Difference between revisions of "Team:Kyoto/Safety"
SAKANAhuman (Talk | contribs) |
SAKANAhuman (Talk | contribs) |
||
| Line 71: | Line 71: | ||
<!-- ###################################################### BLOCK Contents END #################################################--> | <!-- ###################################################### BLOCK Contents END #################################################--> | ||
| − | <br><br><br><br><br> | + | <br><br><br><br><br> |
| − | + | ||
<!-----------------------------------------------------BLOCK Safe project design--------------------------------------------------------------> | <!-----------------------------------------------------BLOCK Safe project design--------------------------------------------------------------> | ||
<h5 id="Safe project design">1) Safe project design</h5> | <h5 id="Safe project design">1) Safe project design</h5> | ||
| Line 79: | Line 78: | ||
<!-----------------------------------------------------BLOCK Safe project design END----------------------------------------------------------> | <!-----------------------------------------------------BLOCK Safe project design END----------------------------------------------------------> | ||
| − | + | <!------------------------------------------------------BLOCK Safe lab work----------------------------------------------------------> | |
| − | + | ||
| − | <!------------------------------------------------------BLOCK Safe lab work | + | |
<!-- Table Generated by TableMaker.py Author: OHAD --> | <!-- Table Generated by TableMaker.py Author: OHAD --> | ||
<h5 id = "Safe lab work">2) Safe lab work</h5> | <h5 id = "Safe lab work">2) Safe lab work</h5> | ||
| Line 93: | Line 90: | ||
| − | <h5 id=" | + | <h5 id="Safe shipment">3) Safe shipment</h5> |
| − | <!------------------------------------------------------BLOCK | + | <!------------------------------------------------------BLOCK Safe shipment PY------------------------------------------------------> |
| + | <!-- Table Generated by TableMaker.py Author: OHAD --> | ||
<h6 id = "Kit">3-1 Kit</h6> | <h6 id = "Kit">3-1 Kit</h6> | ||
<table> | <table> | ||
| Line 101: | Line 99: | ||
</table> | </table> | ||
<!-- Table end --> | <!-- Table end --> | ||
| − | <!------------------------------------------------------BLOCK | + | <!------------------------------------------------------BLOCK Safe shipment.py END------------------------------------------------------> |
| − | <h5 id=" | + | <h5 id="link">4) Link</h5> |
| − | <!------------------------------------------------------BLOCK | + | <!------------------------------------------------------BLOCK Link PY----------------------------------------------------------------> |
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | ||
<h6 id = "Miniprep">4-1 Miniprep</h6> | <h6 id = "Miniprep">4-1 Miniprep</h6> | ||
| Line 122: | Line 120: | ||
<!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | ||
| − | <!------------------------------------------------------BLOCK | + | <!------------------------------------------------------BLOCK Link.py END -----------------------------------------------------------> |
</div> | </div> | ||
</div> | </div> | ||
Revision as of 08:16, 2 October 2018
Safety
1) Safe project design
Basic Parts
Composite Parts
2) Safe lab work
| primer name | sequence | Length | Tm | GC% | Designer | Manufacturer |
|---|---|---|---|---|---|---|
| tropomyosinF | GATCGAGAAGGACAACGCCC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
| IK107 | cccgccgccaccatggaggcggccgcaaaatcagg | 35 | 94 | 71 | Yoshimoto | Macrogen Japan Corp |
3) Safe shipment
3-1 Kit
| Name | Supplier |
|---|---|
| Wizard® SV Gel and PCR | Promega |
| FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
4) Link
4-1 Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
4-17 Soaking
We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf
