|
|
| Line 4: |
Line 4: |
| | | | |
| | <body> | | <body> |
| | + | <button onclick="topFunction()" id="myBtn" title="Go to top">Top</button> |
| | | | |
| | <main> | | <main> |
| Line 41: |
Line 42: |
| | | | |
| | <div class="tab-pane fade show active" id="Detection" role="tabpanel" aria-labelledby="home-tab"> | | <div class="tab-pane fade show active" id="Detection" role="tabpanel" aria-labelledby="home-tab"> |
| − | <p>Raw denim you probably haven't heard of them jean shorts Austin. Nesciunt tofu stumptown aliqua, retro synth master cleanse. Mustache cliche tempor, williamsburg carles vegan helvetica. Reprehenderit butcher retro keffiyeh dreamcatcher | + | <p class="lead">Raw denim you probably haven't heard of them jean shorts Austin. Nesciunt tofu stumptown aliqua, retro synth master cleanse. Mustache cliche tempor, williamsburg carles vegan helvetica. Reprehenderit butcher retro keffiyeh dreamcatcher |
| | synth. | | synth. |
| | </p> | | </p> |
| Line 48: |
Line 49: |
| | | | |
| | <div class="tab-pane fade" id="ImmuneResponse" role="tabpanel" aria-labelledby="profile-tab"> | | <div class="tab-pane fade" id="ImmuneResponse" role="tabpanel" aria-labelledby="profile-tab"> |
| − | <p>Cosby sweater eu banh mi, qui irure terry richardson ex squid. Aliquip placeat salvia cillum iphone. Seitan aliquip quis cardigan american apparel, butcher voluptate nisi qui.</p> | + | <p class="lead">Cosby sweater eu banh mi, qui irure terry richardson ex squid. Aliquip placeat salvia cillum iphone. Seitan aliquip quis cardigan american apparel, butcher voluptate nisi qui.</p> |
| | </div> | | </div> |
| | | | |
| Line 57: |
Line 58: |
| | <div class="container"> | | <div class="container"> |
| | <div class="row justify-content-center lead"> | | <div class="row justify-content-center lead"> |
| − | <div class="col-lg-9"> | + | <div class="col-lg-12"> |
| | <h1>Project Design for miRNA</h1> | | <h1>Project Design for miRNA</h1> |
| | + | <br> |
| | <!-- Article body --> | | <!-- Article body --> |
| | <article> | | <article> |
| | <h2><u>Design of the dumbell-probes and gRNAs</u></h2> | | <h2><u>Design of the dumbell-probes and gRNAs</u></h2> |
| − | <p>As a first miRNA target, we decided to consider let-7a-5p: this miRNA is not among the ones found to be relevant as melanoma biomarkers (as instead are other miRNAs of the let-7 family) [1, 2]; nonetheless, we thought it might | + | <br> |
| | + | <p class="lead">As a first miRNA target, we decided to consider let-7a-5p: this miRNA is not among the ones found to be relevant as melanoma biomarkers (as instead are other miRNAs of the let-7 family) [1, 2]; nonetheless, we thought it might |
| | be the best option to start from it as a proof of concept, because it was already well characterized for Rolling Circle Amplification (RCA) by Deng et al. [3] and Qiu et al. [4]. </p> | | be the best option to start from it as a proof of concept, because it was already well characterized for Rolling Circle Amplification (RCA) by Deng et al. [3] and Qiu et al. [4]. </p> |
| | | | |
| − | <p>Qiu et al. [4], as well as our colleagues from the related 2016 iGEM team of NUDT China, had designed their probes in order for the amplicons to be recognized by a CRISPR-Cas 9 system. Since our project deals instead with CRISPR-Cas | + | <p class="lead">Qiu et al. [4], as well as our colleagues from the related 2016 iGEM team of NUDT China, had designed their probes in order for the amplicons to be recognized by a CRISPR-Cas 9 system. Since our project deals instead with CRISPR-Cas |
| | 12a, despite the miRNA sequence being the same, we therefore had to modify the sequences of our probes accordingly. More specifically, we had to adapt the PAM sequence (placed on the amplicon of the probe) in order to match | | 12a, despite the miRNA sequence being the same, we therefore had to modify the sequences of our probes accordingly. More specifically, we had to adapt the PAM sequence (placed on the amplicon of the probe) in order to match |
| | our Cas protein (we worked with LbCpf1): while the requirement for Cas9 was NGG on the 3' of the amplicon, in our case we needed to have TTTN on the 5'. More details on the design are described in the section "Detailed design".</p> | | our Cas protein (we worked with LbCpf1): while the requirement for Cas9 was NGG on the 3' of the amplicon, in our case we needed to have TTTN on the 5'. More details on the design are described in the section "Detailed design".</p> |
| | | | |
| − | <p>We wanted to test different designs of probes: some were conceived to have the PAM at the beginning of the larger loop of the amplicon (as in the probes from NUDT China), but we also investigated the case where the PAM was placed | + | <p class="lead">We wanted to test different designs of probes: some were conceived to have the PAM at the beginning of the larger loop of the amplicon (as in the probes from NUDT China), but we also investigated the case where the PAM was placed |
| | on the double-stranded part (the stem) instead; the sequence on the uncostrained large loop was also changed among the probes. </p> | | on the double-stranded part (the stem) instead; the sequence on the uncostrained large loop was also changed among the probes. </p> |
| | | | |
| − | <p>We ordered 10 different probes; the sequence and related notes are described in the Table below. </p> | + | <p class="lead">We ordered 10 different probes; the sequence and related notes are described in the Table below. </p> |
| | + | |
| | + | <br> |
| | + | |
| | + | <table style="border-collapse:collapse;border-spacing:0" class="tg"><tr><th style="font-family:Arial, sans-serif;font-size:14px;font-weight:normal;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe 1</th><th style="font-family:Arial, sans-serif;font-size:14px;font-weight:normal;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">pACAACCTACTACCTCAAACGTAGGTTGTATAGTTTAAAGGGAGTCGGCGGAACTAT</th><th style="font-family:Arial, sans-serif;font-size:14px;font-weight:normal;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe designed by our team for Cas 12a. PAM on the large loop of the amplicon.</th></tr><tr><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe 2</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">pACCTCATTGTATAGCCCCCCCCTGAGGTAGTAGGTTGCCCAACTATACAACCTACT</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe from [3] and [4] (respectively referred to as "SP-let-7a" and "let-7a probe 1"), designed for Cas9. Used as a control for the efficiency of the amplification.</td></tr><tr><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe 3</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">pACCTCACCCCCCCCCCCCCCCCTGAGGTAGTAGGTTGCCCAACTATACAACCTACT</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe from [4] ("let-7a probe 2"), designed for Cas9. Used as a control for the efficiency of the amplification.</td></tr><tr><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe 4</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">pACCTCAAAAAAAAAAAAAACCCTGAGGTAGTAGGTTGCCCAACTATACAACCTACT</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe from [4] ("let-7a probe 3"), designed for Cas9. Used as a control for the efficiency of the amplification.</td></tr><tr><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe 5</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">pACCTCATTTTTTTTTTTTTCCCTGAGGTAGTAGGTTGCCCAACTATACAACCTACT</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe from [4] ("let-7a probe 4"), designed for Cas9. Used as a control for the efficiency of the amplification.</td></tr><tr><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe 6</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">pACAACCTACTACCTCAAACGTAGGTTGTATAGTTTAAAGGGGGGGGGGCGAACTAT</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe designed by our team for Cas 12a. PAM on the large loop of the amplicon. Large loop with repetitive sequence of Gs.</td></tr><tr><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe 7</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">pACAACCTACTACCTCAAACGTAGGTTGTATAGTTTAAAGGGAGTGGTTTAAACTAT</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe designed by our team for Cas 12a. PAM on the stem. Large loop made of 8 bases.</td></tr><tr><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe 8</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">pACAACCTACTACCTCAAACGTAGGTTGTATAGTTTAAAGGGAGTCGGCGGTTTAAACTAT</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe designed by our team for Cas 12a. PAM on the stem. Large loop made of 12 bases.</td></tr><tr><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe 9</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">pACAACCTACTACCTCAAACGTAGGTTGTATAGTTTAAAGGGGGGGGGGGGGGCGTTTAAACTAT</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe designed by our team for Cas 12a. PAM on the stem. Large loop made of 16 bases.</td></tr><tr><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe 10</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">pACAACCTACTACCTCAAACGTAGGTTGTAGAGTTTAAAGGGAGTCGGCGGAACTCT</td><td style="font-family:Arial, sans-serif;font-size:14px;padding:10px 5px;border-style:solid;border-width:1px;overflow:hidden;word-break:normal;border-color:black;text-align:left">Probe designed by our team for Cas 12a. PAM on the large loop of the amplicon. Single base mismatch on the stem with respect to the target miRNA sequence.</td></tr></table> |
| | + | |
| | + | </div> |
| | + | |
| | | | |
| − | <table>
| |
| − | <tr>
| |
| − | <th>Probe 1</th>
| |
| − | <th>pACAACCTACTACCTCAAACGTAGGTTGTATAGTTTAAAGGGAGTCGGCGGAACTAT</th>
| |
| − | <th>Probe designed by our team for Cas 12a. PAM on the large loop of the amplicon.</th>
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <td>Probe 2</td>
| |
| − | <td>pACCTCATTGTATAGCCCCCCCCTGAGGTAGTAGGTTGCCCAACTATACAACCTACT</td>
| |
| − | <td>Probe from [3] and [4] (respectively referred to as "SP-let-7a" and "let-7a probe 1"), designed for Cas9. Used as a control for the efficiency of the amplification.</td>
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <td>Probe 3</td>
| |
| − | <td>pACCTCACCCCCCCCCCCCCCCCTGAGGTAGTAGGTTGCCCAACTATACAACCTACT</td>
| |
| − | <td>Probe from [4] ("let-7a probe 2"), designed for Cas9. Used as a control for the efficiency of the amplification.</td>
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <td>Probe 4</td>
| |
| − | <td>pACCTCAAAAAAAAAAAAAACCCTGAGGTAGTAGGTTGCCCAACTATACAACCTACT</td>
| |
| − | <td>Probe from [4] ("let-7a probe 3"), designed for Cas9. Used as a control for the efficiency of the amplification.</td>
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <td>Probe 5</td>
| |
| − | <td>pACCTCATTTTTTTTTTTTTCCCTGAGGTAGTAGGTTGCCCAACTATACAACCTACT</td>
| |
| − | <td>Probe from [4] ("let-7a probe 4"), designed for Cas9. Used as a control for the efficiency of the amplification.</td>
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <td>Probe 6</td>
| |
| − | <td>pACAACCTACTACCTCAAACGTAGGTTGTATAGTTTAAAGGGGGGGGGGCGAACTAT</td>
| |
| − | <td>Probe designed by our team for Cas 12a. PAM on the large loop of the amplicon. Large loop with repetitive sequence of Gs.</td>
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <td>Probe 7</td>
| |
| − | <td>pACAACCTACTACCTCAAACGTAGGTTGTATAGTTTAAAGGGAGTGGTTTAAACTAT</td>
| |
| − | <td>Probe designed by our team for Cas 12a. PAM on the stem. Large loop made of 8 bases.</td>
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <td>Probe 8</td>
| |
| − | <td>pACAACCTACTACCTCAAACGTAGGTTGTATAGTTTAAAGGGAGTCGGCGGTTTAAACTAT</td>
| |
| − | <td>Probe designed by our team for Cas 12a. PAM on the stem. Large loop made of 12 bases.</td>
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <td>Probe 9</td>
| |
| − | <td>pACAACCTACTACCTCAAACGTAGGTTGTATAGTTTAAAGGGGGGGGGGGGGGCGTTTAAACTAT</td>
| |
| − | <td>Probe designed by our team for Cas 12a. PAM on the stem. Large loop made of 16 bases.</td>
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <td>Probe 10</td>
| |
| − | <td>pACAACCTACTACCTCAAACGTAGGTTGTAGAGTTTAAAGGGAGTCGGCGGAACTCT</td>
| |
| − | <td>Probe designed by our team for Cas 12a. PAM on the large loop of the amplicon. Single base mismatch on the stem with respect to the target miRNA sequence.</td>
| |
| − | </tr>
| |
| − | </table>
| |
| | </article> | | </article> |
| | </div> | | </div> |
