Difference between revisions of "Team:Kyoto/MaterialsMethods"

Line 158: Line 158:
 
<tr><td>Z042</td><td>aattacatgaCAATGTGGGATCCACCTGTT</td><td>30</td><td>40</td><td>60.27</td><td>Shimazoe</td><td>eurofin</td></tr>
 
<tr><td>Z042</td><td>aattacatgaCAATGTGGGATCCACCTGTT</td><td>30</td><td>40</td><td>60.27</td><td>Shimazoe</td><td>eurofin</td></tr>
 
<tr><td>Z043</td><td>GAAATTGCACTACCACCGGCGGCAAAATAT</td><td>30</td><td>46.67</td><td>63.65</td><td>Shimazoe</td><td>eurofin</td></tr>
 
<tr><td>Z043</td><td>GAAATTGCACTACCACCGGCGGCAAAATAT</td><td>30</td><td>46.67</td><td>63.65</td><td>Shimazoe</td><td>eurofin</td></tr>
 +
 +
 +
 +
 +
 +
</table>
 +
</div>    <!-- Table end -->
 +
   
 +
<!------------------------------------------------------BLOCK primer.py END---------------------------------------------------------->
 +
 +
 +
 +
<h5 id="Materials">3) Materials</h5>
 +
 +
<!------------------------------------------------------BLOCK TableMaker PY------------------------------------------------------>
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
  
  
Line 171: Line 199:
  
  
</table>
 
</div>    <!-- Table end -->
 
   
 
<!------------------------------------------------------BLOCK primer.py END---------------------------------------------------------->
 
  
  
  
<h5 id="Materials">3) Materials</h5>
 
  
<!------------------------------------------------------BLOCK TableMaker PY------------------------------------------------------><!-- Table Generated by TableMaker.py Author: OHAD -->
 
<h6 id = "Kit">3-1 Kit</h6>
 
<table>
 
<tr><th>Name</th><th>Supplier</th></tr><tr><td>Wizard&#174; SV Gel and PCR</td><td>Promega</td></tr><tr><td>FastGene™Plasmid Mini Kit</td><td>NIPPON Genetics Co.,Ltd</td></tr>
 
</table>
 
<!-- Table end -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<h6 id = "Restriction Enzyme">3-2 Restriction Enzyme</h6>
 
<table>
 
<tr><th>Name</th><th>Supplier</th></tr><tr><td>EcoRI</td><td>TaKaRa, Promega</td></tr><tr><td>PstI</td><td>TaKaRa, Promega</td></tr><tr><td>SpeI</td><td>TaKaRa, Promega</td></tr>
 
</table>
 
<!-- Table end -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<h6 id = "Polymerase">3-3 Polymerase</h6>
 
<table>
 
<tr><th>Name</th><th>Supplier</th></tr><tr><td>KAPA™HiFi HotStart ReadyMix (2x)</td><td>KAPABIOSYSTEMS</td></tr><tr><td>KAPA2G™ Fast HotStart ReadyMix with dye (2x)</td><td>KAPABIOSYSTEMS</td></tr><tr><td>KAPATaq™EXtra HotStart ReadyMix with dye</td><td>KAPABIOSYSTEMS</td></tr>
 
</table>
 
<!-- Table end -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<h6 id = "DNA ligase">3-4 DNA ligase</h6>
 
<table>
 
<tr><th>Name</th><th>Supplier</th></tr><tr><td>T4 DNA ligase</td><td>TaKaRa</td></tr>
 
</table>
 
<!-- Table end -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<h6 id = "Marker">3-5 Marker</h6>
 
<table>
 
<tr><th>Name</th><th>Supplier</th></tr><tr><td>1kb DNA Ladder</td><td>TaKaRa</td></tr>
 
</table>
 
<!-- Table end -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<h6 id = "Organism">3-6 Organism</h6>
 
<table>
 
<tr><th>Name</th><th>Supplier</th></tr><tr><td>E.coli DH5α Genotype</td><td>TaKaRa</td></tr><tr><td>E.coli BL21(DE3)pLysS Competent Cells</td><td>Promega</td></tr>
 
</table>
 
<!-- Table end -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<h6 id = "Antibiotics">3-7 Antibiotics</h6>
 
<table>
 
<tr><th>Name</th><th>Supplier</th></tr><tr><td>Chloramphenicol</td><td>Wako</td></tr><tr><td>Ampicillin</td><td>Wako</td></tr>
 
</table>
 
<!-- Table end -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<h6 id = "Equipment">3-8 Equipment</h6>
 
<table>
 
<tr><th>Name </th><th>Supplier</th></tr><tr><td>BioPhotometer</td><td>eppendorf</td></tr><tr><td>LABO SHAKER</td><td>BIO CRAFT</td></tr><tr><td>CO2 INCUBATOR</td><td>SANYO</td></tr><tr><td>Pipette Controller</td><td>Biohit Midi Plus</td></tr><tr><td>MiniCentrifuge Model GMC-060</td><td>LMS CO.,LTD.</td></tr><tr><td>HIGH-SPEED REFRIGERATED CENTRIFUGE</td><td>TOMY</td></tr><tr><td>HIGH-PRESSURE STEAM STERILIZER</td><td>TOMY</td></tr><tr><td>VOTEX-GENE2</td><td>Scientific Industryes</td></tr><tr><td>Scanning Electron Miniscope TM1000s</td><td>HITACHI</td></tr><tr><td>Fluorescence Microscope BX61N-34-FL-1-D</td><td>OLYMPUS</td></tr><tr><td>SCIECE IMAGING SYSTEM LAS-3000</td><td>Fuji film</td></tr>
 
</table>
 
<!-- Table end -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<h6 id = "Backbone">3-9 Backbone</h6>
 
<table>
 
<tr><th>Name</th><th>Supplier</th></tr><tr><td>pSB1C3</td><td>iGEM registry</td></tr><tr><td>pSB1A2</td><td>iGEM registry</td></tr><tr><td>pSB3C5</td><td>iGEM registry</td></tr>
 
</table>
 
<!-- Table end -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<h6 id = "Buffer">3-10 Buffer</h6>
 
<table>
 
<tr><th>Name</th><th>Supplier</th></tr><tr><td>Sodium Carbonate</td><td>Wako</td></tr><tr><td>Sodium Bicarbonate</td><td>Wako</td></tr><tr><td>Methanol(99.5%)</td><td>Wako</td></tr><tr><td>Sodium Chloride</td><td>Wako</td></tr><tr><td>SDS</td><td>nacalai tesque</td></tr><tr><td>Trisaminomethane</td><td>nacalai tesque</td></tr><tr><td>Potassium dihydrogenphosphste</td><td>SIGAMA-ALDRICH</td></tr><tr><td>Potassium Chloride</td><td>Wako</td></tr><tr><td>Glycine</td><td>Wako</td></tr><tr><td>Agar, Powder</td><td>Wako</td></tr><tr><td>Agarose XP</td><td>Wako</td></tr><tr><td>10% Hydrochloric Acid</td><td>Wako</td></tr>
 
</table>
 
<!-- Table end -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<h6 id = "SDS-PAGE&Westernblotting">3-11 SDS-PAGE&Westernblotting</h6>
 
<table>
 
<tr><th>IMMOBILON - P Blotting Sandwiches</th><th>Immobilon</th></tr><tr><td>REAL GEL PLATE (10%)</td><td>BIO CRAFT</td></tr><tr><td>BE-210(SDS-PAGE)</td><td>BIO CRAFT</td></tr><tr><td>BE-330</td><td>BIO CRAFT</td></tr><tr><td>Amersham ECL Anti-Mouse IgG</td><td>GE healthcare</td></tr><tr><td>Amersham ECL Anti-rabbit IgG</td><td>GE healthcare</td></tr><tr><td>Amersham ECL Prime Blocking Reagent</td><td>GE healthcare</td></tr><tr><td>Amersham ECL Prime WB Detection Reagent</td><td>GE healthcare</td></tr>
 
