Difference between revisions of "Team:ZJU-China/Improve"

Line 1: Line 1:
 
{{ZJU-China}}
 
{{ZJU-China}}
−
<html>
+
<html lang="en">
 +
<head>
 +
<style type="text/css">
  
  
  
 +
</style>
 +
<meta charset="{CHARSET}">
 +
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/bootstrapCSS&action=raw&ctype=text/css" />
 +
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/pageCSS&action=raw&ctype=text/css" />
 +
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/sponsorCSS&action=raw&ctype=text/css" />
 +
<script type="text/javascript" src="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/bootstrapJS&action=raw&ctype=text/javascript"></script>
 +
<script type="text/javascript" src="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/jqueryJS&action=raw&ctype=text/javascript"></script>
 +
<title>Improve Part</title>
 +
<link href="css/font-awesome.min.css" rel="stylesheet">
 +
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/bootsnavCSS&action=raw&ctype=text/css" />
  
 +
<style type="text/css">
 +
.igem_content_wrapper {
 +
    width: 100% !important;
 +
}
  
−
<div class="column full_size">
+
#mw-content-text > p {
−
<h1>Improve</h1>
+
display: none !important;
−
<p>For teams seeking to improve upon a previous part or project, you should document all of your work on this page. Please remember to include all part measurement and characterization data on the part page on the Registry. Please include a link to your improved part on this page.</p>
+
}
  
−
<h3>Gold Medal Criterion #2</h3>
+
#HQ_page {
−
<p><b>Standard Tracks:</b> Create a new part that has a functional improvement upon an existing BioBrick part. The sequences of the new and existing parts must be different. You must perform experiments with both parts to demonstrate this improvement. Document the experimental characterization on the Part's Main Page on the Registry for both the existing and new parts. Both the new and existing Main Page of each Part’s Registry entry must reference each other. Submit a sample of the new part to the Registry.
+
    width:  150% !important;
 +
}
  
−
The existing part must NOT be from your 2018 part number range and must be different from the part documented in bronze #4.
+
.firstHeading {
 +
  display: none !important;
 +
}
  
−
<br><br>
+
html, body, .globalWrapper {
−
<b>Special Tracks:</b> Improve the function of an existing iGEM project (that your current team did not originally create) and display your achievement on your wiki.</p>
+
    width: 100% !important;
 +
}
  
 +
.tl {
 +
    font-size: 5.5em !important;
 +
}
 +
.navbar-brand{
 +
padding: 29px 15px;
 +
}
 +
nav.navbar.bootsnav{
 +
border: none;
 +
margin-bottom: 150px;
 +
}
 +
.navbar-nav{
 +
float: left;
 +
}
 +
nav.navbar.bootsnav ul.nav > li > a{
 +
color: #828687;
 +
                text-transform: uppercase;
 +
                font-size: .7em;
 +
/*****/ padding: 30px;
 +
}
 +
nav.navbar.bootsnav ul.nav > li:hover{
 +
background: white;
 +
}
 +
.nav > li:after{
 +
content: "";
 +
width: 0;
 +
height: 5px;
 +
background: #494e6b;
 +
position: absolute;
 +
bottom: 0;
 +
left: 0;
 +
transition: all 0.5s ease 0s;
 +
}
 +
 +
.nav > .logo:after {
 +
background: transparent;
 +
}
 +
.nav > .logo:hover {
 +
background-image: url(https://static.igem.org/mediawiki/2018/b/b0/T--ZJU-China--teamlogo.png) !important;
 +
background: white;
 +
background-size: 100%;
 +
-webkit-background-size: 100%;
 +
}
 +
.logo {
 +
width: 100px !important;
 +
height: 78px;
 +
margin-right: 30px;
 +
background: white;
 +
}
 +
.logo > a{
 +
background: url(https://static.igem.org/mediawiki/2018/b/b0/T--ZJU-China--teamlogo.png) no-repeat;
 +
transform: rotate(45deg);
 +
background-color: white !important;
 +
width: 100px !important;
 +
height: 100px;
 +
background-size: 100%;
 +
-webkit-background-size: 100%;
 +
/*border: #000000 solid 1px;*/
 +
box-shadow: 0 0 10px 3px black;
 +
-webkit-box-shadow: 0 0 10px 3px black;
 +
margin-top: 10px;
 +
margin-left: 10px;
 +
border-radius: 20%;
 +
}
 +
 +
.nav > li:hover:after{
 +
width: 100%;
 +
}
 +
nav.navbar.bootsnav ul.nav > li.dropdown > a.dropdown-toggle:after{
 +
content: "+";
 +
font-family: 'FontAwesome';
 +
font-size: 16px;
 +
font-weight: 500;
 +
position: absolute;
 +
top: 35%;
 +
right: 10%;
 +
transition: all 0.4s ease 0s;
 +
}
 +
nav.navbar.bootsnav ul.nav > li.dropdown.on > a.dropdown-toggle:after{
 +
content: "^";
 +
                font-family: 'FontAwesome';
 +
transform: rotate(180deg);
 +
}
 +
.dropdown-menu.multi-dropdown{
 +
position: absolute;
 +
left: -100% !important;
 +
}
 +
        .dropdown-menu{
 +
                position: absolute;
 +
left:-10%;
 +
        }
 +
nav.navbar.bootsnav li.dropdown ul.dropdown-menu{
 +
box-shadow: 0 0 10px rgba(0, 0, 0, 0.3);
 +
border: none;
  
 +
}
 +
@media only screen and (max-width:990px){
 +
nav.navbar.bootsnav ul.nav > li.dropdown > a.dropdown-toggle:after,
 +
nav.navbar.bootsnav ul.nav > li.dropdown.on > a.dropdown-toggle:after{ content: " "; }
 +
.dropdown-menu.multi-dropdown{ left: 0 !important; }
 +
nav.navbar.bootsnav ul.nav > li:hover{ background: transparent; }
 +
nav.navbar.bootsnav ul.nav > li > a{ margin: 0; }
 +
}
 +
.container {
 +
box-shadow: 0 0 10px 3px black;
 +
-webkit-box-shadow: 0 0 10px 3px black;
 +
}
 +
.navbar-nav {
 +
float: right;
 +
}
 +
.logo {
 +
position: absolute;
 +
left: -7%;
 +
}
 +
 +
@media only screen and (min-width: 1024px) {
 +
/*改变滚动条样式*/
 +
 +
::-webkit-scrollbar
 +
{
 +
    width: 12px;
 +
    height: 16px;
 +
    background-color: gray;
 +
}
 +
 +
::-webkit-scrollbar-track
 +
{
 +
    -webkit-box-shadow: inset 0 0 6px rgba(0,0,0,0.3);
 +
    border-radius: 10px;
 +
    background-color: whitesmoke;
 +
}
 +
 
 +
/*定义滑块 内阴影+圆角*/
 +
::-webkit-scrollbar-thumb
 +
{
 +
    border-radius: 10px;
 +
    -webkit-box-shadow: inset 0 0 6px rgba(0,0,0,.3);
 +
    background-color: rgba(0, 0, 0, 0.6);
 +
}
 +
 +
::-webkit-scrollbar-thumb:hover
 +
{
 +
border-radius: 5px;
 +
-webkit-box-shadow: inset 0 0 5px rgba(0,0,0,0.2);
 +
background: rgba(0,0,0,0.4);
 +
}
 +
}
 +
 +
 +
 +
</style>
 +
</head>
 +
<body>
 +
 +
<div class="demo" style="width: 100%; padding: 0em 0; position: fixed; margin: 0; left:0; top: 0; z-index: 999;">
 +
<div class="container">
 +
<div class="row">
 +
<div class="col-md-12">
 +
<nav class="navbar navbar-default navbar-mobile bootsnav">
 +
<div class="navbar-header">
 +
<button type="button" class="navbar-toggle" data-toggle="collapse" data-target="#navbar-menu">
 +
<i class="fa fa-bars"></i>
 +
</button>
 +
</div>
 +
<div class="collapse navbar-collapse" id="navbar-menu">
 +
<!--<div style="background: url(img/logo.png) no-repeat; height: 100px; width: 100px; background-size: 100% ; position: relative; margin: 0;
 +
padding: 0; border: #000000 solid 1px;"></div>-->
 +
<ul class="nav navbar-nav" data-in="fadeInDown" data-out="fadeOutUp">
 +
<li class="logo"><a href="#">
 +
<!--<img src="url(img/logo.png)" />-->
 +
</a></li>
 +
<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Project</a>
 +
<ul class="dropdown-menu">
 +
<li><a href="#">Description</a></li>
 +
<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Design&Results</a>
 +
<ul class="dropdown-menu">
 +
<li><a href="#">Curli</a></li>
 +
<li><a href="#">Tag/Catcher System</a></li>
 +
<li><a href="#">Enzyme</a></li>
 +
<li><a href="#">Logic Gate</a></li>
 +
</ul>
 +
</li>
 +
<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Applied Design</a>
 +
<ul class="dropdown-menu">
 +
<li><a href="#">Overview</a></li>
 +
<li><a href="#">2D print</a></li>
 +
<li><a href="#">Electrode</a></li>
 +
<li><a href="#">Integration</a></li>
 +
<li><a href="#">Roll-out Plan</a></li>
 +
</ul>
 +
</li>
 +
</ul>
 +
</li>
 +
<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Parts</a>
 +
<ul class="dropdown-menu">
 +
<li><a href="#">Overview</a></li>
 +
<li><a href="#">Basic Parts</a></li>
 +
<li><a href="#">Composite Parts</a></li>
 +
<li><a href="#">Improved Parts</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="#">Modeling</a></li>
 +
<li><a href="#">InterLab</a></li>
 +
<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Safety</a>
 +
<ul class="dropdown-menu">
 +
<li><a href="#">Project Safety</a></li>
 +
<li><a href="#">General Safety</a></li>
 +
</ul>
 +
</li>
 +
<li class="dropdown" style="min-width: 250px;">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Human Practice</a>
 +
<ul class="dropdown-menu">
 +
<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown" >Silver</a>
 +
<ul class="dropdown-menu">
 +
<li><a href="#">TED Talk</a></li>
 +
<li><a href="#">Subscriptions</a></li>
 +
</ul>
 +
</li>
 +
<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown" >Gold Integrated</a>
 +
<ul class="dropdown-menu">
 +
<li><a href="#">Academics</a></li>
 +
<li><a href="#">Hospitals</a></li>
 +
<li><a href="#">Bioethics</a></li>
 +
</ul>
 +
</li>
 +
<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown" >Education & Public Engagement</a>
 +
<ul class="dropdown-menu">
 +
<li><a href="#">Science Museum</a></li>
 +
<li><a href="#">Bioart Exhibition</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="#">Collaborations</a></li>
 +
</ul>
 +
</li>
 +
<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Notebook</a>
 +
<ul class="dropdown-menu">
 +
<li><a href="#">Lab Book</a></li>
 +
<li><a href="#">Protocols</a></li>
 +
</ul>
 +
</li>
 +
<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Team</a>
 +
<ul class="dropdown-menu">
 +
<li><a href="#">Members</a></li>
 +
<li><a href="#">Attribution</a></li>
 +
<li><a href="#">Contributions</a></li>
 +
<li><a href="#">Sponsors</a></li>
 +
<!--<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Sub Menu</a>
 +
<ul class="dropdown-menu">
 +
<li><a href="#">Custom Menu</a></li>
 +
<li><a href="#">Custom Menu</a></li>
 +
<li class="dropdown">
 +
<a href="#" class="dropdown-toggle" data-toggle="dropdown">Sub Menu</a>
 +
<ul class="dropdown-menu multi-dropdown">
 +
<li><a href="#">Custom Menu</a></li>
 +
<li><a href="#">Custom Menu</a></li>
 +
<li><a href="#">Custom Menu</a></li>
 +
<li><a href="#">Custom Menu</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="#">Custom Menu</a></li>
 +
</ul>
 +
</li>-->
 +
</ul>
 +
</li>
 +
 +
</ul>
 +
</div>
 +
</nav>
 +
</div>
 +
</div>
 +
</div>
 
</div>
 
</div>
  
  
 +
<!--<div class="topImg" style="background-image: url(img/improve_part.png) ;"></div>-->
 +
<div class="title">
 +
<div class="tl">IMPOROVE PART&nbsp;<h5>OVERVIEW&nbsp;</h5></div>
 +
</div>
 +
<div class="intro">
 +
<p>Currently, T7 promoter is one of the most widely used promoters for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter has proven quite effective, in some cases, we need modified T7 promoters with even higher efficiency of protein expression to meet specific demands. Hence, we tried to transform the wild-type T7 promoter to get modified T7 promoters with increased strength . </p>
 +
</br>
 +
<p>T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some point mutations between positions -11 and -7 may make T7 promoter fail to work. Thus, with the help of previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the range from -4 to +6. The sequences of these modified promoters are shown in the Table below.</p>
 +
</br>
 +
</div>
 +
<hr />
 +
<!--<div class="element1">
 +
<h5>Engaging Experts</h5>
 +
<p>High impact projects with consequences affecting whole humanity should always be discussed with professionals from different scientific backgrounds. To meet this goal we talked to theologists, legal professionals, safety representatives, astrophysicists, and experts in the field of medicine, agriculture, information technology and many more. Check out the professionals who shaped our project!</p>
 +
</div>-->
 +
<div class="cnt_psg">
 +
<div class="cnt"></div>
 +
<div class="psg" >
 +
<span class="psg_ttl">Sequences of Modified Promoters</span>
 +
<table class="table">
 +
<thead>
 +
<tr>
 +
<th><span>Part Number</span></th>
 +
<th><span>Sequence(-17~+6)</span></th>
 +
</tr>
 +
</thead>
 +
<tbody>
 +
<tr>
 +
<td><span>BBa_R0085(wild type)</span></td>
 +
<td><span>TAATACGACTCACTATAGGGAGA</span></td>
 +
</tr>
 +
<tr>
 +
<td><span>BBa_K2721000</span></td>
 +
<td><span>TAATACGACTCACTAT<span style="color: steelblue;">C</span><span></span>G</span><span style="color: steelblue;">C</span><span>G</span><span style="color: steelblue;">GAG</span></td>
 +
</tr>
 +
<tr>
 +
<td><span>BBa_K2721001</span></td>
 +
<td><span>TAATACGACTCACT</span><span style="color: steelblue;">CC</span><span>AG</span><span style="color: steelblue;">CA</span><span>A</span><span style="color: steelblue;">TC</span></td>
 +
</tr>
 +
<tr>
 +
<td><span>BBa_K2721002</span></td>
 +
<td><span>TAATACGACTCACT</span><span style="color: steelblue;">TC</span><span>AG</span><span style="color: steelblue;">C</span><span>GA</span><span style="color: steelblue;">CC</span></td>
 +
</tr>
 +
<tr>
 +
<td><span>BBa_K2721003</span></td>
 +
<td><span>TAATACGACTCAC</span><span style="color: steelblue;">ACG</span><span>AG</span><span style="color: steelblue;">C</span><span>GAGA</span></td>
 +
</tr>
 +
</tbody>
 +
</table>
 +
<span class="psg_ttl">Test</span>
 +
<p>To test the function of mutant promoters, we chose the GFP as our reporter. By assessing the absolute fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of GFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure and Table below.</p>
 +
<img src="https://static.igem.org/mediawiki/2018/5/54/T--ZJU-China--ip01.png" style="width: 80%;"/>
 +
<h5>Fig.1 Relative Strength of wildtype T7 promoter and mutant promoters</h5>
 +
<table class="table">
 +
<thead><tr>
 +
<th><span>Part Number</span></th>
 +
<th><span>Relative Strength</span></th>
 +
</tr></thead>
 +
<tbody>
 +
<tr>
 +
<td><span>BBa_R0085(wild type)</span></td>
 +
<td><span>1</span></td>
 +
</tr>
 +
<tr>
 +
<td><span>BBa_K2721000</span></td>
 +
<td><span>20.99</span></td>
 +
</tr>
 +
<tr>
 +
<td><span>BBa_K2721001</span></td>
 +
<td><span>17.75</span></td>
 +
</tr>
 +
<tr>
 +
<td><span>BBa_K2721002</span></td>
 +
<td><span>7.63</span></td>
 +
</tr>
 +
<tr>
 +
<td><span>BBa_K2721003</span></td>
 +
<td><span>13.92</span></td>
 +
</tr>
 +
</tbody>
 +
</table>
 +
<p></br>As we can see from the figure, our mutant promoters showed largely increased strength compared with wild type T7 promoter. Therefore, our mutant promoters offer users more opportunity to control the expression of protein using T7 promoter and permit higher levels of target protein expression to be obtained.</p>
 +
<span class="psg_ttl">References</span>
 +
<p>[1] Ikeda R A, Ligman C M, Warshamana S, et al. T7 promoter contacts essential for promoter activity in vivo[J]. Nucleic Acids Research, 1992, 20(10): 2517-2524.</p>
 +
<p>[2] Paul S, Stang A, Lennartz K, Tenbusch M, Uberla K. Selection of a T7 promoter mutant with enhanced in vitro activity by a novel multi-copy bead display approach for in vitro evolution[J]. Nucleic Acids Research, 2013, 41(1):e29.</p>
 +
<br /><br />
 +
<!---->
 +
 +
<!---->
 +
</div>
 +
<div class="sponsors">
 +
<p class="sponsor_ttl">Our Sponsors</p>
 +
<img src="https://static.igem.org/mediawiki/2018/6/68/T--ZJU-China--home--biolab.png" />
 +
<img src="https://static.igem.org/mediawiki/2018/f/f1/T--ZJU-China--genscript.png" />
 +
<img src="https://static.igem.org/mediawiki/2018/b/b2/T--ZJU-China--home--undergraduate.png" />
 +
<img src="https://static.igem.org/mediawiki/2018/5/5f/T--ZJU-China--foundation.png" />
 +
<img src="https://static.igem.org/mediawiki/2018/7/7f/T--ZJU-China--hospital.png" />
 +
 +
</div>
 +
</div>
 +
 +
<!--<hr />-->
 +
<script type="text/javascript">
 +
var dom = document.getElementById("container");
 +
var myChart = echarts.init(dom);
 +
var app = {};
 +
option = null;
 +
var dataAxis = ['', '', '', '', ''];
 +
var data = [2993, 62815.05, 53126.97, 22837.41, 41658.86];
 +
var yMax = 500;
 +
var dataShadow = [];
 +
 +
for (var i = 0; i < data.length; i++) {
 +
    dataShadow.push(yMax);
 +
}
 +
 +
option = {
 +
    title: {
 +
        text: '            ',
 +
        textStyle: {
 +
            color: '#999999',
 +
            fontFamily: 'crimson',
 +
            fontWeight: 'normal',
 +
            align: 'center',
 +
        }
 +
//      subtext: 'yAxis: Absolute fluorescence unit \ OD600',
 +
       
 +
    },
 +
    xAxis: {
 +
    type: 'category',
 +
        data: ['BBa_R0085(wild type)', 'BBa_K2721000', 'BBa_K2721001', 'BBa_K2721002', 'BBa_K2721003'],
 +
    axisLabel: {
 +
            inside: false,
 +
            textStyle: {
 +
                color: '#999999'
 +
            }
 +
        },
 +
        axisTick: {
 +
            show: false
 +
        },
 +
        axisLine: {
 +
            show: false
 +
        },
 +
        z: 10
 +
    },
 +
    yAxis: {
 +
    name: 'Absolute fluorescence unit \ OD600',
 +
    nameRotate: 90,
 +
    nameGap: -300,
 +
   
 +
//  offset: 'start',
 +
        axisLine: {
 +
            show: false
 +
        },
 +
        axisTick: {
 +
            show: false
 +
        },
 +
        axisLabel: {
 +
            textStyle: {
 +
                color: '#999'
 +
            }
 +
        }
 +
    },
 +
    dataZoom: [
 +
        {
 +
            type: 'inside'
 +
        }
 +
    ],
 +
    series: [
 +
        { // For shadow
 +
            type: 'bar',
 +
            itemStyle: {
 +
                normal: {color: 'rgba(0,0,0,0.05)'}
 +
            },
 +
            barGap:'-100%',
 +
            barCategoryGap:'80%',
 +
            data: dataShadow,
 +
            animation: false
 +
        },
 +
        {
 +
            type: 'bar',
 +
            itemStyle: {
 +
                normal: {
 +
                    color: new echarts.graphic.LinearGradient(
 +
                        0, 0, 0, 1,
 +
                        [
 +
                            {offset: 0, color: 'steelblue'},
 +
                            {offset: 0.4, color: 'steelblue'},
 +
                            {offset: 1, color: 'steelblue'}
 +
                        ]
 +
                    )
 +
                },
 +
                emphasis: {
 +
                    color: new echarts.graphic.LinearGradient(
 +
                        0, 0, 0, 1,
 +
                        [
 +
                            {offset: 0, color: 'lightsteelblue'},
 +
                            {offset: 0.7, color: 'lightsteelblue'},
 +
                            {offset: 1, color: 'lightsteelblue'}
 +
                        ]
 +
                    )
 +
                }
 +
            },
 +
            data: data
 +
        }
 +
    ]
 +
};
 +
 +
// Enable data zoom when user click bar.
 +
//var zoomSize = 6;
 +
//myChart.on('click', function (params) {
 +
//  console.log(dataAxis[Math.max(params.dataIndex - zoomSize / 2, 0)]);
 +
//  myChart.dispatchAction({
 +
//      type: 'dataZoom',
 +
//      startValue: dataAxis[Math.max(params.dataIndex - zoomSize / 2, 0)],
 +
//      endValue: dataAxis[Math.min(params.dataIndex + zoomSize / 2, data.length - 1)]
 +
//  });
 +
//});
 +
if (option && typeof option === "object") {
 +
    myChart.setOption(option, true);
 +
}
 +
      </script>
 +
        <!--<script type="text/javascript" src="js/bootsnav.js"></script>-->
 +
        <script type="text/javascript" src="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/bootnavJS&action=raw&ctype=text/javascript"></script>
 +
        <script type="text/javascript" src="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/pageJS&action=raw&ctype=text/javascript"></script>
 +
</body>
 +
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/pageCSS&action=raw&ctype=text/css" />
 +
<link rel="stylesheet" type="text/css" href="https://2018.igem.org/wiki/index.php?title=Team:ZJU-China/sponsorCSS&action=raw&ctype=text/css" />
  
 
</html>
 
</html>

Revision as of 02:26, 12 October 2018

HOME
TEAM
Team Members
Collaborations
PROJECT
Description
Design
Experiments
Notebook
InterLab
Model
Results
Demonstrate
Improve
Attributions
PARTS
Parts Overview
Basic Parts
Composite Parts
Part Collection
SAFETY
HUMAN PRACTICES
Human Practices
Education & Engagement
AWARDS
Applied Design
Entrepreneurship
Hardware
Measurement
Model
Plant
Software
JUDGING FORM ⇗
Improve Part
IMPOROVE PART 
OVERVIEW 

Currently, T7 promoter is one of the most widely used promoters for expression of heterogenous protein in some E.coli strains such as BL21(DE3). Though the wild-type T7 promoter has proven quite effective, in some cases, we need modified T7 promoters with even higher efficiency of protein expression to meet specific demands. Hence, we tried to transform the wild-type T7 promoter to get modified T7 promoters with increased strength .


T7 RNA polymerase promoters consist of a highly conserved 23 base-pair sequence that spans the site of the initiation of transcription (+ 1) and extends from -17 to +6. As reported in some papers, the sequence specificty of T7 promoter is so strong that some point mutations between positions -11 and -7 may make T7 promoter fail to work. Thus, with the help of previous research, we carefully chose the site which would be mutated by PCR. These sites mainly distribute in the range from -4 to +6. The sequences of these modified promoters are shown in the Table below.


Sequences of Modified Promoters
Part Number Sequence(-17~+6)
BBa_R0085(wild type) TAATACGACTCACTATAGGGAGA
BBa_K2721000 TAATACGACTCACTATCGCGGAG
BBa_K2721001 TAATACGACTCACTCCAGCAATC
BBa_K2721002 TAATACGACTCACTTCAGCGACC
BBa_K2721003 TAATACGACTCACACGAGCGAGA
Test

To test the function of mutant promoters, we chose the GFP as our reporter. By assessing the absolute fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of GFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure and Table below.

Fig.1 Relative Strength of wildtype T7 promoter and mutant promoters
Part Number Relative Strength
BBa_R0085(wild type) 1
BBa_K2721000 20.99
BBa_K2721001 17.75
BBa_K2721002 7.63
BBa_K2721003 13.92


As we can see from the figure, our mutant promoters showed largely increased strength compared with wild type T7 promoter. Therefore, our mutant promoters offer users more opportunity to control the expression of protein using T7 promoter and permit higher levels of target protein expression to be obtained.

References

[1] Ikeda R A, Ligman C M, Warshamana S, et al. T7 promoter contacts essential for promoter activity in vivo[J]. Nucleic Acids Research, 1992, 20(10): 2517-2524.

[2] Paul S, Stang A, Lennartz K, Tenbusch M, Uberla K. Selection of a T7 promoter mutant with enhanced in vitro activity by a novel multi-copy bead display approach for in vitro evolution[J]. Nucleic Acids Research, 2013, 41(1):e29.