Date:

Template

To Do 

Accomplishment

Date:

08/29

To Do 

Accomplishment

• Transformed colony 6 and 8 of LsrK second plasmid
• Double plasmid transformation of colony 6 of LsrK second plasmid and colony of first plasmid inside pACYC. Created a plate by spreading tetracycline and chloramphenicol on a non antibiotic plate.
• Ordered primers for LuxS second plasmid and YdgG second plasmid in pGGA for golden gate assembly using NEB GG tool
• Vignesh → 3hrs

Date:

08/27

To Do 

Accomplishment

• Mini Prepped the 9 colonies of O/N cultures of LsrK second plasmid in pGGA
• Ran a single restriction enzyme digest using PstI on the plasmid
• Ran a gel on the digest. The gel was successful. The bands of colony 6 & 8 were most promising with bands around the 4800-5000 mark and the actual length is ~4850
• First plasmid is seemingly made, but gel quality is bad 

Date:

08/26

To Do 

Accomplishment

• Several colonies grew of LsrK second plasmid in pGGA. I picked 9 colonies to create an overnight culture of.

Date:

08/25

To Do 

Accomplishment

Transformed 4uL of LsrK second plasmid golden gate reaction

Date:

08/24

To Do 

Accomplishment

• Gel extracted sfgfp block gg pcr since it is in a cam backbone and pgga is also cam resistant
• Ran golden gate reaction on LsrK second plasmid using pGGA plasmid

Date:

8/23

To Do 

Accomplishment

• There are colony growths in the 1st plasmid pACYC goldengate; will check via gel.
• Primers for golden gate asssembly of LsrK second plasmid arrived. Performed golden gate pcr on sfgfp block and LsrK block

Date:

8/22

To Do 

Accomplishment

• Checked rest of the LsrRpLsr in PSB1C3; none had the part in it
• Performed goldengate of the first plasmid in pACYC

Date:

8/20

To Do 

• Send W&M our BioBricks
• Complete W&M Experiments and send results
• Miniprep lsrACDB + Terminator

Accomplishment

• Order new golden assembly primers for LsrK second plasmid in pGGA but inserted the bsaI sites in the right place. The first creation of LuxS Block_pGGA turns out not to have the insert in the right place since when i created the assembly, the primers were desinged at the beginning and end of the plasmid when in linear form. The plasmid already has bsaI sites at its insert region. This is where I inserted the LsrK Block and sfgfp block this time.
• Sent Experiment 1 results to W&M
• Ran gel on W&M experiment 2. All four lanes were failures.<img alt="" src="" style="width: 482.00px; height: 361.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
• Ran a gel on the 8 lsrACDBTT minipreps. All of them appear to be reannealed backbones.
• Continued golden assembly for YdgG and LsrK plasmids

• Ran golden gate pcr on YdgG sfgfp and LsrK sfgfp using neb TM Calculator: Annealed 62C for LsrK sfgfp and 66C for YdgG sfgfp

• Restriction digest of LsrK_pSB1C3 and YdgG_pSB1C3 on E|P to confirm they are the right parts

• The gel showed that the backbone just reanneal so this means that the ligation was unsuccessful

• We received sequencing results for LuxS_pSB1C3 and a failure of “No Priming” occurred

• <a class="c45" href="https://www.google.com/url?q=https://clims4.genewiz.com/SangerSequencing/ViewResultFileByReaction?ReactionID%3D4243f3e4-bcff-4a8b-aced-3598a7e5feae&sa=D&ust=1535736625122000">https://clims4.genewiz.com/SangerSequencing/ViewResultFileByReaction?ReactionID=4243f3e4-bcff-4a8b-aced-3598a7e5feae</a>
• <a class="c45" href="https://www.google.com/url?q=https://clims4.genewiz.com/SangerSequencing/ViewResultFileByReaction?ReactionID%3Dcec1f867-9e0f-4f69-b65d-98c88435d35b&sa=D&ust=1535736625122000">https://clims4.genewiz.com/SangerSequencing/ViewResultFileByReaction?ReactionID=cec1f867-9e0f-4f69-b65d-98c88435d35b</a> 

• What was thought to be LsrRpLsr inside PSB1C3 was found to be an incomplete digest of the backbone. A second gel of the digested plasmid confirmed that there is no part in it.

• This explains why our recent LsrRpLsr gibson PCR have not been working; there was no template in there to start with

Date:

08/18

To Do 

• Miniprep colonies of YdgG_pSB1C3 & LsrK_pSB1C3
• PCR amplify pSB1A3 backbone

Accomplishment

• Miniprepped 8 colonies of C and 8 colonies of LsrK_pSB1C3

Date:

08/17

To Do 

Accomplishment

• Golden gate reaction using NEB TM Calculator for pSB1A3 YdgG & LsrK

• Annealed at 71C for both (only half of the primer is annealing this time)

• Grew out colonies of LsrK_pSB1C3 & YdgG_pSB1C3 for miniprep tomorrow
• Ordered plasmid miniprep kit, pcr extraction kit, and gel extraction kit from Genscript
• W&M Exp 1 final steps completed
• Ligation of lsrACDB, B0015, and pSB1K3 begun.

Date:

08/16

To Do 

Accomplishment

• Gel extraction ydgg pcr
• E|P digest of pSB1C3, Lsrk pcr amplify, ydgg pcr amplify

• Ligated and transformed Biobrick piece (Lsrk_pSB1C3 & YdgG_pSB1C3)

Date:

8/15

To Do 

• Transform the successful LsrRpLsr

Accomplishment

• Ran pcr amplification of LsrK and Gel confirmed pcr amplification of LsrK

• Ran a gel extraction to isolate the piece

• PCR amplified YdgG using new NEB temperatures after the phone call with them

Date:

8/14

To Do 

• Gibson PCR of LsrRplsr and T7TT were failures, so retrying with higher annealing temperature of 59 degree celsius

Accomplishment

• Gel of LsrRpLsr shows correct part in tube 1: very likely it is a success. Must re-transform (because there is no restreak done) and confirm by sequencing
• T7TT re-PCRed with 59 and 60C.

Date:

08/12

To Do 

Accomplishment

• Transformations of golden reactions were unsuccessful
• Transformed ligation of LsrRplsr in PSB1C3; harvest on 8/14
• Ordered primers for sequencing 1st plasmid & sfGFP_LuxS. Also ordered primers for PCRing those parts with prefix/suffixes.
• Reran W&M experiment 1 for reaction C. Left in thermocycler O/N after PCR step.
• PCR of pT7-sfGFP-TT with sfgfp Y forward/reverse primers
• Trying the same method again:

• Ran PCR of pSB1A3 (ydgg) but increased the annealing temperature to 67.5C
• Ran PCR on YdgG block

Date:

08/11

To Do 

Accomplishment

• Ran golden gate reaction on LuxS, LsrK, YdgG Plasmids(in pSB1A3) (2:1 insert to vector ration used)
• Transformed using NEB high efficiency competent cells
• PCR amplified LsrR_pLsr using Part Prefix and Part Suffix primers (ordered 8/2). There were multiple wrong bands along with the correct band, so gel extracted the part, then ligated into PSB1C3. Did overnight ligation.

Date:

08/10

To Do 

• Gel (extraction) of W&M parts
• Miniprep and glycerol stocks of pE-FLP plasmid

Accomplishment

• Golden gate continued…

• Ran pcr on LuxS, Lsrk, and YdgG plasmid blocks to add golden gate primers
• Gel extraction from sfgfp block from pcr to isolate from dna template plasmid

Date:

08/09

To Do 

Accomplishment

• Gel extraction of pOSIP-KO plasmid
• pE-FLP started in overnight culture @ 30˚C
• W&M experiment 1 completed up to PCR step. Left overnight.
• Started golden assembly on LuxS, Lsrk, and YdgG plasmid in pSB1A3

• Ran pcr on pSB1A3 and sfgfp blocks to add on golden gate primers

Date:

08/08

To Do 

• Confirm pACYC cut and uncut, then remake the pACYC PCR for Gibson

Accomplishment

• PCR amplified pSB1K3 using Prefix and Suffix Primer Pool(50uL rxn with annealing at 57C and elongation for 1:20)

• Gel confirmed!

• PCR amplified LsrR_rbs_pLsr_rbs and LuxS using Prefix and Suffix Primer Pool (50uL rxn with annealing at 57.3C and elongation for 45 seconds)

• LuxS block is gel confirmed!
• LsrR_rbs_pLsr_rbs had three bands. There was one band the right length (~1300 bp). There were two other bands around 500bp. Not exactly sure what these two bands represent.

Date:

08/07

To Do 

• Transform pE-FLP
• Create sequencing primers

Accomplishment

• Ordered primers to create LuxS, LsrK, and YdgG Plasmids in pSB1A3 using golden gate assembly method
• PCR of pACYC for Gibson was unsuccessful: had 5 bands...

Date:

08/06

To Do 

• Gibson first plasmid

• Purify and run gel

• Order primers to sequence the first plasmid
• Order primers for Clonetegration assembly and screening by 8/7
• Replate pOSIP-KO plasmid
• Create Tetracycline LB agar plates

Accomplishment

• Created Tetracycline LB agar plates
• Transformed the LuxS Plasmid from golden gate using the miniprep result from colony B.
• pT7_RBS_sfGFP_pT7_RBS_LsrK/YdgG plasmids checked on gel; they were failures. YdgG had nothing but backbone, LsrK had only a band on 1000 and 2000, so likely only sfGFP got in.
• Collected flow cytometry data

• Tested all 10 samples of constitutively expressed sfgfp
• Tested every other sample of negative control pt7_rbs_sfgfp
• Tested one sample of negative control pt7_rbs

Date:

08/03

To Do 

Accomplishment

• Mini Prepped golden gate LuxS O/N culture. Ran single restriction digest on all three samples using PstI.
• Ran gel on golden gate LuxS. Made a single cut so the resulting length should be ~3820 bp. Lane 5, colony B, seems to be closest to the length. Lane 3 and Lane 7 both seem to a partial digest so some of the uncut plasmid would be supercoiled, traveling farther down the gel.
• <img alt="" src="" style="width: 1154.94px; height: 578.74px; margin-left: -381.48px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">

Date:

08/02

To Do 

Accomplishment

• Diluted the overnight cultures of flow parts: 1 ml of cells in 4 ml of LB

• Now the cells are in log phase
• Collected a sample every 30 minutes for five hours

• Took 200 ul of cells and put them in 800 ul of LB. Dipped the cells in liquid nitrogen to freeze them in that point in time for flow cytometry later this week. 10 samples total

• Will fix the cells right before flow cytometry

• Grew out three colonies from golden gate of LuxS transformation for miniprep tomorrow

Date:

08/01

To Do 

Accomplishment

• PCR of pSB1K3 backbone left o/n in machine
• Digest of CFP to confirm insert and test REs
• Digest of IDT part in vector
• Gel of the above two digests. Each enzyme cut CFP properly and showed a single band at the proper length (if it is in pSB1C3, if it is in pSB4C5 then there was no insert). The IDT part was actually a religated backbone showing only one bad despite being cut twice.
• Transformed the golden gate rxn on the LuxS plasmid using our competent cells
• Planned out Flow Cytometry measurement process. Going to run flow cytometry on pt7_rbs (negative control), pt7_rbs_sfgfp_term (negative control), and constitutive promoter_rbs_sfgfp_term (positive control).

• Started overnight cultures on each of these parts.

Date:

07/31

To Do 

• Order low-copy plasmid
• Transform first plasmid
• PCR pSB1K3 backbone
• Create BioBricks
• Begin Flow Measurement

Accomplishment

• Completed PCR of pSB1K3, but accidentally left the initial denaturation step on for 7 minutes
• Transformed 3 trials of first plasmid ligation and control
• Ordered low copy plasmid
• Ordered primers for Gibson Assembly
• Ran golden gate pcr on pt7_rbs_sfgfp_term then ran a gel to gel extract only that amplified part that way the original backbone would not get in it
• Concentration was better this time; therefore, ran golden gate using that part and golden ready luxs and pGGA from the earlier golden gate reaction
• Ran a restriction digest (cut on E|P) on LuxS block, YdgG block, and Lsrk block and then gel extracted those pieces to ligate. This is to prepare the biobricks that can be shipped off to iGEm HQ

• Gel extractions were fairly low however. Better to use SeaPlaque agarose for gel extraction next time

Date:

07/30

To Do 

• Order low-copy plasmid
• Religate first plasmid
• Run a gel on the LuxS ligation
• PCR pSB1K3 backbone
• Run gel of uncut modified pBELOBac11 (to see if anything is actually in the miniprep)
• Run gel of cut modified pBELOBac11
• Try Imai method on overnight pBELOBac11 culture
• Send out modified pBELOBac11 DNA for sequencing
• LsrR_RBS_pLsr_RBS_sfGFP_T7

Accomplishment

• Ran gel on LuxS golden gate ligation. Was not successful. Seems like only the pt7_rbs_sfgfp_term was inside its original pSB1C3 plasmid
• Digested then ran a gel on pt7_rbs_sfgfp_term to gel extract it and then run golden gate pcr that way none of the original plasmid would be there. However, the gel extraction had very low concentration, 6.9ng/ul.

Date:

07/29

To Do 

• Grow out the one “successful” LuxS 3A assembly colony for miniprep monday
• Grow out LuxS golden gate colony for miniprep monday

Accomplishment

• Picked glowing One Plasmid + pT7-RBS-sfGFP-TT colonies to grow over night and restreak.
• Grew out constitutive promoter-RBS-T7-TT and LuxS golden gate colonies overnight.

Date:

07/28

To Do 

Accomplishment

• Ran pcr rxn to add neb golden gate primers for LuxS plasmid construction. LuxS block and sfGFP block are going to be added to the pGGA destination cloning vector. It is chloramphenicol resistant

• PCR reaction was fairly successful based on nanodrop results since they weren’t below 30 ng/uL this time. No guarantee still though

• Ran golden gate reaction on LuxS plasmid to create pT7_rbs_sfGFP_term_pT7_rbs_LuxS_term-pGGA
• Transformed LuxS golden gate plasmid using the NEB competent cells. Plated cells using dilution method that NEB protocol recommends. A pU19 plasmid was also plated to act as a control. It is ampicillin resistant
• LuxS 3A assembly plate looked to have only one colony that could be useful. There were a lot of red colonies meaning that the backbone never got digest properly.
• Transformed ligation of constitutive promoter-RBS-T7-TT
• Transformed ligation of One Plasmid + pT7-RBS-sfGFP-TT
• PCR purified and nanodropped the pSB1K3 reaction. Determined that it was a failure.

Date:

07/27

To Do 

Accomplishment

• Reran gel on pBeloBac with PstI single restriction digest.

• Still no successful bands

• Diluted new primers for LuxS plasmid for golden gate….primers based off of NEB Golden gate tool
• Received YdgG from IDT
• Ligated constitutive promoter-RBS-T7-TT and One Plasmid + pT7-RBS-sfGFP-TT, but used the wrong pipette. Remade both ligations and used shrimp alkaline phosphatase.
• Attempted to PCR amplify the pSB1k3 plamid
• Ligated LuxS plasmid using 3A assembly into pSB4K5

• Forgot to add shrimp phosphatase so reran digest using shrimp phosphatase
• One plate was plated with shrimp and the other without it

Date:

07/26

To Do 

Accomplishment

• Single restriction digest on pBeloBac using PstI

• No successful bands on gel

• Ran restriction digest on LuxS plasmid parts for 3A assembly

Date:

07/25

To Do 

Accomplishment

• Miniprepped two different versions of modified pBELOBac11 plasmid backbone
• Ordered Golden gate primers for LuxS block, but used neb golden gate assembly tool this time
• Used 3A assembly to piece together pt7_rbs_sfgfp_term and pt7_rbs_LsrK_term into pSB1K3. Added shrimp alkaline phosphatase (rSAP) to limit the backbone from reannealing

• Added the phosphatase after the digestion: 2ul of cutsmart buffer and 1ul of rSAP

Date:

07/24

To Do 

• Miniprep LsrR_rbs_pLsr_rbs_T7_term_pT7_rbs_sfgfp flourescent colony cultures
• Continue golden gate pcr primer rxn for constructing first plasmid

• Need to do T7 and B0015(Terminator)

• Run golden gate reaction to construct first plasmid

Accomplishment

• Transformed T7 from the kit
• Ran golden gate primer pcr on T7 and B0015; refer to notebook for exact protocol
• Ran golden gate ligation on first plasmid. Gel shows that none of the parts actually ligated during the reaction so the process was unsuccessful.
• Noticeable growth observed on pBELOBac11 Hans Method 150 uL on miniprepped pBELOBac11 backbone, Low growth observed on pBELOBac11 Hans Method 150 uL on transformed DH5alpha original backbone

Date:

07/23

To Do 

Accomplishment

• Received golden gate and gibson master mixes that Pure Solutions ordered
• Diluted primer order that came in today (200uM stock solution and 10uM working solution)
• Created more Kanamcyn agar plates
• Ran pcr rxn on pBeloBAC11 using Koz and Hansen method on “pBeloDircect” miniprep and “pBelo overnight culture” miniprep. A ligation was run on the Koz method reactions to ligate the backbone back together using T4 Ligase

• 2ul t4 ligase buffer
• 1ul t4 ligase
• 2ul Koz method pBelo
• 15ul water

• All four reactions were transformed and plated on chloramphenicol plates (4ul of the ligation reaction was used to the transformation; 2ul of the Hansen PCRs were used for the transformation)
• Tried to harvest more fluorescent colonies from the LsrR_rbs_pLsr_rbs_T7_term_pT7_rbs_sfgfp plate
• <img alt="" src="" style="width: 482.00px; height: 364.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
• <img alt="" src="" style="width: 482.00px; height: 364.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
• The first image is constitutively expressed sfGFP. The seond image shows a colony that looks to be flourescing from the LsrR_rbs_pLsr_rbs_T7_term_pT7_rbs_sfgfp plate
• Ran Golden Gate PCR primer rxn on pSB4K5 and LsrR_rbs_pLsr_rbs (refer to written lab notebook for exact protocol used)

Date:

07/22

To Do 

Accomplishment

• Grow overnight cultures for pBeloBAC11, ready the bacteria for miniprep, PCR, transformation on Monday

Date:

07/21

To Do 

Accomplishment

• Growth was visible on pBeloBAC11 plates, directly miniprepping was successful

Date:

07/20

To Do 

• Confirm Miniprepped pBeloBAC DNA from original strain, run gel from cultures → If this works, do all transformations, PCR-mediated deletions FROM miniprepped pBeloBAC

• Make glycerol stock solution for successful (if successful) culture

Accomplishment

• Gel possibly confirmed for miniprepped pBeloBAC11loxp2272? Expected 2 thick ~3000 BP bands and that is clearly shown, but there are other bands…

• <img alt="" src="" style="width: 323.46px; height: 431.50px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">

Date:

07/18

To Do 

Goals/Deadlines

Accomplishment

• Ordered shrimp alkaline phosphatase
• One colony of pBeloBAC cultured

Date:

07/17

To Do 

• Order shrimp alkaline phosphatase, new low copy backbone

Accomplishment

• Transformed DH5alpha cells w/ unmodified pBeloBAC11 backbone to see if this basic transformation attempt is successful
• Added golden gate primers onto Lsrk using same method as yesterday
• Ran golden gate reaction on the LsrK plasmid, used NEB protocol and equimolar calculator from Zargar (<a class="c45" href="https://www.google.com/url?q=http://www.insilico.uni-duesseldorf.de/Lig_Input.html&sa=D&ust=1535736625227000">http://www.insilico.uni-duesseldorf.de/Lig_Input.html</a>)

• 2.6ul pSB4A5
• 2ul Golden Gate NEB Buffer
• 1ul Golden Gate NEB Assembly master mix
• 2.3ul T7_term
• 0.5ul B0015
• 1.2ul LsrR_rbs_pLsr_rbs
• 3.8ul LsrK
• 6.6ul water

• Transformed 2ul of golden gate result
• Transformed LsrR_RBS_pLsr_RBS in chloramphenicol backbone.
• Grew out culture of B0015 transformed E. Coli for future B0015 terminator use.
• Received sequencing results for rbs_sfgfp...still analyzing them

Date:

07/16

To Do 

• Received second set of sequencing primers
• First attempt of golden gate, single plasmid
• Remove sites from single copy plasmid.

Accomplishment

• Added golden gate primers onto pSB4A5, LsrR_rbs_pLsr_rbs, T7_term, and term(B0015) using pcr

• Used Q5 High Fidelity Master Mix and protocol

• Did not receive great results based on the nanodrop

Date:

07/15

To Do 

Accomplishment

• LsrACDBTT, YdgGTT, LsrKTT, LuxSTT colony PCR were failures; they had bands at 300 but no other bands, which means no part was inserted into the plasmid backbone. 3A probably is not good for such short ligation.

Date:

07/11

To Do  

Accomplishment

• We got colonies on the sfGFP controlled by the constitutive promoter all the colonies were not flourescing, only a portion of them. We think this is due to the lack of terminator...need to do some testing to figure out why
• Ligated LsrR_rbs_pLsr_rbs_T7_term + pT7_rbs_sfGFP_term in pSB1K3 backbone
• Ligated LuxS, LsrK, and LsrACDB into pSB1k3 backbone and transformed them

Date:

07/10

To Do  

Accomplishment

• pT7+RBS confirmed: ~300bps, because it was PCRed with VF2 & Vr primers<img alt="" src="" style="width: 482.00px; height: 336.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
• pT7+RBS+sfGFP+pT7+RBS confirmed:<img alt="" src="" style="width: 482.00px; height: 337.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
• Transformed constitutive promoter(plus rbs) sfGFP (in pSB1K3)

Date:

07/09

To Do 

• Create standard sequencing protocol in the handbook
• Get forward only primers for sequencing
• Run gels on LsrKTT & LsrACDBTT
• Make mid-sequence primers for LsrK (1600+), T7-term (3000), LsrACDB (4500) for sequencing.
• Resend samples for sequencing (9/13)
• Obtain all plasmids necessary for further work (9/13)

Accomplishment

• (assuming that all parts are in vectors and also using VF2&VR primers)

• LsrK (BBa_K1202109) primer:

• Ctgtggctggcacatcatcgtagcg (@500bp)

• T7-term (BBa_K145001) primer:

• Gttcaggctgtagcaagcgcaatcg (@400bp) - 1
• Cagtaagaaagcactgatgcgctac (@900bp) - 2
• Tgcgggtgtcgataaggttccgttc (@1400bp) - 3
• Tcatgacgctggcttacgggtccaa (@1900bp) - 4

• LsrACDB primer:

• GCCGATCGCCAAATGGTGGAAATCC (@430bp)-1
• TATGCTGAATGGTAAAGAGATCAAT(@960bp)-2
• TGCGCGTTGCCTTCGGCGATAGTCA(@1490bp)-3
• GGTTGACGATAATTCTGGTGGCATT (@2020bp)-4
• CCGCATAATGCGTATTCGCTACGGT (@2550bp)-5
• CTCGTTTTCTGGCTCTGGCTGCATA (@3080bp)-6
• ATTGCCGCAATCTCTATGAATGTGC (@3610bp)-7

• Golden gate primers for LsrK plasmid...check csv file
• Ligated a constitutive promoter(plus rbs) onto sfGFP to check if fluorescence actually occurs with a Kanamicin backbone(pSB1K3)

Date:

07/06

To Do 

• Need more Amp plates

Accomplishment

• Redid ligation of LsrKTT & LsrACDBTT because gel did not show proper bands

Date:

07/05

To Do 

Accomplishment

• Ran gel of digested LsrK+TT, LsrACDB+TT, pT7rbs+sfGFP+pT7rbs, strong RBS, pT7sfGFP, lsrR+rbs+plsr+rbs, B0034, T7+terminator (F1, I2, G2, H8)(orange samples are the parts sent for sequencing
• Another gel of LuxS, LsrK, YdgG, LsrACDB, pT7rbs

Date:

07/03

To Do 

Accomplishment

• Ligated and transformed pT7rbs+sfGFP+pT7rbs
• Cultured LsrK+TT, LsrACDB+TT

Date:

07/02

To Do 

Accomplishment

• LuxS, LsrK, YdgG, LsrACDB, Lsr+rbs+plsr+rbs, pT7+rbs+sfGFP, B0034, T7-terminator sent to sequencing
• Ligated and transformed LsrK+TT, LsrACDB+TT
• Agar plates with both Amp and Cm made

Date:

06/29

To Do 

• PCR lsrACDB out of genome again
• Purify and send out parts for sequencing
• Religate the first plasmid

Accomplishment

Date:

06/28

To Do 

• Run digests and gels on all unconfirmed parts (ACDB, ACDB + RBS, LsrK, Plasmid 1 religation)
• PCR LuxS
• Prepare parts with proper lengths for sequencing
• List which parts need to be remade

Accomplishment

• PCR on LuxS
• Ran a gel on LuxS and other parts. Confirmed LuxS length.
• Ran a gel on lsrACDB, RBS+ACDB, pT7+RBS+sfGFP, RBS+YdgG, and sfGFP digested with E-HF and P-HF. P-HF cannot be heat killed, so this was a mistake. Both parts with ACDB show problems. The other three parts look the correct length, although sfGFP looks to be a partial digest.<img alt="" src="" style="width: 482.00px; height: 241.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">

Date:

06/27

To Do 

• Do PCR to make more parts, especially kanamycin backbone
• Transform LsrR+rbs+pLsr+rbs+pSB1C3

Goals/Deadlines

• Complete ILS (6/29)
• Complete and verify lengths of pT7 + RBS + sfGFP, RBS + LsrACDB, RBS + LuxS, RBS + LsrK, and Ordered part + T7term (06/29)
• Find Single copy backbone (for double plasmid)

Accomplishment

• Transformed YFL, CFP, OFL, PFP to create fluorescent plates
• Restriction digest on pT7+rbs+sfGFP
• Transformed IDT Part that was cloned into a vector yesterday (LsR+rbs+pLsr+rbs)
• Performed PCR on pSB1C3/A3/K3 as well as pT7-RBS, and pT7-RBS-sfGFP
• Ran a gel on the above parts. Backbone PCRs showed success. pT7-RBS-sfGFP looks to have successfully ligated, but not fully digested. New gel will be run tomorrow. pT7-RBS band appears at 400bp, which is approx. where it should be due to extra bps from the PCR primers used. A second band appears in the well however, there should only be one.
• Competed ILS

Date:

06/26

To Do 

• Move pT7-RBS-sfGFP transformants to cultures and restreak plates.
• Purify pT7-RBS-sfGFP
• Troubleshoot problems in digest procedure
• Verify lengths of parts

Goals/Deadlines

• Complete ILS (6/29)
• Complete and verify lengths of pT7 + RBS + sfGFP, RBS + LsrACDB, RBS + LuxS, RBS + LsrK, and Ordered part + T7term (06/29)
• Find Single copy backbone (for double plasmid)

Accomplishment

• Moved pT7-RBS-sfGFP transformants to cultures and restreak plates.
• New digest procedures tested successfully, neither using BSA. The first digest used Cutsmart and the second digest used NEBuffer 2.1. Gel revealed that the insert length for plasmid 1 is approximately 1500 bp (near the 1337 of the IDT ordered part), rather than the 6000 bp it should have been.

• Gel of plasmid 1 digested with (from left) cutsmart buffer, buffer 2.1, and uncut.<img alt="" src="" style="width: 482.00px; height: 241.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
• Appears that there is the backbone (~2200 bp) and IDT part (1337 bp)
• 7 μL DNA, 2.5 μL buffer, 0.5 μL per enzyme (E & S used), 14.5 μL H2O. 37˚C for rxn and 80˚C for heat kill, 20 minutes each.
• Digested pSB1C3 and IDT Part (LsrR+rbs+pLsr+rbs) both with E|S. Then ligated both:

• Ligation protocol → 20uL Reaction

• 2uL of pSB1C3
• 4uL of IDT Part
• 1uL of T4 Ligase Buffer
• 0.5uL of T4 Ligase Buffer
• 12.5uL of MilliQ Water
• Incubate at 16C for 30 mins then heat killed at 80C for 20 mins

Date:

06/25

To Do 

• Email Endy again
• Restreak pSB4K5 and pSB4A5 restreaks
• Purify pSB4K5, pSB4A5, and Plasmid 1 from O/N cultures
• Sequence stuff!

Goals/Deadlines

• Complete ILS (6/29)
• Complete and verify lengths of pT7 + RBS + sfGFP, RBS + LsrACDB, RBS + LuxS, RBS + LsrK, and Ordered part + T7term (06/29)
• Find Single copy backbone (for double plasmid)

Accomplishment

• Learned gateway assembly
• pSB4A5 and pSB4K5 restreaked
• Emailed Endy, Clonetegration is coming
• Ran 2 half gels on Plasmid 1 digest. Nothing was seen in the wells, but DNA was apparent when undigested Plasmid 1 DNA was run. Potential problem with the new enzymes, buffer, or the digest procedure. The following is Plasmid 1 undigested. The lane appears much smaller than it should be (must be noted that plasmid is still in a circular form)<img alt="" src="" style="width: 482.00px; height: 337.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""> 

Date:

06/22

To Do 

• Assess new competent cells
• Check for successful transformants and move to shaker O/N
• PCR LuxS out of iGEM part (Will)
• Transform pSB4C5 and pSB4A5 (Vignesh)
• Catalogue successfully made parts

Goals/Deadlines

• Go and learn how to do Goldengate

Accomplishment

• New competent cells have transformation efficiency of 1.6 x 107
• Primers for amplifying iGEM parts ordered from IDT

Date:

06/21

To Do 

• Make new competent cells (Nick, Paul, Kevin)
• Transformations of pSB4A3, pSB4K3, IDT-T7-Term (Vignesh)
• Mini-prep RBS-Shaker (Paul)
• PCR out of iGEM parts (Will, Kevin)
• Make more agar plates (Dylan)
• Email Endy

Goals/Deadlines

• Complete ILS (6/29)
• Complete RBS + sfGFP, T7 + Term, RBS + YdgG, RBS + LsrACDB, Ordered part + T7term (06/29)
• Find Single copy backbone (for double plasmid)

Accomplishment

• Made new competent cells
• Made more Ampicillin and Kanamycin plates
• Transformed pSB4A3, pSB4K3, IDT-T7-Term
• Began test of new vs old competent cells
• PCR done with LsrK, LuxS on iGEM parts; used primers from IDT

Date:

06/20

To Do 

• Make more agarose gels (Nick)
• Run gels of ligation products
• Transfer RBS-sfGFP to shaker tubes
• Restreak?
• Ligate IDT part + T7-Term
• Check on growth for competent cell creation (Nick, Vignesh)
• Get more pipette tips and foil
• Check on status of iGEM ordered parts
• Order primer for PCR on plasmid backbones
• Order Gibson/Gate primers

Goals/Deadlines

• Complete ILS
• Complete RBS + sfGFP, T7 + Term, RBS + YdgG, RBS + LsrACDB, Ordered part + T7term (06/29)
• Find Single copy backbone (for double plasmid)

Accomplishment

• Did miniprep of grown cultures of RBS+YdgG, T7-terminator, RBS+LsrADCB.
• Made a gel
• Got more pipette tips
• Received iGEM parts
• Ordered backbone primers
• Ran gel of (from left) T7+terminator, RBS+YdgG, RBS+LsrACDB digested with EcoRI, SpeI, XbaI, and Cutsmart buffer newly arrived from NEB. Used the old PstI-HF instead of new PstI<img alt="" src="" style="width: 482.00px; height: 241.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
• The plasmids seem not cut properly. We messed up in the preparation, or the new enzymes were bad.

Date:

06/19

To Do 

• Rerun gel on RBS, Term, and LsrACDB (Will)

• Begin ILS cell measurement (Ngozi)
• Rehydrate and store LsrR+RBS+Proms+RBS (Kevin)
• Religate RBS + sfGFP
• Transform bacteria with RBS-sfGFP
• Transfer successful transformants to overnight broths
• Prepare for creation of new competent cells on Thursday (Vignesh)

Goals/Deadlines

• Complete ILS
• Complete RBS + sfGFP, T7 + Term, RBS + YdgG, RBS + LsrACDB, Ordered part + T7term (06/29)

Accomplishment

• Received NEB Order, added to inventory
• Prepared LB and DH5 preculture for competent cell creation
• Made overnight transformant pre-cultures
• Redid RBS + sfGFP ligation and plated
• Reran gel on RBS, Term, and LsrACDB. Gels imaged very poorly
• Rehydrated and stored LsrR+RBS+Proms+RBS

Date:

06/18

To Do 

• Make more gels
• Check PCR of ACDB
• Check transformations of Term. and RBS
• Assemble RBS + sfGFP, T7 + Term, RBS + YdgG, RBS + LsrACDB, Ordered part + T7term.
• Make orders for supplies

Accomplishment

• Made Kanamycin agar plates
• Made 2 agarose gels, used 1
• Two unknown gels run. One at 10 am, 1 at 4 pm.
• Obtained more agarose, ph probe storage buffer, and petri plates from Ms. Christopher; she will order more plates for us.
• Assembled RBS + sfGFP, T7 + Term, RBS + YdgG, RBS + LsrACDB

Date:

06/15

To Do 

• Re-run gels
• PCR using the primers we got (single colony PCR)
• Pick the transformed colonies
• Transform RBS and terminator
• Purify T7 rna polymerase from cut gel
• Glycerol stock solution of the original cells

Goals/Deadlines

• Make pT7+sfGFP & first plasmid by end of June/start of July

Accomplishment

• Glycerol stock solution of DH5 alpha, JM109, XL1-Blue made and stored in -80 degrees celsius
• Gel purification done
• The reason why B0034 was not transforming found: it is in an ampicillin resistance backbone, but we have been growing it in chloramphenicol agar plate.
• All ILS transformants were inoculated into 15 mL falcon tubes to grow overnight.
• Duplicate transformant plates were disposed of.
• Inventory was made of plates in the 4˚C refrigerator.
• PCR was completed for YdgG

• Two reactions worth of mastermix was made in a tube with 10 microL Buffer, 2 microL dNTPs, 6 microL MgCl2, 0.8 microL Taq polymerase, and 61.2 microL water.
• Dissolved 1 colony of non-competent, un-transformed DH5-alpha in 25 microL water.
• Diluted 100 mM of RNA primer into a 10 mM stock.
• Pipetted 50 microL of the mastermix into a tube with 5 microL of diluted primer, and 5 microL of dissolved DH5.
• PCR was set to denature a 95˚C for 1 min, then cycle 8 times with an annealing temperature of 51˚C and extension temperature of 68˚C for 1 minute 2 seconds. The next 22 cycles were with an annealing temperature of 60˚C and extension temperature of 68˚C 1 minute 2 seconds. Final extension was 10 minutes at 68˚C.
• Same done for ACDB, except that the second annealing temperature was 61˚C and each extension cycle was 4:36.

YdgG gel

<img alt="" src="" style="width: 323.00px; height: 499.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">

Gel confirms that YdgG was amplified. Since this gel was run from PCR product, only one band was expected. The band is seen between 1615 and 1018 bp, but much closer to 1018. Its expected length is 1035.

Date:

06/14

To Do 

• Restreak bottom row plates again
• Check growth in ILS plates
• Analyze results from yesterday’s gel
• Rerun gel for gel excision and purification

Accomplishment

<img alt="" src="" style="width: 482.00px; height: 593.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">

• Gel of 1kb ladder, T7 rna polymerase (left)(E/S) and B0017 terminator (right)(X/P)
• The terminator is not showing two bands again… sequencing these would be nice. Why is this happening?
• The E/S pair used this time proves to be working.

• Cut gels and stored in 4 degree C for purification tomorrow

Date:

06/13

To Do 

Miniprep DNA from successful transformants

Create agarose gel

Run gel with transformant DNA and RFP insert as positive control to verify transformation and working restriction enzymes

Goals/Deadlines

Gibson Primers

Successfully transform sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase, Terminator, and plasmid backbones. (by 6/15)

Verify transformations by running a gel. (by 6/15)

Assemble T7 RNA Polymerase + Terminator (by 6/22)

PCR out all necessary genes and transform (6/22)

Accomplishment

Ran gel to assess transformations and enzyme function

Mini-prepped DNA

Ran gel

<img alt="" src="" style="width: 482.00px; height: 349.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">

• Gel of (from left) 1kb ladder, T7 rna polymerase(X/P), B0017 terminator(X/P), sfGFP(E/S), pT7 (E/S), pSB4C5 (X/P), strong RBS + Promotor (E/S). One out of E or S is probably bad
• T7 rna polymerase, as it should be, is in two pieces of ~2000 (psb1c3 backbone) & ~2700 bps.
• B0017 terminator, as it should, has a piece ~2000 (backbone), but is missing the 170bp part. Perhaps it is not visible because it is too small. But 2000 bp shows that it cut properly at both X and P sites.
• sfGFP part is 717bp, backbone is pSB1C3. So the total should be ~2700bp. The band shown is about 3000bp. This is likely because there has been only one cut but no second cut, so the entire linear plasmid ran through the gel.
• That explains why pT7, also cut with E/S, seems to be ~2000 bp just like it should. Since at least one site was cut, the band appears at 2000 bp. Same conclusion with strong RBS + promotor
• The fact that there are two bands for pSB4C5 means that both sites have been cut. But the sequence for pSB4C5 is unknown.

Retried unsuccessful transformants

Re-Streaked plates from successful transformants

Date:06/12

To Do 

Find, order Restriction Enzymes  

Check Transformed Bacteria → Transfer to Broth  

Check for IDT orders

Goals/Deadlines

• Successfully transform sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase, Terminator, and plasmid backbones. (by 6/15)
• Verify transformations by running a gel. (by 6/15)
• Assemble T7 RNA Polymerase + Terminator (by 6/22)
• PCR out all necessary genes and transform (6/22)

Accomplishment

• Successful colonies (sfGFP, strong promoter + RBS, pT7, T7 RNA polymerase, psb4c5). LsrR was unsuccessful
• Made stock solutions of the colonies, 6 mL each
• Found and made list of previous iGEM team’s restriction enzymes

Date:06/11

To Do 

• Make agarose gels and glycerol stock for long term bacterial storage.

Goals/Deadlines

• Successfully transform sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase, Terminator, and plasmid backbones. (by 6/15)
• Verify transformations by running a gel. (by 6/15)
• Assemble T7 RNA Polymerase + Terminator (by 6/22)

Accomplishment

• Transformed LsrR, sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase
• Agarose gel made and run with B0017; but we did not cut the DNA before running it on gel, so the true plasmid size was undetermined (should be around 2200bps, shown is only 1500bp)<img alt="" src="" style="width: 482.00px; height: 236.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
• Glycerol stock solution of B0017 cells made (50:50 glycerol:cell volume) and stored in -80, at the 2nd compartment from top

Date:06/10

To Do

Goals/Deadlines

• Successfully transform sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase, Terminator, and plasmid backbones. (by 6/15)
• Verify transformations by running a gel. (by 6/15)
• Assemble T7 RNA Polymerase + Terminator (by 6/20)

Accomplishments

• Successfully transformed, bred, and miniprepped B0017
• Some B0017 cells still left in fridge

Date:06/08

To Do 

• Make Agar plates with Amp
• Obtained from Prof. Koz his competent cells (1,2,2,3,3) and DNA: Transform the cells with his DNA and B0017.

Goals/Deadlines

• Successfully transform sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase, Terminator, and plasmid backbones. (by 6/15)
• Verify transformations by running a gel. (by 6/15)
• Assemble T7 RNA Polymerase + Terminator (by 6/20)

Accomplishment

• 1, 2, 2, 3 were transformed with Amp resistance gene.

• Standard heat shock
• 1uL of dna into 100uL of competent cells
• Incubate on ice for 15-20 mins
• Heat shock at 42C for 90 seconds
• Incubate on ice for 5 minutes
• Add 900uL of LB to competent cells

• Grow in 37°C for 1 hour in long glass tubes, shaking
• Transfer 1 mL to eppendorf tube
• Spin down @ 8000rpm for 1 min
• Take out 800 µL of supernatant
• Resuspend pellet in remaining 200µL
• Plate 50 µL on one plate, 150 µL on another

centrifuged samples twice because pellets were so small.

because pellets were so small after 1 hours incubation, 2, 2, 3 were incubated an additional hour and then centrifuged again. 1 and DHL were plated normally.

Date:06/07

To Do 

• Fix transformation protocol
• Analyze results from yesterday
• Send out IDT order (DNA + primers)

Goals/Deadlines

• Verify transformation of cells with sfGFP(1365020), pT7 (K525088), RBS (K608022), T7Rpol, and Terminator (B0017) with gel. (by 6/8)

Accomplishment

• We got competent cell success on the plate without any antibiotic but none of the transformed bacteria on plates with Cm grew. Going to try a new protocol (God Eric’s) using SOC media instead of LB media.
• Ordered primers and one item for synthesis
• Creating new Cm stock with 350 mg in 10 mL EtOH.
• SOC Protocol (<a class="c45" href="https://www.google.com/url?q=http://www.fbs.leeds.ac.uk/facilities/protein/documents/SOC.pdf&sa=D&ust=1535736625381000">http://www.fbs.leeds.ac.uk/facilities/protein/documents/SOC.pdf</a>)

• For 500ml:
• 10g tryptone
• 2.5g yeast extract
• 0.25g NaCl
• 0.5ml 2.5M KCl
• Then autoclave
• 2.5 ml 2M MgCl2
• 10ml 1M Glucose

• Transformed and Plated sfGFP (one with SOC media and the other with LB), pLsrA, T7 RNA Polymerase, LsrR, pT7. Using LB unless specified otherwise
• Made new Chloromphenical Plates (35ug/ml)
• Diluted RBS(B0034), Strong Promoter + RBS (K608022), Promoter (K823003), and Double Terminator (B0017) from the distribution kit with 10ul of MilliQ water.
• Finished ordering all primers (LsrK, LuxS, LsrACDB, YdgG) and DNA (LsrR + pLsrR + pLsrA) with IDT

Date:06/06

To Do 

• Order all DNA and RNA primers (complete by 5 pm today)
• Send out IDT order

Goals/Deadlines

• Verify transformation of cells with sfGFP(1365020), pT7 (K525088), RBS (K608022), T7Rpol, and Terminator (B0017) with gel. (by 6/8)

Accomplishment

• Finished iGEM Safety Form (Proofreading required from other team members)
• Created new Chloramphenicol plates with 500 ul of 350 mg/ml stock chloramphenicol in 500 mL LB. Stock Cm solution may be mislabeled.

Date:06/05

To Do 

Goals/Deadlines

• Order all DNA and RNA primers (complete by 5/31)
• Send out IDT order

Accomplishment

• Transformed competent cells with sfGFP(1365020), pLsrA(117002), LsrR (K091001), pT7 (K525088)

• Failed: all plates had no growth after overnight culture

To Do 

• Analyze results of competency test
• Remake plates containing antibiotic (they were left out all night)
• Transform competent cells with sfGFP(1365020), pLsrA(117002), LsrR (K091001), pT7 (K525088)
• Find out how to sequence genes (do we need to?)
• Interlab- Microsphere

Goals/Deadlines

• Order all DNA and RNA primers (complete by 5/31)
• Send out IDT order
• Create Competent Cells (completed)
• Interlab- Microsphere (completed)

Accomplishment

• Confirmed successful competency test
• Figure A. Cells transformed with BBa_J04450 grew on Chloramphenicol plates, while untransformed cells did not.
• Figure B. Untransformed cells were unable to grow on Ampicillin, showing that there was no antibiotic resistant contamination. A second Chloramphenicol plate was inoculated with DH5-alpha transformed with BBa_J04450 to reconfirm.<img alt="" src="" style="width: 237.68px; height: 317.50px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
• Created new Ampicillin and Chloramphenicol plates
• Interlab- Microsphere (completed)

Date:06/03

To Do 

• Continue incubating 500 mL of DH5-alpha to create competent cells
• Continue monitoring growth to determine when OD will reach 0.12 (Its taking twice as long as it should).
• Complete competent cell procedure if possible

Goals/Deadlines

• Order all DNA and RNA primers (complete by 5/31)
• Send out IDT order
• Create Competent Cells (complete by 6/4)

Accomplishment

• Growth continued DH5a culture in 500ml Flask (LB + 2.5ml MgCl20) in Kozminski lab for competent cells; 12:00 am = OD 0.09; 3:00 am = OD 0.104; 7:00 am = OD 0.13
• Completed competent cell procedure
• Prepared competence test (attempted transformation with RFP, plated on Chloramphenicol. Plated untransfromed cells on chloramphenicol and ampicillin as control. Incubated at 37˚C.)

Date:06/02

To Do 

• Continue incubating 500 mL of DH5-alpha to create competent cells
• Continue monitoring growth to determine when OD will reach 0.12 (Its taking twice as long as it should).
• Complete competent cell procedure if possible
• Interlab - Ludox protocol

Goals/Deadlines

• Order all DNA and RNA primers (complete by 5/31)
• Send out IDT order
• Create Competent Cells (complete by 6/4)
• Interlab - Ludox protocol

Accomplishment

• Created Transformation Buffer
• Started growth of DH5a culture in 500ml Flask (LB + 2.5ml MgCl20) in Kozminski lab for competent cells; 11:00 am = OD 0.053; 2:45 pm = OD 0.059; 9:00 pm = OD 0.074
• Interlab - Ludox protocol is complete

Date:06/01

To Do 

• Incubate 500 mL of DH5-alpha to create competent cells
• Monitor growth to determine when OD will reach 0.12
• Interlab - Plate reader information

Goals/Deadlines

• Order all DNA and RNA primers (complete by 5/31)

• Send out Free IDT Base Pair Application (cannot proceed with IDT orders until they respond)
• Create Competent Cells (complete by 6/4)
• Collect Plate reader information

Accomplishment

• Sent out Free IDT Base Pair Application (cannot proceed with IDT orders until they respond)  
• Started growth of DH5a culture in 500ml Flask (LB + 2.5ml MgCl20) in Kozminski lab for competent cells; Growth started at 3:30 → t0 = 0.048 OD; 5:30 pm = OD 0.048;
• Plate reader information collected except filter and bandpass information need to be confirmed from Koz and Dr.Spano

Date:05/31

To Do 

• Grow up second set of cultures

Goals/Deadlines

• Create competent cells (complete by 5/31)
• Order all DNA and RNA primers (complete by 5/31)
• Send out Free IDT Base Pair Application (cannot proceed with IDT orders until they respond)

Accomplishment

• Created Transformation Buffer (This buffer ended up precipitating and needed to be remade).

Date:05/30

To Do 

• Take bacteria colony and put it into 2 mL of broth, incubate
• Create competent cell reagents

• Make 1M CaCl2/2H2O
• Make 0.5 M MnCl2/4H2O
• Find PIPES, N2, DMSO

• Send out some IDT orders
• Understand, Figure out

• Golden Gate
•  J5
• Clonetegration
• AI-2 Assay
• BglBricks

Goals/Deadlines

• Create competent cells (complete by 5/31)
• Order all DNA, DNA and RNA primers (complete by 6/1)

Accomplishment

• Created bacterial colony
• Created competent cell reagents
• Info obtained on Goldengate
• Obtained Flow Cytometry Authorization

Date:05/29

To Do 

• Housekeeping: Inventory and reorganize lab
• Create Ampicillin stock solution
• Create Chloramphenicol stock solution
• Create LB plates (Control, ampicillin, chloramphenicol)
• Create LB broth
• Incubate cells to be made competent

Goals/Deadlines

• Create competent cells (complete by 5/31)
• Order all DNA and RNA primers (complete by 5/31)

Accomplishment

• Created Ampicillin stock solution

• Created Chloramphenicol stock solution
• Created LB plates (Control, ampicillin, chloramphenicol)
• Created LB broth
• Incubated cells to be made competent
• Inventory

Date:05/23

To Do

Accomplishment

• Synthesis and Assembly plan
• Use IDT to synthesize the T7Rpol? Or the entire plsr + T7Rpol + terminator sequence. We have 20 kb of free synthesis, but it will likely take 18-25 days to ship.
• We plan to try to make the plasmids with Gibson assembly unless it gives us significant trouble due to the size of the pieces being used. Contact former VA iGEM member Eric about his mastermix for Gibson assembly from last year.