Team:Thessaloniki/Experiments

Protocols

Protocols

Frozen Competent Cells

Materials

• Plate of cells to be made competent
• LB Broth
• CaCl2 solution 0,1M
• 100% glycerol
• Ice

Method

1. Inoculate 1 colony from a freshly grown plate into 50ml broth
2. Incubate cells overnight at 37°C in a shaking incubator (200-250 rpm)
3. Transfer cells into 500 ml LB Broth in a 500ml E. flask
4. Incubate at 250-300 rpm and 37°C for approx. 2,5 hours (or OD = 0.5). Centrifuge at 5000 rpm and 4°C for 15 min
5. Remove supernatant and resuspend pelleted cells in 250 ml 0,1 M CaCl2 solution
6. Incubate on ice for 20 min
7. Centrifuge at 5000 rpm for 15 min
8. Remove supernatant and resuspend pelleted cells in 43 ml 0,1 M CaCl2 solution
9. Incubate on ice for 2-12 hours
   Note: Maximum Incubation at 24 hours. Efficiency of Transformation is gradually reduced afterwards
10. Add 7ml 100% glycerol, mix well
11. Aliquot cells into prechilled 15ml tubes
12. Quick freeze in liquid nitrogen
13. Store (-80°C)

Fresh Competent Cells

Materials

• Plate of cells to be made competent
• LB Broth
• CaCl2 solution 0,1M
• Ice

Method

1. Inoculate 1 colony from a freshly grown plate into 50ml LB Broth in a 500ml E. Flask
2. Incubate at 250-300 rpm and 37°C for approx. 3 hours (or until OD600 is about 0,375)
   Note: Transformation Effeciency will decrease if cells are allowed to grow to a density greater than 0,4 OD
3. Centrifuge 3000 rpm and 4°C for 7 minutes. No brake.
4. Remove supernatant and drain the tubes by keeping them inverted on an absorbent paper for 1 minute
5. Resuspend pelleted cells in 10ml ice-cold CaCl2 solution by pipetting gently up and down. Make sure that cells are fully resuspended. Keep on ice for 5 min
6. Centrifuge 3000 rpm and 4°C for 7 minutes. No brake.
7. Remove supernatant and drain the tubes by keeping them inverted on an absorbent paper for 1 minute
8. Resuspend pelleted cells in 2ml ice-cold CaCl2 solution by pipetting gently up and down. Make sure that cells are fully resuspended. Keep on ice.
   Note: Increased transformation efficiency next 24h, decrease after the 24 hour mark.

Chemical Transformation

Materials

• Chemically competent cells
• DNA to be transformed
• LB agar with antibiotics
• Ice

Method

1. Thaw 100 μl of competent cells on ice.
   Note: Thawing at room temp decreases efficiency
2. Add DNA:
   1. For transformation of ligated products add 8μl of the ligation reaction mix
   2. For transformation of known plasmids add approx. 10-100 μg DNA
3. Incubate cells on ice for 30min.
   Note: Cutting this incub time short slightly decreases transformation efficiency.
4. Heat shock cells at 42°C for 90 sec.
   Note: Optimal heat shock duration depends on the strain and the method used to make it competent.
5. Incubate on ice for 5 minutes
6. Heat shock cells at 42°C for 90 sec
7. Incubate on ice for 5 minutes
8. Add 1ml of SOC or LB Broth.
   Note: Using SOC increases transformation efficiency.
9. Incubate cells for 1 hour at 37°C in a shaking incubator (200-250rpm).
   Note: Incubation without shaking will decrease transformation efficiency
   Note: If using LB Broth, longer incubation up to 2 hours can increase transformation Efficiency
10. Centrifuge at 8000rpm for 3 minutes
11. Remove 920μl of supernatant
12. Resuspend pelleted cells in the remaining LB broth or SOC.
13. Plate resuspended cells onto LB agar plates containing the appropriate antibiotic.
14. Let the plates dry in the incubator for approx. 30min.
15. Flip upside down and incubate for 16-18 hours.

Growing Overnight Cultures

Materials

• 5-10 ml LB broth
• 5-10 μl antibiotic
• culture tubes

Method

Overnight cultures are prepared under sterile conditions using a Bunsen burner

1. Add 5-10 ml ofLB media into a culture tubes.
2. Add 5-10 μl of appropriate antibiotic into the broth.
3. Using a loop, pick a single colony and inoculate the culture by dipping the loop into the LB broth.
4. Incubate overnight at 37°C shaking at 200-250 rpm.

LB Broth

Materials

• 20 g LB broth (powder)
• 1 Litre Purified Water

Method

1. Add 20g LB broth to 1 litre purified water
2. Autoclave

LB Agar

Materials

• 35 g LB Agar (powder)
• 1 Litre Purified Water

Method

1. Add 37g LB Agar to 1 litre purified water
2. Autoclave

SOC Medium

We followed the Quiagen protocol

Materials

• 0.5% Yeast Extract
• 2% Tryptone
• 10 mM NaCl
• 2.5 mM KCl
• 10 mM MgCl2
• 10 mM MgSO4
• 20 mM Glucose*

Notes

• Add Glucose after autoclaving the solution with the remaining ingredients, and letting it cool down. Sterilize the final solution by passing it through a 0.2 µm filter.
• SOC medium can be stored at room temperature and is stable for several years.

Glycerol Stocks

Materials

• 500µl glycerol (50%)
• 500µl overnight culture in LB

Method

1. Add 500µl glycerol (80%) to 1.5ml eppendorf tube
2. Add 500µl overnight culture in LB
3. Store at -80°C

PCR From Plasmid DNA Template

We followed the NEB PCR with hiFi Q5 master mix Protocol for our PCR reactions.

Materials

• 2x Q5 High-Fidelity Master Mix
• 10μΜ Forward Primer
• 10μΜ Reverse Primer
• Template DNA
• Nuclease Free Water

For a 20 µL reaction:

Q5 High-Fidelity 2X Master Mix	10 μl
10 µM Forward Primer	1 μl
10 µM Reverse Primer	1 μl
Template DNA	variable (1-5 ng)
Nuclease-Free Water	to 20 μl

Note: Reactions are set on ice

Thermocycling

Initial Denaturation	95°C	2 minutes
25-35 cycles	95°C (Denaturation)	0.5-1 minute
	42-65°C (Annealing)	0.5-1 minute
	72°C (Extension)	1 min/kb
Final Extension	72°C	5 minutes
Hold	4–10°C	Indefinite

Note: We used the NEB ™ Calculator to determine the annealing temperature.

Colony PCR

We followed the Promega GoTaq® DNA Polymeras Protocol for our Colony PCR reactions.

Materials

• 5X Green or Colorless GoTaq® Reaction Buffer1
• GoTaq® DNA Polymerase
• PCR Nucleotide Mix
• Forward Primer
• Reverse Primer
• Template DNA
• Nuclease Free Water

For a 50 μl PCR Reaction:

5X Green or Colorless GoTaq® Reaction Buffer1	10 μl
PCR Nucleotide Mix, 10mM each	1 μl
Forward Primer	1 μl
Reverse Primer	1 μl
GoTaq® DNA Polymerase (5u/µl)	0,25 μl
template DNA	variable (1-5 ng)
Nuclease-Free Water	to 50 μl

Method

We performed 10μl Colony PCR Reactions

Thermocycling

Initial Denaturation	98°C	30 seconds
25-30 cycles	98°C (Denaturation)	10 seconds
	50–72°C (Annealing)	30 seconds
	72°C (Extension)	30 seconds/kb
Final Extension	72°C	2 minutes
Hold	4–10°C	Indefinite

Notes: Perform PCR using your standard parameters

• Reactions are set on ice
• Reactions are placed in a thermal cycler that has been preheated to 95°C
• The thermal cycling protocol has an initial denaturation step where samples are heated at 95°C for 2 minutes to ensure that the target

Agarose Gel Electrophoresis

Equipment

• Casting tray
• Well combs
• Voltage source
• Gel box
• UV light source

Reagents

• TAE
• Agarose
• Ethidium bromide (stock concentration of 10 mg/mL)

Method

For a standard 1% agarose gel

1. Measure 1 g of agarose and mix agarose powder with 100 mL 1xTAE in a microwavable flask
2. Microwave for 1-3 min until the agarose is completely dissolved and let agarose solution cool down to about 50 °C
3. Add ethidium bromide (EtBr) to a final concentration of approximately 0.2-0.5 μg/mL. EtBr binds to the DNA and allows you to visualize the DNA under ultraviolet (UV) light
4. Pour the agarose into a gel tray with the well comb in place
5. Place newly poured gel at 4 °C for 10-15 mins OR let sit at room temperature for 20-30 mins, until it has completely solidified
6. Add loading buffer to each of your DNA samples
7. Once solidified, place the agarose gel into the gel box (electrophoresis unit). Fill gel box with 1xTAE (or TBE) until the gel is covered
8. Carefully load a molecular weight ladder into the first lane of the gel and your samples into the additional wells of the gel
9. Run the gel at 80-150 V until the dye line is approximately 75-80% of the way down the gel. A typical run time is about 40 minutes-1.5 hours, depending on the gel concentration and voltage
10. Turn OFF power, disconnect the electrodes from the power source, and then carefully remove the gel from the gel box
11. Using any device that has UV light, visualize your DNA fragments. The fragments of DNA are usually referred to as ‘bands’ due to their appearance on the gel

Restriction Digestion

• Restriction Enzyme: NEB enzyme finder used to determine the appropriate restriction enzymes
• Reaction buffer: NEB double digest finder used to determine an appropriate buffer and protocol for the restriction enzymes used

Ligation

We followed the NEB Ligation Protocol with T4 DNA Ligase.

Materials

• Microcentrifuge Tubes
• Ice
• T4 DNA Ligase Buffer (10x)
• T4 DNA Ligase
• Vector DNA
• Insert DNA
• Nuclease Free Water

Method

1. Set up the following reaction in a microcentrifuge tube on ice

   Component	20 μl Reaction
   T4 DNA Ligase Buffer (10x)	2 μl
   T4 DNA Ligase	1 μl
   Vector DNA	50 ng
   Insert DNA	ng calculated using the NeBioCalculator
   Nuclease Free Water	To 20 μl

2. For cohesive (sticky) ends, incubate at 16°C overnight or room temperature for 10 minutes. For blunt ends or single base overhangs, incubate at 16°C overnight or room temperature for 2 hours
3. Heat inactivate at 65°C for 10 minutes
4. Chill on ice and transform 8μl of the reaction into 100 μl competent cells
Notes:
• T4 DNA Ligase should be added last
• Ligation using a molar ratio of 1:3 vector to insert increases the reaction’s efficiency
• The T4 DNA Ligase Buffer should be thawed and resuspended at room temperature

Golden Gate Assembly

We followed the Golden Gate Assembly Protocol for Using NEB Golden Gate Assembly Mix

Materials

• Destination Plasmid
• Insert/Inserts
• NEB Golden Gate Buffer (10x)
• NEB Golden Gate Assembly Mix
• Nuclease-free H2O

Method

1. Set up a 20 μl reaction according to the following table

   Reagent	Assembly Reaction
   Destination Plasmid 75ng/μl	1 μl
   Insert: If Precloned If in amplicon Form	75-100 ng each plasmid 2:1 molar ratio insert:vector
   NEB Golden Gate Buffer (10x)	2 μl
   NEB Golden Gate Assembly Mix	1 μl
   Nuclease-free H2O	to 20 μl

Assembly Protocol

Number Of Inserts	Assembly Protocol
1-4 inserts	37°C for 60 minutes → 55°C for 5 minutes
5-10 inserts	(37°C for 1 minute → 16°C for 1 minute)x30 → 55°C for 5 minutes

For our plasmid isolation we used the Macherey Νagel NucleoSpin® Plasmid isolation Kit, unless otherwise stated. For PCR Purification and Gel Extraction we used the Macherey Nagel NucleoSpin® Gel and PCR Clean-up Kit, unless otherwise stated.

dCas9 Toxicity Measurements

All measurements shown regarding Abs600 were taken using plate reader.

Day 1

Inoculate one single colony of DH5a E.coli cells containing the dcas9 cassette into 1 ml LB+Kanamycin in

2‐ml eppendorf tubes

and grown at 37 °C, 250 rpm overnight in a MultitronPro shaker incubator.

Day 2

The overnight cultures were diluted 1:360 into 1ml LB+ kanamycin in 2‐ml eppendorf tubes and doxycycline was added to the following final concentration: 0, 0.2, 0.4, 0.6, 0.8, 1.2, 4, 8.The cultures were grown at 37 °C, 250 rpm in a MultitronPro shaker incubator. After 6 hours measurements for Abs600 were performed using plate reader

Flow Cytometry Sample Preparation

We followed the protocol from Adam Mayer et al [1].

All measurements shown were taken by cytometry of cells in mid-log growth except when noted.

Day1

Glycerol stocks of strains containing the plasmids of interest were streaked on LB + 1.5% Agar plates and grown overnight at 37 °C

Day2

Single colonies were inoculated into 1 ml LB + antibiotics in 2‐ml eppendorf tubes and grown at 37 °C, 250 rpm overnight in a MultitronPro shaker incubator

Day3

The overnight growths were diluted 1:200 into 1 ml LB + antibiotics in 2‐ml eppendorf tubes and grown at 37 °C, 250 rpm.
After 2 hours the growths were diluted 1:500 into prewarmed LB + antibiotics + inducer where necessary in 2‐ml eppendorf tubes and grown at 37 °C, 250 rpm for 5 hours.
After growth, 20 μl of culture sample was diluted into 180 μl PBS + 200 μg/ml kanamycin to inhibit translation. The samples were stored at 4°C for 1 hour and then measurements were performed using the CyFlow Cube8 Sysmex Partec Flow Cytometer.

[1] Meyer, A. J., Segall-Shapiro, T. H., & Voigt, C. A. (2018). Marionette: E. coli containing 12 highly-optimized small molecule sensors. BioRxiv. Retrieved from http://biorxiv.org/content/early/2018/04/10/285866.abstract

Plate Reader Sample Preparation for our Interlaboratory Collaboration

We followed the iGEM 2018 InterLab Study Protocol

Primers

Primers

Primers Name	Sequence	Usage
VR	attaccgcctttgagtgagc	Amplification of IDT gBlocks Colony PCR
VF2	tgccacctgacgtctaagaa	Amplification of IDT gBlocks Colony PCR
E Vector	belongs to the Metabrick Platform	Vector Amplification for insertion of BsaI sites in the Prefix and Suffix
P Vector	belongs to the Metabrick Platform	Vector Amplification for insertion of BsaI sites in the Prefix and Suffix
E Primer	belongs to the Metabrick Platform	Part Amplification for insertion of BsaI sites in the Prefix
P Primer	belongs to the Metabrick Platform	Part Amplification for insertion of BsaI sites in the Suffix
X Primer	belongs to the Metabrick Platform	Part Amplification for insertion of BsaI sites in the Suffix
S Primer	belongs to the Metabrick Platform	Part Amplification for insertion of BsaI sites in the Prefix
P.Rem 1	aGGTCTCcgcagcaccctgctgcccttg	Removal of PstI illegal Site from the Addgene Plasmids pTHSSe_59 & pTHSSe_60 (Insertion Point 50)
P.Rem 4	aGGTCTCcgtgtctcgacataccaaattgagtcatgg	Removal of PstI illegal Site from the Addgene Plasmids pTHSSe_59 & pTHSSe_60 (Insertion Point 50)
P.Rem 2	GGTCTCgctgcgataaggctacgatgtgg	Removal of PstI illegal Site from the Addgene Plasmids pTHSSe_59 & pTHSSe_60 (Insertion Point 802)
P.Rem 3	GGTCTCgacacggactgctgcaactctttcgtag	Removal of PstI illegal Site from the Addgene Plasmids pTHSSe_59 & pTHSSe_60 (Insertion Point 802)
In 1	AGGTCTCAGGAActtcagccaaaaaacttaagacc	Amplification of Test Device 1 and Test Device 2 from pTHSSe_59 & pTHSSe_60, used for our Interlaboratory Study
In 2	AGGTCTCAACTgacatagcgtataaacgcaga	Amplification of Test Device 1 and Test Device 2 from pTHSSe_59 & pTHSSe_60, used for our Interlaboratory Study
Ri 1	AGGTCTCATTCCTGGCTGAAACCTATTATGACG	Amplification of pTHSSe_59 & pTHSSe_60 vectors for our TALEsp1 and TALEsp2 stabilised Riboswitch Constructs.
Ri 2	AGGTCTCACAGTCGCTATGTCTTCTACTAGTAGC	Amplification of pTHSSe_59 & pTHSSe_60 vectors for our TALEsp1 and TALEsp2 stabilised Riboswitch Constructs.
DC1	AGGTCTCAGGAAgctttactccaccgttgg	Amplification of pAN-PTet-dCas9 plasmid to make the insert RFC10 compatible
DC2	AGGTCTCAACTGcctcagataaaatatttgctcatgagc	Amplification of pAN-PTet-dCas9 plasmid to make the insert RFC10 compatible
Vi1	AGGTCTCATTCCGCTCCGTGTCTTCCTC	Amplification of pTHSSe_59 & pTHSSe_60 vectors for insertion of a BsaI site in the prefix
AG1	AGGTCTCAATGTCCAGATTAGATAAAAGTAAAGTG	Amplification of the ANDgate Plasmid to replace the J23114 Promoter with a Talesp1 psp1w1 promoter for the TetR expression
AG2	AGGTCTCATTCCGGCTGAACTCTAGAAGC	Amplification of the ANDgate Plasmid to replace the J23114 Promoter with a Talesp1 psp1w1 promoter for the TetR expression
YG1	aggtctcaggaaGAAGACACGGAGCTCG	Amplification of pTHSSe_59 psp1w1 to replace the J23114 Promoter with a Talesp1 psp1w1 promoter for the TetR expression
YG2 (30)	aggtctcaACATATGGTATTTCTCCTCtttAAtttaaaca	Amplification of pTHSSe_59 to replace the J23114 Promoter with a Talesp1 psp1w1 promoter for the TetR expression
YG2 (32)	aggtctcaACATCTAGTACTTTCCTGTGTGA	Amplification of pTHSSe_59 to replace the J23114 Promoter with a Talesp1 psp1w1 promoter for the TetR expression
IA1	aggtctcactttTTAAACAAAATTATTTGTAGAGGCTGTTTCGtc	Amplification of pTHSSe_59 psp1w1 vector for insertion of BsaI sites in the Prefix
IA2	aggtctcaTACTAGAGCCAGGCATCAAATAAAACG	Amplification of pTHSSe_59 psp1w1 vector for insertion of BsaI sites in the Suffix Amplification of pSB1C3 and pTHSSe_59 for the Insertion of constitutively expressed sgRNA cassette.
IG1	aggtctcatcaaGGCTGTAAGAATCCTATAGGTTGAG	Amplification of pSB1C3 and pTHSSe_59 for the Insertion of constitutively expressed sgRNA cassette.
GG1	aggtctcattgacagctagctcagtcctGTTTTAGAG	Amplification of pRha sgRNA cassette in order to replace pRha with psp1w1
GG2	aggtctcaagtataTTATTTGTAGAGCTCATCCATGCCATG	Amplification of pRha sgRNA cassette in order to replace pRha with psp1w1
GK1	aggtctctaaagaggagaaatactagATGAGCAAAG	Amplification of B0034-sfGFP for the incorporation of BsaI restriction sites.
GK2	aggtctcaagtaTTATTTGTAGAGCTCATCCATGC	Amplification of B0034-sfGFP for the incorporation of BsaI restriction sites.

Clonning Strategy

Cloning Strategy

TALE stabilized Promoters

TALEsp1 / TALEsp2 - Stabilized Promoters

TALEsp1-Pupsp1 stabilized promoter /TALEsp2-Pupsp2 stabilized promoter
TALEsp1 / TALEsp2 - Stabilized Promoters

Steps

1. PCR amplification of psb1c3 vector with a set of standardized primers.

   These primers belong to the Metabrick Platform [1] and incorporate BsaI restriction sites to the biobrick prefix and suffix.

2. PCR amplification of pTHSSe_59 and pTHSSe_60 plasmid with E,P standardized primers.

   These primers belong to the Metabrick platform and incorporate BsaI restriction sites to the plasmid’s biobrick prefix and suffix.

3. Golden Gate assembly of the PCR amplified products.

   The amplified products after restriction digestion with bsaI restriction enzyme, acquire complementary sticky ends and can be ligated together forming the TALEsp1-Pupsp1-pSB1C3, TALEsp2-Pupsp2-pSB1C3 plasmids.

4. Restriction digestion with EcoRI and PstI, enzymes that are unique to prefix and suffix.

   Since the assembled Talesp1-Pupsp1 / Talesp2-Pupsp2 constructs are RFC[10] compatible, they can be easily assembled with other vectors. This can be achieved by cutting the Talesp1-Pupsp1-pSB1C3 vector and the receiver vectors with two biobrick enzymes one of which having it’s restriction site to prefix and the other to suffix.

5. Ligation between the digested pieces.

Psp1w1 promoter characterization device

The Psp1w1 promoter characterization device emerged from the assembly of three individual parts: Psp1w1, sfGFP (without starting codon) and amplified pSB1C3 vector.

Steps

1. PCR amplification of pSB1C3 vector with a set of standardized primers.
2. Design and synthesis of the Psp1w1 and sfGFP (without starting codon) with the appropriate flanking regions.
3. Golden Gate assembly between Psp1w1, sfGFP (without starting codon) and the amplified pSB1C3 vector.
   This reaction forms the final plasmid Psp1w1-pSB1C3 containing the Psp1w1 promoter characterization device.

Talesp1-Psp1w1 stabilized promoter

The following procedure has been followed in order to replace the Pupsp1 stabilized promoter with the Psp1w1 stabilized promoter .The expression levels of the sfGFP driven by the Psp1w1 promoter are lower than the sfGFP expression levels driven by the Pupsp1 promoter.

Steps

1. PCR amplification of Psp1w1-pSB1C3 plasmid with In1, In2 primers.

   These primers amplify the Psp1w1 promoter characterization device and incorporate BsaI sites flanking the amplified device.

2. PCR amplification of TALEsp1-pSB1C3 vector with Ri1, Ri2 primers.

   These primers amplify the TALEsp1 cassette together with the plasmid backbone and incorporate BsaI restriction sites at the external regions of the amplified sequence.

   Restriction digestion with BsaI restriction enzyme of the previously amplified sequences creates sticky complementary ends and thus they can be assembled together.

3. Restriction digestion with BsaI restriction enzyme of the previously amplified sequences creates sticky complementary ends and thus they can be assembled together.

   This reaction forms the final plasmid TALEsp1-Psp1w1-pSB1C3 plasmid containing the Psp1w1 TALE stabilized promoter.

Riboswitches

The final plasmids for the characterization of the theophylline riboswitches consist of three individual parts: A(Pupsp1 promoter fused with riboswitch), B(sfGFP marker) and C. Each part’s sequence is flanked by BsaI recognition sites and after digestion with BsaI restriction enzyme, part A has sticky ends with part B and part C, while part B has sticky ends with part A and part C.

Steps

1. PCR amplification of psb1c3 vector with a set of standardized primers.

   These primers amplify the plasmid backbone without the insert, incorporate BsaI sites at prefix and suffix, forming the amplified pSB1C3 vector (part C).

2. Design and synthesis of the part A, part B fragments with the appropriate flanking regions.
3. Golden Gate assembly between part A, part B and the amplified pSB1C3 Vector (part C). This reaction forms the final plasmids Ribo12.1-pSB1C3 and RiboT27-pSB1C3 containing the riboswitch characterization device.

TALEsp1 stabilized promoters with translational control.

Steps

1. PCR amplification of RiboT27-pSB1C3 plasmid with In1, In2 primers.

   These primers amplify the riboswitch characterization device and incorporate BsaI sites at the external regions of the amplified device.

2. PCR amplification of pTHSSe_59 plasmid with Ri1, Ri2 primers.

   These primers amplify the TALEsp1 cassette together with the plasmid backbone and incorporate BsaI restriction sites flanking the amplified sequence.

   Restriction digestion with BsaI restriction enzyme of the previously amplified sequences, creates sticky complementary ends and thus they can be assembled together.

3. Golden Gate assembly reaction between the amplified products from step 1 and step 2.

   This reaction forms the TALEsp1-Pupsp1-RT27-pSB1C3 plasmid containing the theophylline inducible TALE stabilized promoter.

CRISPRi system

Constructs used to test dcas9/sgrna repression.

pRha-sgRNA Cassette

pRha-sgRNA Cassette test construct

Steps

1. PCR amplification of pSB1C3 vector and pTHSSe_59 plasmid with a set of standardized primers.

   These primers belong to the Metabrick Platform, amplify the plasmid backbones without the insert and incorporate BsaI sites at prefix and suffix, forming the amplified pSB1C3 and amplified pTHSSe_59 vectors.

2. Design and synthesis of part 1 (sgRNA construct) and part 2 (sfGFP construct).

   Each part’s sequence is flanked by BsaI recognition sites and after digestion with BsaI restriction enzyme, part 1 has sticky ends with part 2 and the amplified pSB1C3 or amplified pTHSSe_59 vector, while part 2 has sticky ends with part 1 and the amplified vectors.

3. Golden gate Assembly between part 1, part2 and one of the amplified pSB1C3 or amplified pTHSSe_59 vector.

   Depending on the amplified vector we chose, this reaction leads to the formation of the sgRNA-sfGFP-pSB1C3 or the sgRNA-sfGFP-pTHSSe_59 plasmid.

   We transformed DH5a E.coli competent cells with sgRNA-sfGFP-pTHSSe_59 vector along with dCas9-pSB3K3 vector in order to test the response function for the repression of the J23104 promoter by the sgRNA/dCas9 complex. This procedure is thoroughly described at the characterization page.

CRISPRi stabilized promoter

After testing the response function of the CRISPRi system we replaced the rhamnose inducible promoter that is located upstream of the sgRNA cassette with the constitutive Psp1w1 promoter.

Steps

1. Digestion with biobrick enzymes of the Psp1w1 promoter characterization device and ligation with digested pTHSSe_59 vector.

   Since the Psp1w1 promoter characterization device is compatible with Biobrick RFC[10], it can be easily assembled with other RFC[10] compatible vectors. This requires digestion of the characterization device and the receiver vector with two enzymes having their restriction sites on the prefix and suffix, followed by ligation.

   These reactions forms the final plasmid psp1w1-pTHSSe_59 containing the Psp1w1 promoter characterization device.

2. PCR amplification of the psp1w1-pTHSSe_59 plasmid with IG1, IA2 primers.

   These primers amplify the psp1w1 promoter sequence together with the pTHSSe_59 plasmid backbone and incorporate BsaI restriction sites flanking the amplified sequence.

3. PCR amplification of the sgRNA-sfGFP-1c3 plasmid with GG1, GG2 primers.

   These primers amplify the sgrna cassette along with the stabilized J23104 promoter cassette and incorporate BsaI restriction sites at the external regions of the amplified sequence.

4. Golden gate assembly of the amplified products.

   After digestion with BsaI restriction enzyme,the amplified sequences acquire complementary sticky ends and thus they can be assembled together forming the Psp1w1-CRISPRi-stabilized promoter-pTHSSe_59 vector.

5. Restriction digestion with two enzymes that are unique to prefix and suffix.

   Since the assembled CRISPRi-stabilized-Psp1w1 construct is compatible with Biobrick RFC[10], it can be easily assembled with other vectors. This can be achieved by cutting the Psp1w1-sgRNA-stabilized promoter-pTHSSe_59 vector and the receiver vectors with two enzymes having their restriction sites on the prefix and suffix,followed by ligation.

dCas9-tetR expression cassette

The dcas9-tetR expression cassette is located at the pAN-Ptet-dcas9 plasmid. This plasmid was obtained from Addgene and is not compatible with RFC[10] biobrick standard, since it lacks prefix and suffix. Furthermore there is one recognition site of the EcoRI enzyme in the coding sequence of the dCas9. Taking all the above into consideration, we decided to modify this plasmid in order to make it compatible with the RFC[10] biobrick standard.

Steps

1. PCR amplification of TALEsp1-pSB1C3 plasmid with Vi1, Ri2 primers.

   These primers amplify pSB1C3 along with prefix, suffix and incorporate BsaI restriction sites and the external regions of the amplified sequence.

2. PCR amplification of pAN-Ptet-dCas9 plasmid with DC1, DC2 primers.

   These primers amplify the dCas9-tetR-lacI expression cassette and add BsaI restriction sites flanking the amplified sequence.

3. Golden gate assembly of the amplified products.

   After digestion with BsaI restriction enzyme,the amplified sequences acquire complementary sticky ends and thus they can be assemble together forming the pAN-Ptet-dCas9-prefsuf plasmid.

4. PCR amplification of pAN-Ptet-dcas-prefsuf plasmid with dcm1 and dcm2 primers and sequential Golden Gate assembly.

   These primers amplify the dcas9-tetR-lacI expression cassette along with the vector backbone and incorporate BsaI sites at the amplified sequence. After digestion with BsaI, followed by ligation this sequence can be circularized forming the initial plasmid with a single mutation at the EcorI recognition site.

AND GATE

AND Gate-pSB4K5 & AND Gate-pSB3K3

The following procedure has been followed in order to incorporate the AND Gate circuit at pSB4K5 and pSB3K3 plasmids. Then, we evaluated the circuit’s behaviour at these plasmids of different copy number.

Steps

1. Design and synthesis of the part A, part B fragments with the appropriate flanking regions.

2. PCR amplification of pSB1C3 vector with a set of standardized primers.

   These primers belong to the Metabrick Platform and incorporate BsaI restriction sites to the biobrick prefix and suffix.

3. Golden Gate assembly reaction between part A,part B and the amplified pSB1C3 vector. This reaction forms the final plasmids AND Gate-pSB1C3 containing the AND gate circuit.

4. Restriction digestion with EcoRI and SpeI (enzymes unique to prefix and suffix)

   Since the assembled AND gate construct is compatible with Biobrick RFC[10], it can be easily assembled with other vectors. This can be achieved by cutting the AND Gate-pSB1C3 plasmid and the receiver vectors with two enzymes having their restriction sites on the prefix and suffix. Following this approach we digested and assembled the AND gate circuit with pSB4K5 and pSB3K3 vector, constructing the AND Gate-pSB4K5 and AND Gate-pSB3K3 plasmids.

[1] Damalas, S. (2017, June 9). The MetaBrick platform for DNA manipulation and standardization. Bridging Synthetic Biology standards for optimized interoperability. https://doi.org/10.17605/OSF.IO/8DHMU