma
- ECDD2 - Source tube Double Digest #2 prepared by Eleanor Cloves
- PST1-4 - Source tube "PST1 4" prepared by Nicole LeBlanc
- MiniNW - Source tube "PSTI undig." prepared by Nathanael Willms
The following concentrations of all components were confirmed using the NanoDrop Lite:
The following amounts were used (calculated using the Promega Biocalculator):
2uL of each sample was used for the Transformation (next) and the remainder was stored at 4C until further use.
Transformation
Competent DH5a cells were transformed according to the protocol Transformation (NEB)
Due to lack of an available 37C shaker/incubator, cells were placed into a cup of 42C water from our incubator, which was then placed into 25C water in the shaker incubator in the MICRO lab next door.
The heat was turned on and set to 37C but the cup of warm water was used to avoid stressing the cells during heat-up.
Uniform 37C was achieved within 10 minutes
SOC Media (April 2) was used for the transformation
LB+Kan Plates were used for selection
100uL cells were plated and spread using glass beads
plates were dried for approximately 10 minutes benchtop, then sealed and incubated upside down at 37C
Remaining transformed cells were stored in Freezer Box 1 at -20C
MONDAY, 6/4/2018
Patch Plating
The 6 plates from the transformation were patch plated onto three additional LB-Kan plates
- ECDD2 FRC and ECDD2 OXC were patch plated onto the same plate
- PST1-4 FRC and PST1-4 OXC were patch plated onto the same plate
- MiniNW FRC and MiniNW OXC were patch plated onto the same plate
From each plate, 6 colonies were patch plated and labelled on both the original plate and the patch plate
Patch plates were incubated at 37°C
Original plates were wrapped in foil and stored in 4°C fridge
Liquid Culture Inoculation (in preparation for glycerol stocks)
1. Make o/n of a-d to create glycerol stocks
- DH5a - LB
- DH5a-pET-28a - LB-Kan
- BL21 (DE3) pLysS - LB-Cam
- DH5a-pET-28a-PstI - LB-Kan
2. Made 5 mL LB and 5 μL Kan or Cam per tube In preparation for a miniprep tomorrow
Made 3 tubes of pET-PstI from 22-May-2018 Patch Plate from Nykole because the 20-May-2018 JS pET-28a-PstI.
TUESDAY, 6/5/2018
Miniprep and Double Digestion
50 μL minipreps of pET28a-PstI were created in two epitubes, using the protocol outlined above. Two culture tubes from the previous day containing 5 mL DH5a-pET28a-PstI-LB-Kan were centrifuged at 1500 rpm for five minutes in the centrifuge next to the fridge in order to pellet out the cells (a slower speed than usual was used because the centrifuge is old and its safety was uncertain). During the process, 300 μL of Lysis buffer was added to each tube by accident instead of 250 μL, so 400 μL of neutralization solution was added instead of 350 μL in order to compensate for this. After the miniprep was complete, the optical density of the minipreps was measured using the Nanodrop. The density, A260, and A260/A280 of each miniprep was labeled on the side of each epitube. 20 μL of the miniprep with a density of 30.2 ng/μL was pipetted into a separate epitube to be digested, while the miniprep tubes were also labelled on the lid and then placed in the freezer.
A restriction enzyme double digest using PstI and EcoRV was conducted on 20 μL of pET28a-PstI using the procedure outlined above. The digest was then labelled and placed overnight in the incubator next door.
PCR of FRC and OXC
A PCR was done adding the RE ends to FRC and OXc as described prior.
Making Gels
Two gels were prepped, then cling-wrapped and placed in the fridge overnight in order to run the PCR FRC and OXC samples in the morning.
WEDNESDAY, 6/6/2018
Made 3 gels
The gel's of yesterday's PCR were ran with slightly visible bands.
WEDNESDAY, 6/13/2018
Miniprep
The samples Nykole had made of PST1 was miniprepped by Jehoshua. The results of the two tubes were:
PST1 Miniprep June 13th: Concentration 37.6ng/uL. 260/280 is 1.92
PST1 Miniprep June 13th: Concentration 36.8ng/uL 260/280 is 1.93
MONDAY, 6/18/2018
Double Digest
Double digests were prepared with the following ingredients:
20 μL of DNA from
- 06-13-18's Miniprep of Pst1 [37.6]
- FRC PCR from 06-09-18
- OXC PCR from 06-09-18
1uL EcoRI was added
1uL PSTI was added
2.5uL Cutsmart buffer was added
1.0uL water was added
Double digestion was incubated at 37°C for 3 hours (from 1:30 pm-4:30 pm)
Digestion Clean Up
After the digestion, the sample was cleaned up using a Thermo Scientific PCR Purification kit
Ligation
Prepared the ligation reaction of FRC and OXC into PSTI vector according to the protocol: DNA Ligation (Anza T4 DNA Ligase Mastermix - Invitrogen)
TUESDAY, 6/19/2018
Bacterial Transformation
Two of Rebecca Shapiro's competent cells and 2 of tubes of the ones made on 05-19-18 were taken out of the freezer and were sat on ice for 10 minutes.
The cells were lightly vortexed on the lowest setting for 10 seconds.
The two ligations were taken out of the fridge and had 15 uL of the transformed plasmid DNA was added directly to the microtubes containing the competent cells and pipetted to mix.
The microtube was incubated on ice for 30 minutes.
The microtube was heat shocked at 42°C for exactly 30 seconds.
The cells were then put back on ice for another 5 minutes.
950uL of SOC media (from the Shapiro lab) was added into each tube.
The tubes were placed in an epitome holder and then grown in a 250 rpm shaker for 1 hr.
While the tubes were on the shaker for 1 hr, the LB - Kan (50 ug/mL) plates were taken out and warmed up in a 37°C static incubator for 1 hr.
The cells were taken out of the shaker and then transferred to the LB-Kan plate using a pipette and sterile glass beads. The plates were incubated overnight at 37°C
TUESDAY, 6/26/2018
Miniprep of Pet-28a-PstI
Overnights of pET28a-PstI control culture and designated samples from 25 June 2018 (FRC 13-RS, FRC 14-RS, FRC 15- RS, FRC 19-RS, FRC 20-RS, OXC 11-RS, OXC 12-RS, OXC 13-RS, OXZC 19-RS, OXC 20-RS) were dispensed into 1 mL aliquots in 1.5 mL epitubes (total of 4 tubes). The tubes were centrifuged at 3000 rpm for 5 min. Supernatant was discarded. Another 1 mL of each culture was added to the tubes. They were centrifuged again at 3000 rpm for 5 min, and the supernatant was discarded.
MiniPrep was performed according to Plasmid Miniprep (GeneJet Kit Thermofisher) protocol and the values were nanodropped and recorded
Tubes 1, 2, and 4 of purified plasmid DNA was stored at -20C.
Double Digestion:
Tube 3 and 5 were digested by double digestion.
Using the 60uL of each sample eluted from the miniprep, two separate digestion protocols were run with EcoRI and PstI○ 25uL was used for each protocol
- 10uL remaining in tube undigested to be run alongside Seah samples on gel later today
Protocol A - Seah
- 25 μL of plasmid DNA from each sample was digested using the following procedure (remaining DNA in tubes stored at -20C):
- note: 25uL of each sample DNA is to be used (modified protocols)
Protocol A Digestion
25 μL of plasmid DNA from each sample was digested using the following procedure (remaining DNA in tubes stored at -20C):
Overnight protocol labelled as 24h
Protocol B Digestion
20 μL of DNA from Tube 1 was pipetted into a new epitube.
1 μL of EcoRV was added to the tube.
1 μL of PstI was added to the tube.
2.5 μL of Cutsmart buffer was added.
0.5 μL of water was added.
- Contents were mixed by light vortexing, and tube was incubated overnight at 37C.
WEDNESDAY, 7/4/2018
40 μL minipreps of OXC 11-RS, OXC 12-RS, OXC 13-RS, FRC 13-RS, FRC 19-RS, and FRC 20-RS were created from 5 mL LB-Kan overnights that had been prepared the night before and had been shaking at 37 C. The overnights of OXC 13 and FRC 20 had been inoculated with 6 μL of Kanamycin rather than 5 μL in order to see if plasmid non-retention was causing decreased yields.
The minipreps were carried out using spin columns and reagents provided by Dr. Seah, and according to the miniprep protocol. Samples were then quantified using a nanodrop.
WEDNESDAY, 8/15/2018
Four 50 uL minipreps of PstI were created, using 3 mL LB-Kan overnights of DH5a-pET28a-PstI, using the standard GeneJET plasmid miniprep kit protocol (details in lab book).
Nanodrop results on Slack.
A new plate of DH5a-pET28a-PstI was prepared from NW June 24 and left to incubate overnight.
THURSDAY, 8/16/2018
A 1% gel was run of the double digest and confirmed the presence of FRC and OXC in pET-28a.
