Difference between revisions of "Team:EPFL/Design"

Line 122: Line 122:
 
(<a href="#Wolfel1995"><span style="color:blue">Wolfel <i>et al.</i>, 1995</span></a>)
 
(<a href="#Wolfel1995"><span style="color:blue">Wolfel <i>et al.</i>, 1995</span></a>)
 
....
 
....
−
(<a href="#Matsushita2012"><span style="color:blue">Matsushita <i>et al.</i>, 2012</span></a>,<a href="#Tran2014"><span style="color:blue">Tran <i>et al.</i>, 2014</span></a>,<a href="#Tran2016"><span style="color:blue">Tran <i>et al.</i>, 2016</span></a>,<a href="#Tran2017"><span style="color:blue">Tran <i>et al.</i>, 2017</span></a>)
+
(<a href="#Matsushita2012"><span style="color:blue">Matsushita <i>et al.</i>, 2012</span></a>; <a href="#Tran2014"><span style="color:blue">Tran <i>et al.</i>, 2014</span></a>; <a href="#Tran2016"><span style="color:blue">Tran <i>et al.</i>, 2016</span></a>; <a href="#Tran2017"><span style="color:blue">Tran <i>et al.</i>, 2017</span></a>)
 
....
 
....
−
(<a href="#Alexandrov2013"><span style="color:blue">Alexandrov <i>et al.</i>, 2013</span></a>,<a href="#Zhu2017"><span style="color:blue">Zhu <i>et al.</i>, 2017</span></a>)
+
(<a href="#Alexandrov2013"><span style="color:blue">Alexandrov <i>et al.</i>, 2013</span></a>; <a href="#Zhu2017"><span style="color:blue">Zhu <i>et al.</i>, 2017</span></a>)
 
  <div id="ImportanceCard">
 
  <div id="ImportanceCard">
 
<div class="card">
 
<div class="card">
Line 136: Line 136:
 
<div id="AssistedDelivery" class="collapse" data-parent="#ImportanceCard">
 
<div id="AssistedDelivery" class="collapse" data-parent="#ImportanceCard">
 
<div class="card-body">
 
<div class="card-body">
−
(<a href="#Liu2014"><span style="color:blue">Liu <i>et al.</i>, 2014</span></a>,<a href="#Fifis2004"><span style="color:blue">Fifis <i>et al.</i>, 2004</span></a>)
+
(<a href="#Liu2014"><span style="color:blue">Liu <i>et al.</i>, 2014</span></a>; <a href="#Fifis2004"><span style="color:blue">Fifis <i>et al.</i>, 2004</span></a>)
 
...
 
...
 
(<a href="#Janssen2005"><span style="color:blue">Janssen <i>et al.</i>, 2005</span></a>)
 
(<a href="#Janssen2005"><span style="color:blue">Janssen <i>et al.</i>, 2005</span></a>)
Line 451: Line 451:
 
<div id="crRNAdes" class="collapse" data-parent="#Cas12">
 
<div id="crRNAdes" class="collapse" data-parent="#Cas12">
 
<div class="card-body">
 
<div class="card-body">
 +
<p class="lead">An appropriate design of the ssDNA consists of three separate part in the following order:</p>
 +
<ul>
 +
<li><b>T7 promoter</b> (5’-<i>ctTAATACGACTCACTATAgg</i>-3’): This is needed for the transcription and the sequence will not appear in the final gRNA. To increase the polymerase efficiency, it is recommended to add 1, 2 or 3 G’s right after the promoter (<a href="#sgRNASynth"><span style="color:blue">New England BioLabs</span></a>) as well as adding CT upstream of it (<a href="#Baklanov1996"><span style="color:blue">Baklanov <i>et al.</i>, 1996</span></a>)</li>
 +
<li><b>Scaffold</b> (5’-<i>TAATTTCTACTAAGTGTAGAT</i>-3’): This sequence can change according to the Cas12a species (the one shown here is specific for LBa Cas12a)</li>
 +
<li><b>Spacer</b>: It is the gRNA sequence that is complementary to the activator sequence (TS). For the ctDNA group it was designed to be 17 nucleotides long as this was proved to be the length yielding the highest activation (<a href="#Gootenberg2017"><span style="color:blue">Gootenberg <i>et al.</i>, 2017</span></a>).</li>
 +
</ul>
 +
<p class="lead">The T7 polymerase needs a double stranded region to bind to. It is thus necessary to order a primer for this region. The rest of the sequence can stay single stranded for a lower cost.</p>
 
...(<a href="#Zetsche2017"><span style="color:blue">Zetsche <i>et al.</i>, 2017</span></a>)
 
...(<a href="#Zetsche2017"><span style="color:blue">Zetsche <i>et al.</i>, 2017</span></a>)
 
</div>
 
</div>
Line 901: Line 908:
 
<li id="Calapre2017">Calapre, Leslie, et al. "Circulating tumour DNA (ctDNA) as a liquid biopsy for melanoma." <i>Cancer letters</i>, 404 (2017): 62-69.</li>
 
<li id="Calapre2017">Calapre, Leslie, et al. "Circulating tumour DNA (ctDNA) as a liquid biopsy for melanoma." <i>Cancer letters</i>, 404 (2017): 62-69.</li>
 
<li id="Heitzer2017">Heitzer, Ellen, et al. "The potential of liquid biopsies for the early detection of cancer." <i>NPJ precision oncology</i>, 1.1 (2017): 36.</li>
 
<li id="Heitzer2017">Heitzer, Ellen, et al. "The potential of liquid biopsies for the early detection of cancer." <i>NPJ precision oncology</i>, 1.1 (2017): 36.</li>
 +
<li id="sgRNASynth">"sgRNA Synthesis Using the HiScribe™ Quick T7 High Yield RNA Synthesis Kit" - New England BioLabs website. URL:https://international.neb.com/protocols/2015/11/24/sgrna-synthesis-using-the-hiscribe-quick-t7-high-yield-rna-synthesis-kit-neb-e2050 (Accessed 14/10/2018)</li>
 +
<li id="Baklanov1996">Baklanov, Michail M., Larisa N. Golikova, and Enrst G. Malygin. "Effect on DNA transcription of nucleotide sequences upstream to T7 promoter." <i>Nucleic acids research</i>, 24.18 (1996): 3659-3660.</li>
 +
<li id="Gootenberg2017">Gootenberg, Jonathan S., et al. "Nucleic acid detection with CRISPR-Cas13a/C2c2." <i>Science</i>, (2017): eaam9321.</li>
 
 
 
<li id="Mitchell">Mitchell, Patrick S., et al. "Circulating microRNAs as stable blood-based markers for cancer detection." <i>Proceedings of the National Academy of Sciences</i>, 105.30 (2008): 10513-10518.</li>
 
<li id="Mitchell">Mitchell, Patrick S., et al. "Circulating microRNAs as stable blood-based markers for cancer detection." <i>Proceedings of the National Academy of Sciences</i>, 105.30 (2008): 10513-10518.</li>

Revision as of 16:02, 14 October 2018

iGEM EPFL 2018

Design

Index
Introduction
Rising Importance of Cancer Vaccination
Encapsulin
Our Vaccine Design
Library Expression Process

Introduction

The aim of the vaccine part is ....


Rising Importance of Cancer Vaccination

(Wolfel et al., 1995) .... (Matsushita et al., 2012; Tran et al., 2014; Tran et al., 2016; Tran et al., 2017) .... (Alexandrov et al., 2013; Zhu et al., 2017)


Encapsulin

....


Our Vaccine Design

....


Library Expression Process


References

  1. Wolfel, Thomas, et al. "A p16INK4a-insensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma." Science, 269.5228 (1995): 1281-1284.
  2. Matsushita, Hirokazu, et al. "Cancer exome analysis reveals a T-cell-dependent mechanism of cancer immunoediting." Nature, 482.7385 (2012): 400.
  3. Tran, Eric, et al. "Cancer immunotherapy based on mutation-specific CD4+ T cells in a patient with epithelial cancer." Science, 344.6184 (2014): 641-645.
  4. Tran, Eric, et al. "T-cell transfer therapy targeting mutant KRAS in cancer." New England Journal of Medicine, 375.23 (2016): 2255-2262.
  5. Tran, Eric, Paul F. Robbins, and Steven A. Rosenberg. "'Final common pathway'of human cancer immunotherapy: targeting random somatic mutations." Nature immunology, 18.3 (2017): 255.
  6. Alexandrov, Ludmil B., et al. "Signatures of mutational processes in human cancer." Nature, 500.7463 (2013): 415.
  7. Zhu, Guizhi, et al. "Efficient nanovaccine delivery in cancer immunotherapy." ACS nano, 11.3 (2017): 2387-2392.
  8. Liu, Haipeng, et al. "Structure-based programming of lymph-node targeting in molecular vaccines." Nature, 507.7493 (2014): 519.
  9. Fifis, Theodora, et al. "Size-dependent immunogenicity: therapeutic and protective properties of nano-vaccines against tumors." The Journal of Immunology, 173.5 (2004): 3148-3154.
  10. Janssen, Edith M., et al. "CD4+ T-cell help controls CD8+ T-cell memory via TRAIL-mediated activation-induced cell death." Nature, 434.7029 (2005): 88.
  11. Amigorena, Sebastian, and Ariel Savina. "Intracellular mechanisms of antigen cross presentation in dendritic cells." Current opinion in immunology, 22.1 (2010): 109-117.
  12. Sutter, Markus, et al. "Structural basis of enzyme encapsulation into a bacterial nanocompartment." Nature structural & molecular biology, 15.9 (2008): 939.

Introduction

The aim of the follow-up part is to provide a proof of concept for detecting disease recurrence, as well as to monitor our treatment efficacy in melanoma patients by detecting specific biomarkers present in the blood. This is particularly important for our project since it constitutes a non-invasive way of validating our vaccine efficacy: tumor biopsies are indeed very invasive, time consuming, and often difficult to perform. Here, we envision a new generation of diagnostic approach, by which a simple liquid biopsy could give us an accurate prognosis regarding the genetic evolution of the tumor in response to our immunotherapy treatment, and would also enable us to detect relapses. This requires a detection system that is both highly sensitive and highly specific, since these biomarkers yield a very precise sequence and are often present in extremely low concentrations in the blood. Our idea to solve this problem is to combine RCA or PCR amplification with a Cas12a-protein based system for a rapid and specific detection. We divided this part in two separate modules, designed to tackle the two different biomarkers we are using: circulating tumor DNA and microRNAs.

Index
Introduction
Biomarkers and Liquid Biopsies
Cas12a
Sample preparation
Amplification
Fluorescence readout

Biomarkers and Liquid Biopsies

Through our dialogue with many health specialists (more info in Integrated Human Practices), we realized that there was an urgent need for practitioners to be able to evaluate the response to targeted treatments. Assuming, for example, that the treatment has no effect on a certain tumor population, this would be ruled out, saving expenses as well as unnecessary side effects to the patient. In addition, the tumor heterogeneity often generates cases of resistance to targeted therapy (Calapre et al., 2017), via the selection pressure they generate. However, repeated tumor biopsies to study genomic changes are unthinkable in most cases, as these methods are often painful, risky and time-consuming.

Recently, several studies have shown that non-invasive liquid biopsy methods are a promising way to detect cancer relapse and monitor tumor burden in cancer (Heitzer et al., 2017), as these constitute a quick, reliable and easily obtained samples.


miRNAs are instead short (18-24 nt) non-coding RNA molecules which act as post-transcriptional regulators of gene expression. Over the years, miRNAs have been proved to play a critical role in a variety of different diseases and in several aspects of cancer (Larrea et al., 2016). Moreover miRNAs are remarkably stable in human plasma (Mitchell et al., 2008), and recently several miRNAs circulating in the blood have been shown to be dysregulated (either over- or under-expressed) in patients with certain cancers, including melanoma, with respect to healthy subjects (Mirzaei et al., 2016). For these reasons, miRNAs have been proposed as potential prognostic and diagnostic biomarkers for melanoma, which makes them suitable candidates for the follow-up part of our project as well.


Cas12a

To answer the need for a fast and robust detection method we chose to work with the newly characterized Cas12a (Cpf1) protein.

CRISPR-Cas (clustered regularly interspaced short palindromic repeats–CRISPR-associated) system are originally inspired by an antiviral defense mechanism used by prokaryotes which essentially works by recognizing and cleaving the foreign DNA/RNA. It has in the recent years widely been used as a gene editing tool for its ability to find and cut a specific target sequence (the activator).

This activator is composed of two different strands: the target strand (TS) and the non-targeted strand (NTS). The NTS requires a T-rich protospacer adjacent motif (PAM) sequence to be recognized by Cas12a whereas the TS contains the complement sequence of the guide RNA (gRNA), the gRNA being part of the crRNA.

With both these requirements completed, the interchangeable CRISPR RNA (crRNA) will successfully guide the protein to the target.

As a result of cleaving its double stranded DNA (dsDNA) target, Cas12a will undergo a conformational change which will unleash the protein’s endonuclease activity with a single active site in the RuvC catalytic region against any single stranded DNA (ssDNA). This unspecific collateral cleavage is what makes this system so suitable for detection as it greatly amplifies the signal.

In our assays we decided to work with the purified Lba Cas12a (type V-A CRISPR) extracted from Lachnospiraceae bacterium ND2006 and provided by New England BioLabs.

Design of the crRNA

An appropriate design of the ssDNA consists of three separate part in the following order:

  • T7 promoter (5’-ctTAATACGACTCACTATAgg-3’): This is needed for the transcription and the sequence will not appear in the final gRNA. To increase the polymerase efficiency, it is recommended to add 1, 2 or 3 G’s right after the promoter (New England BioLabs) as well as adding CT upstream of it (Baklanov et al., 1996)
  • Scaffold (5’-TAATTTCTACTAAGTGTAGAT-3’): This sequence can change according to the Cas12a species (the one shown here is specific for LBa Cas12a)
  • Spacer: It is the gRNA sequence that is complementary to the activator sequence (TS). For the ctDNA group it was designed to be 17 nucleotides long as this was proved to be the length yielding the highest activation (Gootenberg et al., 2017).

The T7 polymerase needs a double stranded region to bind to. It is thus necessary to order a primer for this region. The rest of the sequence can stay single stranded for a lower cost.

...(Zetsche et al., 2017)

Cas12a detection assay using a fluorescent readout

Blablabla


Sample preparation

Sample preparation


Amplification

ctDNA amplification

One disadvantage of a classic CRISPR-Cas based assay is the need to have a PAM sequence near the region that we want to detect, for efficient RNA-guided DNA binding. To eliminate this need, we designed PCR primers that would specifically introduce the PAM sequence, for efficient and sequence-independent detection of any given junction or mutation


Although miRNAs are potentially very valid candidate as biomarkers, they are associated with some hurdles (particularly low abundance) which are not completely overcome by currently existing detection methods (Miao et al., 2015).

Among different recent amplification techniques, Rolling Circle Amplification has been proved to be one of the most suitable, thanks to its robustness, simplicity, specificity and high sensitivity (Cheng et al., 2009). Rolling-Circle Amplification (RCA) is an isothermal amplification (contrarily for instance to Polymerase Chain Reaction) where miRNA (or another short RNA or DNA sequence) is amplified by means of a circular DNA template (i.e. a probe) and a special DNA (or RNA) polymerase: the miRNA acts as a primer, with the RCA product (i.e. the amplicon) consisting in a concatemer containing tens to hundreds of tandem repeats that are complementary to the probe (Ali et al., 2014).

Toehold-initiated Rolling Circle Amplification (tiRCA), in particular, employs phi-29 DNA polymerase and is based on structure-switchable dumbbell-shaped probes (Deng et al., 2014): upon hybridization with the specific target miRNA, one of the two strands of the double-stranded region of the probe is displaced, resulting in an "activated" circular form of the probe with triggers the start of the RCA reaction. The complete mechanism of RCA is shown in the Figure below:

Image
Schematic representation of the tiRCA reaction. miRNA is represented in magenta, the dumbbell-shaped probe is shown in light blue and the amplicon in green.

Although it is the probe - and not directly the miRNA - to be amplified, RCA allows to significantly increase the concentration of the miRNA sequence in solution: indeed, since a large portion of the probe is complementary to the miRNA, the amplicon of the probe will incorporate several copies of the original miRNA. This can theoretically be exploited to increase the sensitivity of an assay for quantification of miRNA. As later explained, while our Amplification step was mostly inspired by Qiu et al., 2018, we explored a new, ambitious Detection step after RCA based on Cas12a (and not on Cas9 and split reporter proteins). This implied designing new probes with specific characteristics for Cas12a, as explained in the following sections.

Our probes

The first miRNA we decided to target is let-7a-5p: this miRNA is not among the ones found to be relevant as melanoma biomarkers (as instead are other miRNAs of the let-7 family) (Larrea et al., 2016; Mirzaei et al., 2016); nonetheless, we thought it might be the best option to start from it as a proof of concept, because it was already well characterized for Rolling Circle Amplification (RCA) by Deng et al., 2014 and Qiu et al., 2018

Qiu et al., 2018, as well as our colleagues from the related 2016 iGEM team of NUDT China, had designed their probes in order for the amplicons to be recognized by a CRISPR-Cas 9 system. Since our project deals instead with CRISPR-Cas 12a, despite the miRNA sequence being the same, we therefore had to modify the sequences of our probes accordingly. More specifically, we had to adapt the PAM sequence (placed on the amplicon of the probe) in order to match our Cas protein (we worked with LbCpf1): while the requirement for Cas9 was NGG on the 3' of the amplicon, in our case we needed to have TTTN on the 5'. More details on the design are described in the section "Detailed design".

We wanted to test different designs of probes: some were conceived to have the PAM at the beginning of the larger loop of the amplicon (as in the probes from NUDT China), but we also investigated the case where the PAM was placed on the double-stranded part (the stem) instead; the sequence on the uncostrained large loop was also changed among the probes.

We ordered 10 different probes; the sequence and related notes are described in the Table below.


Name Sequence (5'->3') Description
Probe 1 pACAACCTACTACCTCAAACGTAGGTTGTAT
AGTTTAAAGGGAGTCGGCGGAACTAT		 Probe designed by our team for Cas 12a. PAM on the large loop of the amplicon.

Probe 2		 pACCTCATTGTATAGCCCCCCCCTGAGGTAG
TAGGTTGCCCAACTATACAACCTACT		 Probe from Deng et al., 2014 and Qiu et al., 2018 (respectively referred to as "SP-let-7a" and "let-7a probe 1"), designed for Cas9. Used as a control for the efficiency of the amplification.
Probe 3 pACCTCACCCCCCCCCCCCCCCCTGAGGTAG
TAGGTTGCCCAACTATACAACCTACT		 Probe from Qiu et al., 2018 ("let-7a probe 2"), designed for Cas9. Used as a control for the efficiency of the amplification.
Probe 4 pACCTCAAAAAAAAAAAAAACCCTGAGGTAG
TAGGTTGCCCAACTATACAACCTACT		 Probe from Qiu et al., 2018 ("let-7a probe 3"), designed for Cas9. Used as a control for the efficiency of the amplification.
Probe 5 pACCTCATTTTTTTTTTTTTCCCTGAGGTAG
TAGGTTGCCCAACTATACAACCTACT		 Probe from Qiu et al., 2018 ("let-7a probe 4"), designed for Cas9. Used as a control for the efficiency of the amplification.
Probe 6 pACAACCTACTACCTCAAACGTAGGTTGTAT
AGTTTAAAGGGGGGGGGGCGAACTAT		 Probe designed by our team for Cas 12a. PAM on the large loop of the amplicon. Large loop with repetitive sequence of Gs.
Probe 7 pACAACCTACTACCTCAAACGTAGGTTGTAT
AGTTTAAAGGGAGTGGTTTAAACTAT		 Probe designed by our team for Cas 12a. PAM on the stem. Large loop made of 8 bases.
Probe 8 pACAACCTACTACCTCAAACGTAGGTTGTAT
AGTTTAAAGGGAGTCGGCGGTTTAAACTAT		 Probe designed by our team for Cas 12a. PAM on the stem. Large loop made of 12 bases.
Probe 9 pACAACCTACTACCTCAAACGTAGGTTGTATAG
TTTAAAGGGGGGGGGGGGGGCGTTTAAACTAT		 Probe designed by our team for Cas 12a. PAM on the stem. Large loop made of 16 bases.

Probe 10		 pACAACCTACTACCTCAAACGTAGGTTGTAG
AGTTTAAAGGGAGTCGGCGGAACTCT		 Probe designed by our team for Cas 12a. PAM on the large loop of the amplicon. Single base mismatch on the stem with respect to the target miRNA sequence.

Note: The sequences of the probes include a phosphate group at the 5' end (in order to ligate the probes). We nonetheless always ordered the oligonucleotides without the phosphate (because the cost was significantly lower) and then performed phosphorylation by means of T4 Polynucleotide Kinase prior to ligation.

For each probe we ran an analysis of the secondary structure by means of available servers online (NUPACK, MFold): in all cases the structure of the probe, of its amplicon and of the series of 4-5 copies of the amplicon were tested in order to check the absence of unwanted secondary structures. We also used RNAstructure DuplexFold to test the secondary structure of the dimer probe/miRNA: we were not able to find a more suitable tool for the analysis of the duplex; nonetheless we believe that this server, despite its limitations with respect to our analysis (no possibility of having a circular probe, no possibility to have a DNA/RNA dimer), was enough to show qualitatively the interaction between our probe and let-7a.

SYBR Green I

Two main alternatives are suitable in order to test the efficacy of Rolling Circle Amplification (Deng et al., 2014; Qiu et al., 2018). First of all, the amplicons can be tested by means of an agarose gel to verify the size; nonetheless, this method shows some limitations because of the large size of the amplicons. Indeed, as we also saw from our experiments (link to the Notebook), the size of the amplicons after a 2 hour-RCA is so large that the band is extremely close to the gel.

A more valid alternative is instead to perform a real-time fluorescence measurement by means of SYBR Green I.


SYBR green I is an intercalating dye that preferentially binds to minor grooves of double-stranded (dsDNA) (Zipper et al., 2004). It has also been shown to bind to single-stranded DNA (ssDNA) and RNA (for which instead SYBR Green II is a more suitable option (Sigma-Aldrich)), but with a significantly lower performance (Vitzthum et al., 1999).

When complexed with nucleid acid, SYBR Green I absorbs blue light (maximum excitation wavelength is 497 nm) and emits green light (emission peak at 520 nm) (Sigma-Aldrich), which makes it suitable for quantification - by means of a plate reader - of the DNA amplicons (i.e. the reverse complement of the probes) from our Rolling Circle Amplification (RCA).

Indeed, since we verified in all cases the absence of unwanted secondary structures (more details in Detailed Design), the stems in the probes and in the amplicons are the only double-stranded targets to which SYBR Green I can preferentially bind: this allows to observe the increase over time in the size of the amplicon during RCA.

Image
"Scheme for miRNA detection by TIRCA in vitro" [Reproduced from Deng et al., 2014 (Figure 1A)].

Detailed design

This section is more specifically dedicated to the reasonings behind the sequences of our probes.

Analysis of given probes

We started our design from the analysis of one probe from Qiu et al., 2018, namely "let-7a probe 1" (Probe 2 for us). The sequence was the following one:

5’-pACCTCATTGTATAGCCCCCCCCTGAGGTAGTAGGTTGCCCAACTATACAACCTACT-3’

where:

  • the regions in italic are those belonging to the loops of the hairpin
  • the regions in orange and green are those belonging to the stem of the hairpin (and which are complementary with each other)
  • the underlined region is the one complementary to the miRNA (let-7a-5p: UGAGGUAGUAGGUUGUAUAGUU)
Image
Secondary structure of "let-7a probe 1" (Probe 2 for us). dG=-10.40.

Such probe consists of a double-stranded stem part, a 10 bases-long loop (which from now on we will refer to as "small loop" - on the right in the figure above) and a 16 bases-long loop ("large loop" - on the left). As we can observe, the toehold region of the probe (i.e. the part on the small loop where the miRNA binds) is 7 bases long, in accordance with Deng et al., 2014, who proved it to be the optimal length to achieve both sensitivity and specificity.

The amplicon of such probe is therefore*:

5'-AGTAGGTTGTATAGTTGGGCAACCTACTACCTCAGGGGGGGGCTATACAATGAGGT-3’

where:

the sequence in bold is the one which is complementary to the gRNA (except for two mismatches, which are highlighted) and the region in red is the PAM sequence (in this case single stranded).

We emphasize here that the PAM sequence is on a single-stranded part of the amplicon (the one complementary to the large loop of the probe): therefore, such single-stranded PAM can only be present on the amplicon, and not on the probe itself (as would have been instead if the PAM was on a double stranded part).


The gRNA sequence (as indicated by Qiu et al., 2018) is:

5’-ACUGUACAAACUACU|ACCUCA(GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG) -3’

with the scaffold region indicated in parentheses. The region out of the brackets is the spacer, binding to the amplicon, and the sequence in italic corresponds in particular to the part of the spacer binding on the loop of the amplicon (with the rest of the spacer binding to the stem). The sign | indicates the position where the gRNA binds to the point on the amplicon where each new "copy" of the amplicon is considered to start (i.e. the point where the 3' of a "subunit" of the amplicon and the 5' of the successive subunit are linked together).


More specifically, we can notice that in this design the spacer coincides with the reverse complement of let-7a, with the exception of the two mismatches and of a missing A at the beginning. The template of the gRNA for Cas9 would therefore be:

5'-[reverse complement of miRNA]-[scaffold]-3'


The expected interaction between amplicon and gRNA is outlined in the figure below:

Image Image
On the left: Generic interaction between a target and a gRNA for Cas9 [Reproduced from Xie and Yang, 2013 (Figure 1A)]. On the right: Predicted interaction of one subunit of the amplicon of Probe 2 with the gRNA.

We can observe how the PAM sequence (in red in the figure) is located at the very beginning of the large loop in the amplicon, whereas the gRNA binds to the whole stem part and partially to the small loop.

*Here and after, when referring to the "amplicon sequence", we only show one single copy of the reverse transcript of the probe. The actual amplicon, by definition of Rolling Circle Amplification, is of course made instead of sequential copies of this "unitary" sequence.

Comparison Cas9/Cas12a

We then tried to design our own probes for Cas 12a, working backwards from the gRNA.

Contrarily to Cas 9, for which the PAM must be on the 3' side of the target, for Cas12a the PAM must be on the 5’ side of the target instead. This implies that the scaffold part of the gRNA must be on the 5’ side (instead of the 3’) as well (Figure below).

Image
"Schematic representation of Lba Cas12a nuclease sequence recognition and DNA cleavage". [Reproduced from New England BioLabs].

Below is shown a direct comparison of the interaction between target amplicon and gRNA for Cas 9 and Cas 12a.

Image
Comparison of the interaction between target amplicon and gRNA for Cas 9 (on the left) and Cas 12a (on the right).

We therefore conclude that the template for our guide RNA for Cas 12a should be:

5’-(UAAUUUCUACUAAGUGUAGAU)NNNNNN|NNNNNNNNNNNNNNNN-3’ [gRNA template]

where the sequence in parentheses indicates the scaffold of the gRNA for LbCas12a. The sequence out of the brackets is the spacer, binding to the amplicon, and in particular the sequence in italic corresponds to the part binding on the loop of the amplicon.


The spacer is therefore 22 bases long (as let-7a-5p), 15 of which bind to the stem part of the amplicon and the remaining 7 bind to the small loop of the amplicon. Note that the gRNA for Cas9 from Qiu et al., 2018 was instead 21 bases long (15 and 6): we decided to add one more base at the end to completely match the length of the miRNA.

We can notice that also in this design the spacer has to coincide with the reverse complement of let-7a (as for Cas 9) . The template of the gRNA for Cas12a would therefore be:

5'-[scaffold]-[reverse complement of miRNA]-3'

Probes for Cas12a

From the template above we can therefore conclude that the gRNA for our Cas 12a system, designed as the one for Cas 9 from Deng et al., 2014, has to be:

5’-(UAAUUUCUACUAAGUGUAGAU)AACUAU|ACAACCUACUACCUCA-3’ [gRNA sequence]


From the specifications for the probe above (10 bases small loop, 16 bases large loop) and from the gRNA sequence, the template amplicon therefore needs to have the following structure:

5’-ATAGTTNNNNNNNNNNNNTTTNAACTATACAACCTACNNNTGAGGTAGTAGGTTGT-3’ [amplicon template]

We then proceeded to define the bases for the Ns, aiming not to have unwanted minor secondary structures (e.g. smaller loops) in the loops. This was done mostly by considering pairing principles, e.g. avoiding non-Watson-Crick interaction (e.g. T-G) which might be thermodynamically favoured or trying not to have complementary bases with more than 1 base in between (which might lead to hairpin loops). In all cases, the minimum free energy structure (MFE) was plotted by means of the available software (NUPACK, Mfold), both for the amplicon and the probe - i.e. its reverse complement-, to check that the intended dumbbell shape was indeed achieved.

This lead us to the sequence of Probe 1 and Probe 6 (Probes from 2 to 5 were the probes for Cas 9 from Deng et al., 2014 and Qiu et al., 2018).

-----


We also wanted to test the case of probes having the PAM sequence not on the large loop, but on the stem instead (i.e. a double-stranded PAM, as usually required in Cas systems, and not single-stranded). We considered in this case three different alternatives:

  1. Changing 4 bases in the large loop in order for them to be complementary to the PAM sequence, without adding more bases. This leads to a 19 bases-long stem, a 10 bases-long "small" loop and a 8 bases-long "large" loop. The template sequence of the amplicon is the following one:

    5’-ATAGTTN'AAANNNNNNNNTTTNAACTATACAACCTACNNNTGAGGTAGTAGGTTGT-3’ (with N' being the base complementary to the N in the PAM)

  2. Inserting 4 more bases complementary to the PAM on one end of the large loop (after ATAGTT), without changing any base. This leads to a 19 bases-long stem, a 10 bases-long small loop and a 12 bases-long large loop. The template sequence of the amplicon is the following one:

    5’-ATAGTTN'AAANNNNNNNNNNNNTTTNAACTATACAACCTACNNNTGAGGTAGTAGGTTGT-3’

  3. Inserting 4 more bases complementary to the PAM on one end of the large loop (after ATAGTT) and 4 more bases at the other end of the large loop (before the PAM sequence), in order to keep the original length of the large loop (16 bases). This leads to a 19 bases-long stem, a 10 bases-long small loop and a 16 bases-long large loop. The template sequence of the amplicon is the following one:

    5’-ATAGTTN'AAANNNNNNNNNNNNNNNNTTTNAACTATACAACCTACNNNTGAGGTAGTAGGTTGT-3’


These three alternatives led, respectively, to Probe 7, Probe 8 and Probe 9.

-----


Finally, Probe 10 was designed in a way to have a mismatched base in the stem with respect to the let-7a sequence (highlighted in both strands below):

5'-pACAACCTACTACCTCAAACGTAGGTTGTAGAGTTTAAAGGGAGTCGGCGGAACTCT-3'

Design of gRNAs after new theory

Halfway through our project (see Notebook for more details), after starting testing our amplicons with Cas12a and the fluorescent reporter (DNase Alert), we realized that the probe itself (more specifically the product of RCA in the absence of miRNA, i.e. with no amplicon) was triggering the Cas system causing a very high fluorescence signal, comparable to the signal obtained for the samples with miRNA (i.e. with probe+amplicon).


We hypothesized that this was due to the fact the our Cas12a was working PAM-independently (more details in "New theory on Cas12a activation - miRNA" in the "Fluorescence readout" section). More specifically, our gRNA was meant to target the whole stem (and in addition 7 bases in the small loop) of the amplicon; since the stem is double-stranded, the target sequence for the gRNA is also present in the probe (in the opposite strand).

This would not have been a problem if the Cas had been working, as expected, PAM-dependently, because the PAM is only contained in the amplicon, not in the probe. Nonetheless, if the Cas does not need the PAM sequence, but simple recognizes a target from the sequence of the gRNA, then also the probe itself is recognized as a target. Moreover, since the concentration of the probe in the RCA reaction is higher than the expected concentration of amplicon, the signal from the probe behaves as noise, overcoming the signal of interest (i.e. from the amplicon).


We therefore designed a new guide RNA with the aim of targeting only the amplicon and not the probe. Our idea was to have the gRNA binding not on the stem, but on the large loop of the amplicon instead. Since the loops of the amplicon are single-stranded (and not double-stranded as the stem) this should allow the gRNA to target only the amplicon and not the probe, being the target sequence contained only in the amplicon and not in its reverse-complement: more specifically, we decided to design a guide RNA perfectly complementary to the large loop of the amplicon of Probe 1; in this way Probe 1, having on the contrary exactly the same sequence as the gRNA, should have never been targeted by this new gRNA.


As from the template gRNA above (5'-[scaffold]-[reverse complement of miRNA]-3'), the spacer was therefore modified to bind (with perfect match) to the large loop of the amplicon of probe 1.

Two different designs were tested, one - referred to elsewhere as "S_1" - binding to the whole large loop and to the first 4 bases after the large loop (for a total of a 20 bases-long spacer), and one - "L_1" elsewhere - binding only to the large loop (16 bases-long spacer). The complete sequences are the following ones:

5'-(UAAUUUCUACUAAGUGUAGAU)UAAAGGGAGUCGGCGGAACU-3' [gRNA sequence - S_1]

5'-(UAAUUUCUACUAAGUGUAGAU)UAAAGGGAGUCGGCGG-3' [gRNA sequence - L_1]


The comparison between the mode of action of the previous, original gRNA and the "new" ones is better explained in the figure below:

Image
Comparison of the interaction between the gRNA and the amplicon for the three different gRNAs we investigated


Fluorescence readout

ctDNA Cas assay

One disadvantage of a classic CRISPR-Cas based assay is the need to have a PAM sequence near the region that we want to detect, for efficient RNA-guided DNA binding. To eliminate this need, we designed PCR primers that would specifically introduce the PAM sequence, for efficient and sequence-independent detection of any given junction or mutation

References

  1. Zetsche, Bernd, et al. "Multiplex gene editing by CRISPR–Cpf1 using a single crRNA array." Nature biotechnology, 35.1 (2017): 31.
  2. Olsson, E. et al. Serial monitoring of circulating tumor DNA in patients with primary breast cancer for detection of occult metastatic disease. EMBO Mol Med, 7, 1034–1047 (2015).
  3. Calapre, Leslie, et al. "Circulating tumour DNA (ctDNA) as a liquid biopsy for melanoma." Cancer letters, 404 (2017): 62-69.
  4. Heitzer, Ellen, et al. "The potential of liquid biopsies for the early detection of cancer." NPJ precision oncology, 1.1 (2017): 36.
  5. "sgRNA Synthesis Using the HiScribe™ Quick T7 High Yield RNA Synthesis Kit" - New England BioLabs website. URL:https://international.neb.com/protocols/2015/11/24/sgrna-synthesis-using-the-hiscribe-quick-t7-high-yield-rna-synthesis-kit-neb-e2050 (Accessed 14/10/2018)
  6. Baklanov, Michail M., Larisa N. Golikova, and Enrst G. Malygin. "Effect on DNA transcription of nucleotide sequences upstream to T7 promoter." Nucleic acids research, 24.18 (1996): 3659-3660.
  7. Gootenberg, Jonathan S., et al. "Nucleic acid detection with CRISPR-Cas13a/C2c2." Science, (2017): eaam9321.
  8. Mitchell, Patrick S., et al. "Circulating microRNAs as stable blood-based markers for cancer detection." Proceedings of the National Academy of Sciences, 105.30 (2008): 10513-10518.
  9. "EnGen Lba Cas12a (Cpf1)" - New England BioLabs website. URL: https://international.neb.com/products/m0653-engen-lba-cas12a-cpf1#Product%20Information_Notes (Accessed 24/09/2018)
  10. Miao, Peng, et al. "Ultrasensitive detection of microRNA through rolling circle amplification on a DNA tetrahedron decorated electrode." Bioconjugate chemistry, 26.3 (2015): 602-607.
  11. Cheng, Yongqiang, et al. "Highly sensitive determination of microRNA using target-primed and branched rolling-circle amplification." Angewandte Chemie International Edition, 48.18 (2009): 3268-3272.
  12. Ali, M. Monsur, et al. "Rolling circle amplification: a versatile tool for chemical biology, materials science and medicine." Chemical Society Reviews, 43.10 (2014): 3324-3341.
  13. Zipper, Hubert, et al. "Investigations on DNA intercalation and surface binding by SYBR Green I, its structure determination and methodological implications." Nucleic acids research, 32.12 (2004): e103-e103
  14. "SYBR Green II RNA Gel Stain" - Sigma-Aldrich. Datasheet. URL: https://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Sigma/Datasheet/2/s9305dat.pdf (Accessed 11/10/2018)
  15. Vitzthum, Frank, et al. "A quantitative fluorescence-based microplate assay for the determination of double-stranded DNA using SYBR Green I and a standard ultraviolet transilluminator gel imaging system." Analytical biochemistry, 276.1 (1999): 59-64.
  16. Larrea, Erika, et al. "New concepts in cancer biomarkers: circulating miRNAs in liquid biopsies." International journal of molecular sciences, 17.5 (2016): 627.
  17. Mirzaei, Hamed, et al. "MicroRNAs as potential diagnostic and prognostic biomarkers in melanoma." European journal of cancer, 53 (2016): 25-32.
  18. "SYBR Green I nucleic acid gel stain" - Sigma-Aldrich. Datasheet. URL: https://www.sigmaaldrich.com/content/dam/sigma-aldrich/docs/Sigma-Aldrich/Datasheet/s9430dat.pdf (Accessed 11/10/2018)
  19. Deng, Ruijie, et al. "Toehold-initiated rolling circle amplification for visualizing individual microRNAs in situ in single cells." Angewandte Chemie, 126.9 (2014): 2421-2425.
  20. Qiu, Xin-Yuan, et al. "Highly Effective and Low-Cost MicroRNA Detection with CRISPR-Cas9." ACS synthetic biology, 7.3 (2018): 807-813.
  21. Zadeh, Joseph N., et al. "NUPACK: analysis and design of nucleic acid systems." Journal of computational chemistry, 32.1 (2011): 170-173.
  22. Zuker, Michael. "Mfold web server for nucleic acid folding and hybridization prediction." Nucleic acids research, 31.13 (2003): 3406-3415.
  23. Reuter, Jessica S., and David H. Mathews. "RNAstructure: software for RNA secondary structure prediction and analysis." BMC bioinformatics, 11.1 (2010): 129.
  24. Xie, Kabin, and Yinong Yang. "RNA-guided genome editing in plants using a CRISPR–Cas system." Molecular plant, 6.6 (2013): 1975-1983.