We started our design from the analysis of one probe from Qiu et al., 2018, namely "let-7a probe 1" (Probe 2 for us). The sequence was the following one:

5’-pACCTCATTGTATAGCCCCCCCCTGAGGTAGTAGGTTGCCCAACTATACAACCTACT-3’

where:

• the regions in italic are those belonging to the loops of the hairpin
• the regions in orange and green are those belonging to the stem of the hairpin (and which are complementary with each other)
• the underlined region is the one complementary to the miRNA (let-7a-5p: UGAGGUAGUAGGUUGUAUAGUU)

Such probe consists of a double-stranded stem part, a 10 bases-long loop (which from now on we will refer to as "small loop" - on the right in the figure above) and a 16 bases-long loop ("large loop" - on the left). As we can observe, the toehold region of the probe (i.e. the part on the small loop where the miRNA binds) is 7 bases long, in accordance with Deng et al., 2014, who proved it to be the optimal length to achieve both sensitivity and specificity.

The amplicon of such probe is therefore*:

5'-AGTAGGTTGTATAGTTGGGCAACCTACTACCTCAGGGGGGGGCTATACAATGAGGT-3’

where:

the sequence in bold is the one which is complementary to the gRNA (except for two mismatches, which are highlighted) and the region in red is the PAM sequence (in this case single stranded).

We emphasize here that the PAM sequence is on a single-stranded part of the amplicon (the one complementary to the large loop of the probe): therefore, such single-stranded PAM can only be present on the amplicon, and not on the probe itself (as would have been instead if the PAM was on a double stranded part).

The gRNA sequence (as indicated by Qiu et al., 2018) is:

5’-ACUGUACAAACUACU|ACCUCA(GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG) -3’

with the scaffold region indicated in parentheses. The region out of the brackets is the spacer, binding to the amplicon, and the sequence in italic corresponds in particular to the part of the spacer binding on the loop of the amplicon (with the rest of the spacer binding to the stem). The sign | indicates the position where the gRNA binds to the point on the amplicon where each new "copy" of the amplicon is considered to start (i.e. the point where the 3' of a "subunit" of the amplicon and the 5' of the successive subunit are linked together).

More specifically, we can notice that in this design the spacer coincides with the reverse complement of let-7a, with the exception of the two mismatches and of a missing A at the beginning. The template of the gRNA for Cas9 would therefore be:

5'-[reverse complement of miRNA]-[scaffold]-3'

The expected interaction between amplicon and gRNA is outlined in the figure below:

We can observe how the PAM sequence (in red in the figure) is located at the very beginning of the large loop in the amplicon, whereas the gRNA binds to the whole stem part and partially to the small loop.

*Here and after, when referring to the "amplicon sequence", we only show one single copy of the reverse transcript of the probe. The actual amplicon, by definition of Rolling Circle Amplification, is of course made instead of sequential copies of this "unitary" sequence.

---

We then tried to design our own probes for Cas 12a, working backwards from the gRNA.

Contrarily to Cas 9, for which the PAM must be on the 3' side of the target, for Cas12a the PAM must be on the 5’ side of the target instead. This implies that the scaffold part of the gRNA must be on the 5’ side (instead of the 3’) as well (Figure below).

Below is shown a direct comparison of the interaction between target amplicon and gRNA for Cas 9 and Cas 12a.

We therefore conclude that the template for our guide RNA for Cas 12a should be:

5’-(UAAUUUCUACUAAGUGUAGAU)NNNNNN|NNNNNNNNNNNNNNNN-3’ [gRNA template]

where the sequence in parentheses indicates the scaffold of the gRNA for LbCas12a. The sequence out of the brackets is the spacer, binding to the amplicon, and in particular the sequence in italic corresponds to the part binding on the loop of the amplicon.

The spacer is therefore 22 bases long (as let-7a-5p), 15 of which bind to the stem part of the amplicon and the remaining 7 bind to the small loop of the amplicon. Note that the gRNA for Cas9 from Qiu et al., 2018 was instead 21 bases long (15 and 6): we decided to add one more base at the end to completely match the length of the miRNA.

We can notice that also in this design the spacer has to coincide with the reverse complement of let-7a (as for Cas 9) . The template of the gRNA for Cas12a would therefore be:

5'-[scaffold]-[reverse complement of miRNA]-3'

From the template above we can therefore conclude that the gRNA for our Cas 12a system, designed as the one for Cas 9 from Deng et al., 2014, has to be:

5’-(UAAUUUCUACUAAGUGUAGAU)AACUAU|ACAACCUACUACCUCA-3’ [gRNA sequence]

From the specifications for the probe above (10 bases small loop, 16 bases large loop) and from the gRNA sequence, the template amplicon therefore needs to have the following structure:

5’-ATAGTTNNNNNNNNNNNNTTTNAACTATACAACCTACNNNTGAGGTAGTAGGTTGT-3’ [amplicon template]

We then proceeded to define the bases for the Ns, aiming not to have unwanted minor secondary structures (e.g. smaller loops) in the loops. This was done mostly by considering pairing principles, e.g. avoiding non-Watson-Crick interaction (e.g. T-G) which might be thermodynamically favoured or trying not to have complementary bases with more than 1 base in between (which might lead to hairpin loops). In all cases, the minimum free energy structure (MFE) was plotted by means of the available software (NUPACK, Mfold), both for the amplicon and the probe - i.e. its reverse complement-, to check that the intended dumbbell shape was indeed achieved.

This lead us to the sequence of Probe 1 and Probe 6 (Probes from 2 to 5 were the probes for Cas 9 from Deng et al., 2014 and Qiu et al., 2018).

-----

We also wanted to test the case of probes having the PAM sequence not on the large loop, but on the stem instead (i.e. a double-stranded PAM, as usually required in Cas systems, and not single-stranded). We considered in this case three different alternatives:

1. Changing 4 bases in the large loop in order for them to be complementary to the PAM sequence, without adding more bases. This leads to a 19 bases-long stem, a 10 bases-long "small" loop and a 8 bases-long "large" loop. The template sequence of the amplicon is the following one:

   5’-ATAGTTN'AAANNNNNNNNTTTNAACTATACAACCTACNNNTGAGGTAGTAGGTTGT-3’ (with N' being the base complementary to the N in the PAM)

   
   

2. Inserting 4 more bases complementary to the PAM on one end of the large loop (after ATAGTT), without changing any base. This leads to a 19 bases-long stem, a 10 bases-long small loop and a 12 bases-long large loop. The template sequence of the amplicon is the following one:

   5’-ATAGTTN'AAANNNNNNNNNNNNTTTNAACTATACAACCTACNNNTGAGGTAGTAGGTTGT-3’

   
   

3. Inserting 4 more bases complementary to the PAM on one end of the large loop (after ATAGTT) and 4 more bases at the other end of the large loop (before the PAM sequence), in order to keep the original length of the large loop (16 bases). This leads to a 19 bases-long stem, a 10 bases-long small loop and a 16 bases-long large loop. The template sequence of the amplicon is the following one:

   5’-ATAGTTN'AAANNNNNNNNNNNNNNNNTTTNAACTATACAACCTACNNNTGAGGTAGTAGGTTGT-3’

   
   

These three alternatives led, respectively, to Probe 7, Probe 8 and Probe 9.

-----

Finally, Probe 10 was designed in a way to have a mismatched base in the stem with respect to the let-7a sequence (highlighted in both strands below):

5'-pACAACCTACTACCTCAAACGTAGGTTGTAGAGTTTAAAGGGAGTCGGCGGAACTCT-3'

Halfway through our project (see Notebook for more details), after starting testing our amplicons with Cas12a and the fluorescent reporter (DNase Alert), we realized that the probe itself (more specifically the product of RCA in the absence of miRNA, i.e. with no amplicon) was triggering the Cas system causing a very high fluorescence signal, comparable to the signal obtained for the samples with miRNA (i.e. with probe+amplicon).

We hypothesized that this was due to the fact the our Cas12a was working PAM-independently (more details in "New theory on Cas12a activation - miRNA" in the "Fluorescence readout" section). More specifically, our gRNA was meant to target the whole stem (and in addition 7 bases in the small loop) of the amplicon; since the stem is double-stranded, the target sequence for the gRNA is also present in the probe (in the opposite strand).

This would not have been a problem if the Cas had been working, as expected, PAM-dependently, because the PAM is only contained in the amplicon, not in the probe. Nonetheless, if the Cas does not need the PAM sequence, but simple recognizes a target from the sequence of the gRNA, then also the probe itself is recognized as a target. Moreover, since the concentration of the probe in the RCA reaction is higher than the expected concentration of amplicon, the signal from the probe behaves as noise, overcoming the signal of interest (i.e. from the amplicon).

We therefore designed a new guide RNA with the aim of targeting only the amplicon and not the probe. Our idea was to have the gRNA binding not on the stem, but on the large loop of the amplicon instead. Since the loops of the amplicon are single-stranded (and not double-stranded as the stem) this should allow the gRNA to target only the amplicon and not the probe, being the target sequence contained only in the amplicon and not in its reverse-complement: more specifically, we decided to design a guide RNA perfectly complementary to the large loop of the amplicon of Probe 1; in this way Probe 1, having on the contrary exactly the same sequence as the gRNA, should have never been targeted by this new gRNA.

As from the template gRNA above (5'-[scaffold]-[reverse complement of miRNA]-3'), the spacer was therefore modified to bind (with perfect match) to the large loop of the amplicon of probe 1.

Two different designs were tested, one - referred to elsewhere as "S_1" - binding to the whole large loop and to the first 4 bases after the large loop (for a total of a 20 bases-long spacer), and one - "L_1" elsewhere - binding only to the large loop (16 bases-long spacer). The complete sequences are the following ones:

5'-(UAAUUUCUACUAAGUGUAGAU)UAAAGGGAGUCGGCGGAACU-3' [gRNA sequence - S_1]

5'-(UAAUUUCUACUAAGUGUAGAU)UAAAGGGAGUCGGCGG-3' [gRNA sequence - L_1]

The comparison between the mode of action of the previous, original gRNA and the "new" ones is better explained in the figure below: