SAKANAhuman (Talk | contribs) |
SAKANAhuman (Talk | contribs) |
||
Line 392: | Line 392: | ||
<!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | ||
+ | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | ||
+ | <h6 id = "Plates">4-10 Plates</h6> | ||
+ | <p> | ||
+ | 1.Rinse the graduated cylinder with distilled water and add 500 ml of milliQ. | ||
+ | <br>2. Transfer 1. to the flask. | ||
+ | <br>3. Place the following in the flask of 2. | ||
+ | <br> ・Bacto Tryptone 5 g | ||
+ | <br> ・Bacto yeast extract 2.5 g | ||
+ | <br> ・NaCl 2.5g | ||
+ | <br> ・Agar 7.5 g | ||
+ | <br>4. After mixing thoroughly, autoclave it after covering with aluminum foil. | ||
+ | <br>5. Add the respective antibiotics. | ||
+ | <br>6. Cool until it gets moderately warm to the touch. | ||
+ | <br>7. Put in a container and fix the lid with the tape after the medium solidifies. | ||
+ | </p> | ||
+ | <table> | ||
+ | <h7> Concentrations of antibiotics:</h7> | ||
+ | <tr><th>Antibiotics</th><th>Stock concentration</th><th>Final concentration</th></tr> | ||
+ | <tr><td>Ampicillin</td><td>100mg/ml</td><td>100μg/ml</td></tr> | ||
+ | <tr><td>Chloramphenicol</td><td>10mg/ml</td><td>30μg/ml</td></tr> | ||
+ | </table> | ||
+ | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | ||
<br> | <br> |
Revision as of 13:31, 26 September 2018
Material&Methods
- 1) Parts
- 2) Primer list
- 3) Materials
- 3-1 Kit
- 3-2 Restriction Enzyme
- 3-3 Polymerase
- 3-4 DNA ligase
- 3-5 Marker
- 3-6 Organism
- 3-7 Antibiotics
- 3-8 Equipment
- 3-9 Backbone
- 3-10 Buffer
- 3-11 SDS-PAGE&Westernblotting
- 4) Methods
1) Parts
Basic Parts
Composite Parts
2) Primer List
primer name | sequence | Length | GC% | Tm | Designer | Manufacturer |
---|---|---|---|---|---|---|
Z001 | GTTAGGGCAGGGATGTAGATT | 21 | 47.62 | 53.07 | Shimazoe | eurofin |
Z002 | TGGTTAACGTATTCTCGATGTAAAG | 25 | 36 | 53.19 | Shimazoe | eurofin |
Z003 | TGGTTACAAACTACCTACAATTTG | 24 | 33.33 | 51.29 | Shimazoe | eurofin |
Z004 | GATCTTTTACCTGATTTCGACC | 22 | 40.91 | 51.18 | Shimazoe | eurofin |
Z005 | TGTTCACACTTAATTCACATTTATTTGAGGCAACAATACGTGGCCAGCGACATGGAGGCCCAGAA | 65 | 44.62 | 72.86 | Shimazoe | eurofin |
Z006 | ATGAATAAGGAAAAAGATAGGGAGCACTTAATAGGCCCTGCCCTCGTTTAAACTGGATGGCGG | 63 | 46.03 | 71.92 | Shimazoe | eurofin |
Z007 | acacgctttttcagttcgagtttat | 25 | 36 | 55.89 | Shimazoe | eurofin |
Z008 | gtttcgaataaacacacataaacaaacaaaatgcgtaaaggagaagaacttttcactgga | 60 | 33.33 | 66.8 | Shimazoe | eurofin |
Z009 | tccagtgaaaagttcttctcctttacgcattttgtttgtttatgtgtgtttattcgaaac | 60 | 33.33 | 66.8 | Shimazoe | eurofin |
Z010 | catggcatggatgaactatacaaataataaAACAGGTGGATCCCACATTGtcatgtaatt | 60 | 35 | 66.71 | Shimazoe | eurofin |
Z011 | aattacatgaCAATGTGGGATCCACCTGTTttattatttgtatagttcatccatgccatg | 60 | 35 | 66.71 | Shimazoe | eurofin |
Z012 | ggccgcaaattaaagccttcgagcg | 25 | 56 | 63.35 | Shimazoe | eurofin |
Z013 | gtttcgaataaacacacataaacaaacaaaatggcttcctccgaagacgttatcaaagag | 60 | 36.67 | 67.57 | Shimazoe | eurofin |
Z014 | ctctttgataacgtcttcggaggaagccattttgtttgtttatgtgtgtttattcgaaac | 60 | 36.67 | 67.57 | Shimazoe | eurofin |
Z015 | aataacgctgatagtgctagtgtagatcgcAACAGGTGGATCCCACATTGtcatgtaatt | 60 | 41.67 | 69.94 | Shimazoe | eurofin |
Z016 | aattacatgaCAATGTGGGATCCACCTGTTgcgatctacactagcactatcagcgttatt | 60 | 41.67 | 69.94 | Shimazoe | eurofin |
Z017 | gaattcgcggccgcttctagagaca | 25 | 56 | 62.89 | Shimazoe | eurofin |
Z018 | tgccggactgcagcggccgctacta | 25 | 68 | 69.57 | Shimazoe | eurofin |
Z019 | AAACATACTATTTAGGCTTGTTTATGTTCAGAACCTGTGACTCGTTTAAACTGGATGGCGGCGTT | 65 | 40 | 70.47 | Shimazoe | eurofin |
Z020 | atggccgctactgacagattaaacc | 25 | 48 | 58.98 | Shimazoe | eurofin |
Z021 | gagacccatcttgtaactcaatacg | 25 | 44 | 55.16 | Shimazoe | eurofin |
Z022 | gaataaacacacataaacaaacaaaatggccgctactgacagattaaacc | 50 | 36 | 65.41 | Shimazoe | eurofin |
Z023 | ggtttaatctgtcagtagcggccattttgtttgtttatgtgtgtttattc | 50 | 36 | 65.41 | Shimazoe | eurofin |
Z024 | cgtattgagttacaagatgggtctcCACCACCACCACCATCACtagAACAGGTGGATCCCACATTGtcatg | 71 | 49.3 | 73.64 | Shimazoe | eurofin |
Z025 | catgaCAATGTGGGATCCACCTGTTctaGTGATGGTGGTGGTGGTGgagacccatcttgtaactcaatacg | 71 | 49.3 | 73.64 | Shimazoe | eurofin |
Z026 | gaattcgcggccgcttctagagacacgctttttcagttcgagtttat | 47 | 46.81 | 69.83 | Shimazoe | eurofin |
Z027 | tgccggactgcagcggccgctactagtaggccgcaaattaaagccttcgagcg | 53 | 60.38 | 77.31 | Shimazoe | eurofin |
Z028 | TGAAAACTCATTACCTAAATTTGTTTATGTTCGGTAGCCCCTCGTTTAAACTGGATGGCGGCGTT | 65 | 41.54 | 71.34 | Shimazoe | eurofin |
Z029 | GTATCCTTTTCAAGTACTTCCACCACCACCACCATCACta | 40 | 45 | 65.52 | Shimazoe | eurofin |
Z030 | taGTGATGGTGGTGGTGGTGGAAGTACTTGAAAAGGATAC | 40 | 45 | 65.52 | Shimazoe | eurofin |
Z031 | caacctcaatggagtgatgcaacc | 24 | 50 | 58.35 | Shimazoe | eurofin |
Z032 | AACAGGTGGATCCCACATTGtc | 22 | 50 | 56.65 | Shimazoe | eurofin |
Z033 | CCTTTGCTCTGACCGATCCATA | 22 | 50 | 56.03 | Shimazoe | eurofin |
Z034 | ACCCAGCACCATCAGAATTTAGCG | 24 | 50 | 59.41 | Shimazoe | eurofin |
Z035 | CGGTGATTATCTAATCGAGGAAGAGG | 26 | 46.15 | 56.42 | Shimazoe | eurofin |
Z036 | GCTCATCAGTTCAATGGGAATCTTG | 25 | 44 | 56.33 | Shimazoe | eurofin |
Z037 | CAGCTTTGCTGCTATGTATGGTG | 23 | 47.83 | 56.35 | Shimazoe | eurofin |
Z038 | GGAACCGCAAAACCAGACTAC | 21 | 52.38 | 55.81 | Shimazoe | eurofin |
Z039 | tttgtttgtttatgtgtgtttattcgaaac | 30 | 26.67 | 54.96 | Shimazoe | eurofin |
Z040 | AACAGGTGGATCCCACATTGtcatgtaatt | 30 | 40 | 60.27 | Shimazoe | eurofin |
Z041 | gtttcgaataaacacacataaacaaacaaa | 30 | 26.67 | 54.96 | Shimazoe | eurofin |
Z042 | aattacatgaCAATGTGGGATCCACCTGTT | 30 | 40 | 60.27 | Shimazoe | eurofin |
Z043 | GAAATTGCACTACCACCGGCGGCAAAATAT | 30 | 46.67 | 63.65 | Shimazoe | eurofin |
3) Materials
3-1 Kit
Name | Supplier |
---|---|
FastGene™Plasmid Mini Kit | NIPPON Genetics Co., Ltd |
FastGene™Gel/PCR Extraction Kit | NIPPON Genetics Co.,Ltd |
3-2 Restriction Enzyme
Name | Supplier |
---|---|
EcoRI | TaKaRa, Promega |
PstI | TaKaRa, Promega |
SpeI | TaKaRa, Promega |
3-3 Polymerase
Name | Supplier |
---|---|
Q5 High-Fidelity 2x master mix | New England Biolabs Japan Inc. |
3-4 DNA ligase
Name | Supplier |
---|---|
T4 DNA ligase | TaKaRa |
3-5 Marker
Name | Supplier |
---|---|
1kb DNA Ladder | NIPPON Genetics Co., Ltd |
3-6 Organism
Name | Supplier |
---|---|
E.coli DH5α Genotype | TaKaRa |
3-7 Antibiotics
Name | Supplier |
---|---|
Chloramphenicol | Wako |
Ampicillin | Wako |
3-8 Equipment
Name | Supplier |
---|---|
BioPhotometer | eppendorf |
LABO SHAKER | BIO CRAFT |
CO2 INCUBATOR | SANYO |
Pipette Controller | Biohit Midi Plus |
MiniCentrifuge Model GMC-060 | LMS CO.,LTD. |
HIGH-SPEED REFRIGERATED CENTRIFUGE | TOMY |
HIGH-PRESSURE STEAM STERILIZER | TOMY |
VOTEX-GENE2 | Scientific Industryes |
Scanning Electron Miniscope TM1000s | HITACHI |
Fluorescence Microscope BX61N-34-FL-1-D | OLYMPUS |
SCIECE IMAGING SYSTEM LAS-3000 | Fuji film |
3-9 Backbone
Name | Supplier |
---|---|
pRS421 | National BioResource Project http://yeast.nig.ac.jp/yeast/ |
pRS423 | National BioResource Project |
pRS424 | National BioResource Project |
pRS425 | National BioResource Project |
pRS426 | National BioResource Project |
pGK421 | National BioResource Project |
pRS316 | National BioResource Project |
3-10 Buffer
Name | Supplier |
---|---|
Sodium Carbonate | Wako |
Sodium Bicarbonate | Wako |
Methanol(99.5%) | Wako |
Sodium Chloride | Wako |
SDS | nacalai tesque |
Trisaminomethane | nacalai tesque |
Potassium dihydrogenphosphste | SIGAMA-ALDRICH |
Potassium Chloride | Wako |
Glycine | Wako |
Agar, Powder | Wako |
Agarose XP | Wako |
10% Hydrochloric Acid | Wako |
3-11 SDS-PAGE&Westernblotting
Name | Supplier |
---|---|
REAL GEL PLATE (10%) | BIO CRAFT |
BE-210(SDS-PAGE) | BIO CRAFT |
BE-330 | BIO CRAFT |
Amersham ECL Anti-Mouse IgG | GE healthcare |
Amersham ECL Anti-rabbit IgG | GE healthcare |
Amersham ECL Prime Blocking Reagent | GE healthcare |
Amersham ECL Prime WB Detection Reagent | GE healthcare |
4) Methods
4-1 Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit according to the manufacturer's protocols.
4-2 Gel Extraction and PCR purification
Gel Extraction was performed using FastGene™Gel/PCR Extraction Kit according to the manufacturer's protocols.
4-3 Restriction Enzyme Digestion
Restriction enzyme treatment was performed using Q5 High-Fidelity 2x master mix according to the respective manufacturer's protocols.
4-4 Ligation
Ligation was performed using Takara Bio's Ligation High Ver.2 according to the manufacturer's.
4-5 Transformation
1.Thaw competent cells on ice
2.Add DNA sample (2.5μl) to competent cells. leave them on ice for 15 minutes
3.Keep them in heating block for 45 seconds, then cool on ice for 2 minutes
4.Add 90μl SOC liquid culture medium, then incubate for 45 minutes at 37℃
5.Seed cells onto LB+antibiotics agar plate. Incubate for 24 hours at 37℃
4-6 PCR
PCR was performed using Q5 High-Fidelity 2x master mix according to the manufacturer's protocols.
4-7 Sequencing
We outsourced the sequencing to Macrogen
http://www.macrogen-japan.co.jp/cap_seq_0203.php
4-8 Western blotting
1.Apply sample to SDS-PAGE minigel (BIOCRAFT 15%).
2.Soak the gel in transfer buffer.
3.Soak PVDF membrane in 100% methanol for 30 sec.
4.Soak PVDF membrane and filter paper in transfer buffer, leave for 5 min.
5.Set filter paper, membrane, gels, filter paper in this order to semidry transfer from anode to cathode.
6.Transfer the proteins from the gel to the membrane with 100 mA for 1 h.
7.Soak membrane in blocking buffer (dilution of 5 g ECL Blocking reagent by 100ml of TBST) for 1 h.
8.Wash for 5 min 3 times with TBST.
9.Apply 1' antibody (dilution of 10 μl of 1’antibody by 10ml of Blocking buffer) and shake for 1 h.
10.Wash for 5 min 3 times with TBST.
11.Apply 2' antibody (dilution of 4μl of 2’antibody by 10ml of Blocking buffer) and shake for 1 h.
12.Wash for 5 min 3 times with TBST.
13.Drain excess wash buffer from the washed membrane and place on flat surface, protein side up.
14.Add detection reagent onto the membrane, covering all of the membrane.
15.Incubate for 5 minutes at room temperature.
16.Drain off excess detection reagent by dabbing with Kimwipe.
17.Place the sample in the CCD camera compartment and record the images.
4-9 Overnight-Culture
1.Prepare LB media by resolving 5g Bacto Tryptone, 1.25g Bacto-yeast extract and 1.25g NaCl in 500ml of milliQ and autoclave it.
2.Transfer 7ml of LB into a culture tube and add the respective antibiotic stock solutions.
3.Inoculate the culture by picking a single colony with a pipet tip and tipping it into the medium.
4.Shake the culture at 37℃ at 180 rpm for 14-16h.
5.Isolate plasmids or use the culture for further experiments.
Antibiotics | Stock concentration | Final concentration |
---|---|---|
Ampicillin | 100mg/ml | 100μg/ml |
Chloramphenicol | 10mg/l | 30μg/ml |
4-10 Plates
1.Rinse the graduated cylinder with distilled water and add 500 ml of milliQ.
2. Transfer 1. to the flask.
3. Place the following in the flask of 2.
・Bacto Tryptone 5 g
・Bacto yeast extract 2.5 g
・NaCl 2.5g
・Agar 7.5 g
4. After mixing thoroughly, autoclave it after covering with aluminum foil.
5. Add the respective antibiotics.
6. Cool until it gets moderately warm to the touch.
7. Put in a container and fix the lid with the tape after the medium solidifies.
Antibiotics | Stock concentration | Final concentration |
---|---|---|
Ampicillin | 100mg/ml | 100μg/ml |
Chloramphenicol | 10mg/ml | 30μg/ml |