</table>
 
<!-- Table end -->
 
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
  

Revision as of 12:22, 26 September 2018

Material&Methods

1) Parts
Basic Parts
Composite Parts
2) Primer List
primer namesequenceLengthGC%TmDesignerManufacturer
Z001GTTAGGGCAGGGATGTAGATT2147.6253.07Shimazoeeurofin
Z002TGGTTAACGTATTCTCGATGTAAAG253653.19Shimazoeeurofin
Z003TGGTTACAAACTACCTACAATTTG2433.3351.29 Shimazoeeurofin
Z004GATCTTTTACCTGATTTCGACC2240.9151.18Shimazoeeurofin
Z005TGTTCACACTTAATTCACATTTATTTGAGGCAACAATACGTGGCCAGCGACATGGAGGCCCAGAA6544.6272.86Shimazoeeurofin
Z006ATGAATAAGGAAAAAGATAGGGAGCACTTAATAGGCCCTGCCCTCGTTTAAACTGGATGGCGG6346.0371.92Shimazoeeurofin
Z007acacgctttttcagttcgagtttat253655.89Shimazoeeurofin
Z008gtttcgaataaacacacataaacaaacaaaatgcgtaaaggagaagaacttttcactgga6033.3366.8Shimazoeeurofin
Z009tccagtgaaaagttcttctcctttacgcattttgtttgtttatgtgtgtttattcgaaac6033.3366.8Shimazoeeurofin
Z010catggcatggatgaactatacaaataataaAACAGGTGGATCCCACATTGtcatgtaatt603566.71Shimazoeeurofin
Z011aattacatgaCAATGTGGGATCCACCTGTTttattatttgtatagttcatccatgccatg603566.71Shimazoeeurofin
Z012ggccgcaaattaaagccttcgagcg255663.35Shimazoeeurofin
Z013gtttcgaataaacacacataaacaaacaaaatggcttcctccgaagacgttatcaaagag6036.6767.57Shimazoeeurofin
Z014ctctttgataacgtcttcggaggaagccattttgtttgtttatgtgtgtttattcgaaac6036.6767.57Shimazoeeurofin
Z015aataacgctgatagtgctagtgtagatcgcAACAGGTGGATCCCACATTGtcatgtaatt6041.6769.94Shimazoeeurofin
Z016aattacatgaCAATGTGGGATCCACCTGTTgcgatctacactagcactatcagcgttatt6041.6769.94Shimazoeeurofin
Z017gaattcgcggccgcttctagagaca255662.89Shimazoeeurofin
Z018tgccggactgcagcggccgctacta256869.57Shimazoeeurofin
Z019AAACATACTATTTAGGCTTGTTTATGTTCAGAACCTGTGACTCGTTTAAACTGGATGGCGGCGTT654070.47Shimazoeeurofin
Z020atggccgctactgacagattaaacc254858.98Shimazoeeurofin
Z021gagacccatcttgtaactcaatacg254455.16Shimazoeeurofin
Z022gaataaacacacataaacaaacaaaatggccgctactgacagattaaacc503665.41 Shimazoeeurofin
Z023ggtttaatctgtcagtagcggccattttgtttgtttatgtgtgtttattc503665.41Shimazoeeurofin
Z024cgtattgagttacaagatgggtctcCACCACCACCACCATCACtagAACAGGTGGATCCCACATTGtcatg7149.373.64Shimazoeeurofin
Z025catgaCAATGTGGGATCCACCTGTTctaGTGATGGTGGTGGTGGTGgagacccatcttgtaactcaatacg7149.373.64Shimazoeeurofin
Z026gaattcgcggccgcttctagagacacgctttttcagttcgagtttat4746.8169.83Shimazoeeurofin
Z027tgccggactgcagcggccgctactagtaggccgcaaattaaagccttcgagcg5360.3877.31Shimazoeeurofin
Z028TGAAAACTCATTACCTAAATTTGTTTATGTTCGGTAGCCCCTCGTTTAAACTGGATGGCGGCGTT6541.5471.34Shimazoeeurofin
Z029GTATCCTTTTCAAGTACTTCCACCACCACCACCATCACta404565.52Shimazoeeurofin
Z030taGTGATGGTGGTGGTGGTGGAAGTACTTGAAAAGGATAC404565.52Shimazoeeurofin
Z031caacctcaatggagtgatgcaacc245058.35Shimazoeeurofin
Z032AACAGGTGGATCCCACATTGtc225056.65Shimazoeeurofin
Z033CCTTTGCTCTGACCGATCCATA225056.03Shimazoeeurofin
Z034ACCCAGCACCATCAGAATTTAGCG245059.41Shimazoe eurofin
Z035CGGTGATTATCTAATCGAGGAAGAGG2646.1556.42Shimazoeeurofin
Z036GCTCATCAGTTCAATGGGAATCTTG254456.33Shimazoeeurofin
Z037CAGCTTTGCTGCTATGTATGGTG2347.8356.35Shimazoeeurofin
Z038GGAACCGCAAAACCAGACTAC2152.3855.81Shimazoeeurofin
Z039tttgtttgtttatgtgtgtttattcgaaac3026.6754.96Shimazoe eurofin
Z040AACAGGTGGATCCCACATTGtcatgtaatt304060.27Shimazoeeurofin
Z041gtttcgaataaacacacataaacaaacaaa3026.6754.96Shimazoeeurofin
Z042aattacatgaCAATGTGGGATCCACCTGTT304060.27Shimazoeeurofin
Z043GAAATTGCACTACCACCGGCGGCAAAATAT3046.6763.65Shimazoeeurofin
3) Materials
4) Methods
4-1 Miniprep

Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.

4-2 Gel Extraction and PCR purification

Gel Extraction was performed using Wizard® SV Gel and PCR Clean-Up System according to the manufacturer's protocols.

4-3 Restriction Enzyme Digestion

Restriction enzyme treatment was performed using Takara Bio's or NEB's restriction enzymes according to the respective manufacturer's protocols.

4-4 Ligation

Ligation was performed using Takara Bio's Ligation High Ver.2 according to the manufacturer's

4-5 Transformation
  1. Thaw competent cells on ice
  2. Add DNA sample (2.5μl) to competent cells. leave them on ice for 15 minutes
  3. Keep them in heating block for 45 seconds, then cool on ice for 2 minutes
  4. Add 90μl SOC liquid culture medium, then incubate for 45 minutes at 37°C
  5. Seed cells onto LB+antibiotics agar plate. Incubate for 24 hours at 37°C
4-6 PCR

PCR was performed using KAPA™HiFi HotStart ReadyMix (2x), KAPA™ 2G Robust HotStart ReadyMix (2x), PrimeSTAR® Max DNA Polymerase, GoTaq®, Takara Ex Taq, and Quick Taq® HS DyeMix according to the manufacturer's protocols

4-7 Sequencing

We outsourced the sequencing to Macrogen

http://www.macrogen-japan.co.jp/cap_seq_0203.php

4-8 RT-PCR

We extracted B. xylophilus whole mRNA using Sepazol®-RNA Ⅰ Super G according to the manufacturer's protocol.

RT-PCR was performed using ~~~ according to the manufacturer's protocol.

4-9 qRT-PCR

We inserted 3 plasmids written on the lower left into 2 types of yeasts written on the lower right.

p14 Gal1p-AK1
p26 GPDp-AK1
p100 GPF-GFP
MKY13 WT
MKY117 ski2Δ
Regarding p14, we conducted
  1. Create culture with raffinose medium as primary culture.
  2. Dilute it in glucose medium and galactose medium and incubate for 12-15 hours.
  3. Collect at log phase of OD = 1.1- 1.8 (MKY13) 0.6 - 1.2 .(MKY117)
  4. Collect RNA by Lucigen's MasterPure Yeast RNA purification kit. (http://www.lucigen.com/home.php?cat=273)
  5. Do DNase treatment according to the manual for 20 minutes.
  6. Dissolve the obtained total RNA in 15 μL and dilute it to prepare a standard curve sample (using p14 sample and p100 sample). The measurement sample was diluted 5000 times with water and used. Analysis is ABI Step-one plus. SuperScript III Platinum SYBR qRT-PCR kit (https://www.thermofisher.com/order/catalog/product/11732020) was used.

