SAKANAhuman (Talk | contribs) |
SAKANAhuman (Talk | contribs) |
||
Line 62: | Line 62: | ||
<h1>Safety</h1> | <h1>Safety</h1> | ||
<ul class="material"> | <ul class="material"> | ||
− | <li><a href="# | + | <li><a href="#Safe project design">1) Safe project design</a></li> |
− | <li><a href="# | + | <li><a href="#">2) Safe lab work |
− | <li><a href="# | + | <li><a href="#Safe shipment">3) Safe shipment</a></li> |
− | + | <li><a href="#Link">4) Link</a></li> | |
− | <li><a href="# | + | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
</ul> | </ul> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
</ul> | </ul> | ||
</ul> | </ul> |
Revision as of 08:08, 2 October 2018
Safety
1) Parts
Basic Parts
Composite Parts
2) Primer List
primer name | sequence | Length | Tm | GC% | Designer | Manufacturer |
---|---|---|---|---|---|---|
tropomyosinF | GATCGAGAAGGACAACGCCC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
IK107 | cccgccgccaccatggaggcggccgcaaaatcagg | 35 | 94 | 71 | Yoshimoto | Macrogen Japan Corp |
3) Materials
3-1 Kit
Name | Supplier |
---|---|
Wizard® SV Gel and PCR | Promega |
FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
4) Methods
4-1 Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
4-17 Soaking
We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf