Difference between revisions of "Team:Kyoto/Safety"
SAKANAhuman (Talk | contribs) |
SAKANAhuman (Talk | contribs) |
||
| Line 75: | Line 75: | ||
<h5 id="Safe project design">1) Safe project design</h5> | <h5 id="Safe project design">1) Safe project design</h5> | ||
<p>All of the species we expect to use are not harmful for human.</p> | <p>All of the species we expect to use are not harmful for human.</p> | ||
| − | < | + | <font size="6">All of the species we expect to use are not harmful for human.</font> |
<h6><a href="https://2017.igem.org/Team:Kyoto/Composite_Part" target="brank">Composite Parts</a></h6> | <h6><a href="https://2017.igem.org/Team:Kyoto/Composite_Part" target="brank">Composite Parts</a></h6> | ||
Revision as of 08:32, 2 October 2018
Safety
1) Safe project design
All of the species we expect to use are not harmful for human.
All of the species we expect to use are not harmful for human.Composite Parts
2) Safe lab work
| primer name | sequence | Length | Tm | GC% | Designer | Manufacturer |
|---|---|---|---|---|---|---|
| tropomyosinF | GATCGAGAAGGACAACGCCC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
| IK107 | cccgccgccaccatggaggcggccgcaaaatcagg | 35 | 94 | 71 | Yoshimoto | Macrogen Japan Corp |
3) Safe shipment
3-1 Kit
| Name | Supplier |
|---|---|
| Wizard® SV Gel and PCR | Promega |
| FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
4) Link
4-1 Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
4-17 Soaking
We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf
For our full safety page please click here.