The three following primers were used :

  • IK91-IK92: This amplifies the loop region of hairpin RNA
  • IK95-IK96: This amplifies the inside of AK1 mRNA
  • Kota 030 - Kota 031: It amplifies near the 5 'end of 25S rRNA. (Fujii Kitabatake et al., 2009)

Quantitation was performed with n = 3 biological triplicate, and the variation in RNA recovery amount was standardized by dividing the quantified value of loop and the quantified value of AK1 by the quantitative value of 25S rRNA, respectively.

4-10 Western blotting (Sample preparation of S. cerevisiae)
  1. Cultivate 1ml of S. cerevisiae culture whose OD600 values are 1.0
  2. Pour 1ml of the S. cerevisiae cell culture into 1.5ml tubes
  3. Centrifuge 5000rpm for 1min and remove the supernatant
  4. Resuspend with 30ul of SDS sample buffer
  5. Heat samples for 10min at 100°C using block incubater
  6. Vortex well
4-11 Western blotting (Basic protocol)
  1. Apply sample to SDS-PAGE minigel (BIOCRAFT 15%)
  2. Soak the gel in transfer buffer
  3. Soak PVDF membrane in 100% methanol for 30 sec
  4. Soak PVDF membrane and filter paper in transfer buffer, leave for 5 min
  5. Set filter paper, membrane, gels, filter paper in this order to semidry transfer from anode to cathode
  6. Transfer the proteins from the gel to the membrane with 100 mA for 1 h
  7. Soak membrane in blocking buffer (dilution of 5 g ECL Blocking reagent by 100ml of TBST) for 1 h
  8. Wash for 5 min 3 times with TBST
  9. Apply 1' antibody (dilution of 10 μl of 1’antibody by 10ml of Blocking buffer) and shake for 1 h
  10. Wash for 5 min 3 times with TBST
  11. Apply 2' antibody (dilution of 4μl of 2’antibody by 10ml of Blocking buffer) and shake for 1 h
  12. Wash for 5 min 3 times with TBST
  13. Drain excess wash buffer from the washed membrane and place on flat surface, protein side up
  14. Add detection reagent onto the membrane, covering all of the membrane
  15. Incubate for 5 minutes at room temperature
  16. Drain off excess detection reagent by dabbing with Kimwipe
  17. Place the sample in the CCD camera compartment and record the images
4-12 Culture using yeasts and measurement
  1. Prepare medium put on 3.5 cm plate.
  2. Drop liquid-cultured yeasts on the center of medium.
  3. Disperse them by bacteria spreader and dry for 30min to 1 hour. Or leave them as they are.
  4. Pipette suspension including nematodes on the medium.
  5. Culture it at 25 ℃
4-13 The way of taking photos
  1. Culture yeasts expressing GFP over night and dilute them three times with DW or SD liquid medium.
  2. Drop 200-300μl of water on the medium after one or two days, and pipette it in order to spread over the medium.
  3. Suck out 12ul of water on the medium and drop it on microscope slide.
  4. Cover it with cover glass and observe whether nematodes feed yeasts expressing GFP by fluorescence microscope.
4-14 Methods of taking movies
  1. Make agar pad.
  2. Extract nematodes from PDA medium, collect them into 1.5ml tube and centrifuge it.
  3. Remove supernatant and put 1.5ul of suspension with nematodes into gap of cover glasses.
  4. Snap microscope slide with the finger and reach suspension to the center of agarose medium.
  5. Observe whether nematodes feed yeast expressing GFP by microscope and take videos of it.
4-15 Way of making agar pad
  1. Make medium of 2% agar and sterlize by autoclave.
  2. Put sterlized slide glass between two of slide glasses covered with "Kimwipes", drop agar medium, then rapidly cover agar medium with another slide glass.
  3. After the medium sodifies, reveal slowly covered slide glass.
  4. Pipette yeasts on the medium, cover the medium on cover glass, and culture it for 1-2days.
4-16 Synthesis of dsRNA

We synthesyzed dsRNA by "MEGAscript™ T7 Transcription Kit."
https://www.thermofisher.com/order/catalog/product/AM1334

4-17 Soaking

We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf