Difference between revisions of "Team:BNU-China/Interlab"

Line 274: Line 274:
 
                
 
                
  
                   <div class="texttitle"><a id = "Method">Method</a></div>
+
                   <a id = "Method"><div class="texttitle">Method</div></a>
 
                   <p>This year’s interlab study aims to reduce a major source of variability during fluorescence measurements: the number of cells in the sample. Normally, we take the Abs600 of a sample as a representation of its cell density, but still many previous studies showed that there was significant lab-to-lab variability(?). Therefore, we followed the protocols delivered by the iGEM authority and carried out this verification.</p>
 
                   <p>This year’s interlab study aims to reduce a major source of variability during fluorescence measurements: the number of cells in the sample. Normally, we take the Abs600 of a sample as a representation of its cell density, but still many previous studies showed that there was significant lab-to-lab variability(?). Therefore, we followed the protocols delivered by the iGEM authority and carried out this verification.</p>
 
                   <br>
 
                   <br>

Revision as of 21:07, 7 October 2018

Proof

Interlab

The Peking iGEM 2016 team is participating in the third year of the iGEM Interlab study along with about 100 teams. We focused on quantifying expression of GFP in common, comparable or absolute units.

Introduction

The Measurement Committee is committed to achieving reliable and repeatable measurement. Therefore the interlab study is established, measurements made in different laboratories by measuring the expression of GFP will be no more variable than measurements taken within the same lab.

After several years of hard work, the committee concluded a universal protocol for measuring GFP expression. In recent years, the interlab study aims to improve the protocol and identify and correct the sources of systematic variability as much as possible.


<div class="texttitle">Method</div>

This year’s interlab study aims to reduce a major source of variability during fluorescence measurements: the number of cells in the sample. Normally, we take the Abs600 of a sample as a representation of its cell density, but still many previous studies showed that there was significant lab-to-lab variability(?). Therefore, we followed the protocols delivered by the iGEM authority and carried out this verification.


According to the protocol, we performed three calibration experiments (OD600 reference point, particle standard curve and the fluorescence standard curve) before the body part began. Results shown below.


Table 1. OD600 reference point


4 replicates are measured respectively to acquire the average Abs600 of LUDOX CL-X solution and dH2O. Reference OD600 is given by the iGEM authority. The ratio of OD600/Abs600 is 3.652.


Figure 1A Particle Standard Curve

Figure 1B Particle Standard Curve (log scale)

We use the silica beads delivered by iGEM and made a serial dilution in the 96-well plate according to the protocol. 4 replicates were measured in total. Origin data presented at the bottom of this page.

Figure 2A Fluorescein Standard Curve

Figure 2B Fluorescein Standard Curve(log scale)

We use the fluorescein powder delivered by iGEM and made a serial dilution in the 96-well plate according to the protocol. 4 replicates were measured in total. Origin data presented at the bottom of this page.

After finishing the calibration, we carried out the cell culturing and the measurements of Abs600 and fluorescein.

First of all, we transformed the given plasmids into E.coli K-12 DH5-alpha on the plates of LB medium with chloramphenicol of 25μg/ml in 37℃, and picked 2 colonies of each plate over night, inoculating into 5ml Luria- Bertani liquid medium with 25 μg/mL chloramphenicol, incubating in 37°C at the speed of 220 rpm for 16hrs.

Secondly, the cell cultures were diluted to the concentration of Abs600=0.02 for target start and were transferred to the same LB medium of 12mL in 50mL falcon tubes, at the same incubator above. At the time of 0 and 6 hours of incubation, we took off 500μL into 1.5 ml eppendorf tubes of each colony of 8 devices, and placed them on ice to prevent from further growth.

Last but most importantly, we pipetted 4 replicates samples of each devices, 100μL per well, into a 96-well plate. Samples were laid out according to the plate diagram shown in the protocol.


Results

Sequencing

• Device 1: J23101+I13504
• Device 2: J23106+I13504
• Device 3: J23117+I13504
• Positive Control Device: I20270 in pSB1C3
• Negative Control Device: R0040 in pSB1C3

>BBa_J23101 Part-only sequence (35 bp)
Tttacagctagctcagtcctaggtattatgctagc

>BBa_J23106 Part-only sequence (35 bp)
Tttacggctagctcagtcctaggtatagtgctagc

>BBa_J23117 Part-only sequence (35 bp)
Ttgacagctagctcagtcctagggattgtgctagc

>BBa_I13504 Part-only sequence (875 bp)
Aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

>BBa_I20270 Part-only sequence (919 bp)
Ttgatggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

>BBa_R0040 Part-only sequence (54 bp)
tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac

Data

OD600 Reference Point

Table 1. OD600 Reference Point.


FITC Standard Curve

Table 2. Data of FITC standard curve.

Figure 2. FITC standard curve.


Normalization

Table 3. Normalization.


Cell Measurement

Table 4. Raw data of Abs600 measurement.

Table 5. Blank subtraction and correction of Abs600 measurement.

Figure 3. Blank subtraction and correction of Abs600 measurement.

Table 6. Raw data of fluorescence measurement.

Table 7. Blank substraction and correction of fluorescence measurement.

Figure 4. Blank subtraction and correction of fluorescence measurement.

Table 8.Raw data of Fl/Abs600.

Table 9. Raw data of average and SD.

Figure 4. Average level of devices.

Discussion

It is noticeable that the promoter of the Device 1 is strongest followed by the promoter of the Device 2 and Device 3.

Appendix

Individuals responsible for conducting InterLab study • Dong Yiming measured the devices. • Li Cheng processed the data.