Difference between revisions of "Team:OUC-China/Parts"

Line 1: Line 1:
−
{{OUC-China}}
+
<!doctype html>
 
<html>
 
<html>
−
<head>
+
<head>
−
<title>Team OUC-China: Main</title>
+
<meta charset="utf-8">
−
<meta charset="utf-8" />
+
<title>无标题文档</title>
−
<meta name="viewport" content="width=device-width, initial-scale=1" />
+
</head>
−
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />
+
−
<link rel="stylesheet" href="https://2018.igem.org/Team:OUC-China/CSS6?action=raw&ctype=text/css" />
+
−
 
+
−
+
−
<style>
+
−
 
+
−
#bodyContent{
+
−
margin:0;
+
−
padding:0;   
+
−
position:absolute;
+
−
top:0 !important;
+
−
width:100%;
+
−
}
+
−
 
+
−
 
+
−
.copyright1 {
+
−
text-align: center;
+
−
padding-top: 20px;
+
−
padding-bottom: 20px;
+
−
background-color: gray;
+
−
color: #FFFFFF;
+
−
text-transform: uppercase;
+
−
font-weight: lighter;
+
−
letter-spacing: 2px;
+
−
border-top-width: 2px;
+
−
        position:absolute;
+
−
        bottom: 0;
+
−
        width:100%
+
−
}
+
  
 +
<body>
 
 
−
.nb{
 
−
background-color:#F7F7F7;
 
−
}
 
−
 
−
 
−
.sk{
 
−
width:1000px;
 
−
padding:0px 50px 0px 50px;
 
−
    margin-left: auto;
 
−
    margin-right: auto;
 
−
background-color:white;
 
−
}
 
−
 
−
 
−
 
−
#myBtn {
 
−
  display: none;
 
−
  position: fixed;
 
−
  bottom: 5px;
 
−
  right: 30px;
 
−
  z-index: 99;
 
−
  border: none;
 
−
  outline: none;
 
−
  background-color: gray;
 
−
  color: white;
 
−
  cursor: pointer;
 
−
  padding: 15px;
 
−
  border-radius: 10px;
 
−
}
 
−
 
−
#myBtn:hover {
 
−
  background-color: #555;
 
−
}
 
−
 
−
body{text-align:center}
 
−
</style>
 
−
 
−
 
−
 
−
</head>
 
−
<body class="homepage">
 
−
 
−
<button onclick="topFunction()" id="myBtn" title="回顶部">TOP</button>
 
−
 
−
<div id="page-wrapper" >
 
−
 
−
 
−
<!-- Nav -->
 
−
<nav id="nav">
 
−
<ul>
 
−
<li ><a href="https://2018.igem.org/Team:OUC-China">Main</a>
 
−
</li>
 
−
<li>
 
−
<a href="#">Project</a>
 
−
<ul>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Description">Overview</a></li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Design">Design</a></li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Results">Results</a></li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Demonstrate">Demonstrate</a></li>
 
−
</ul>
 
−
</li>
 
−
<li><a href="#">Lab WORK</a>
 
−
<ul>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Experiments">Experiments</a></li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Safety">Safety</a></li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/InterLab">InterLab</a></li>
 
−
</ul>
 
−
</li>
 
−
<li><a href="#">Model</a>
 
−
                                                <ul>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Model">Overview</a></li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/miniToe">miniToe</a></li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/miniToe Family">miniToe Family</a></li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/polycistron">polycistron</a></li>
 
−
</ul>
 
−
</li>
 
−
  <li><a href="#">Parts</a>
 
−
<ul>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Parts">List</a></li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Improve">Improve</a></li>
 
−
</ul>
 
−
</li>
 
−
<li><a href="#">HP</a>
 
−
<ul>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Human_Practices">Human Practices</a></li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Public_Engagement">Public Engagement</a></li>
 
−
</ul>
 
−
</li>
 
−
<li><a href="#">Team</a>
 
−
<ul>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Team">Team Member</a></li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Collaborations">Collaborations</a></li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Attributions">Attributions</a></li>
 
−
</ul>
 
−
</li>
 
−
<li><a href="https://2018.igem.org/Team:OUC-China/Notebook">Notebook</a></li>
 
−
 
−
</ul>
 
−
</nav>
 
−
 
−
<!-- Banner -->
 
−
 
−
<img src="https://static.igem.org/mediawiki/2018/f/fe/T--OUC-China--partlist.jpg"width="100%">
 
−
 
−
</div>
 
−
<!-- Main -->
 
−
<div class="nb">
 
−
 
−
 
−
 
−
<div class="sk">
 
−
 
−
<!-- Features -->
 
−
<section class="box features">
 
−
<h2 class="major"><span>Parts</span></h2>
 
−
 
−
<p align="justify">
 
 
<table width="200" border="1">
 
<table width="200" border="1">
 
   <tbody>
 
   <tbody>
Line 202: Line 57:
 
       <td>This part is the miniToe family test system No.1, which consists of promoter J23119, miniToe-1 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 
       <td>This part is the miniToe family test system No.1, which consists of promoter J23119, miniToe-1 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 
       <td>Yunqian Zhang</td>
 
       <td>Yunqian Zhang</td>
−
       <td>&nbsp;</td>
+
       <td>901</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
Line 208: Line 63:
 
       <td>Device</td>
 
       <td>Device</td>
 
       <td>This part is the miniToe family test system No.2, which consists of promoter J23119, miniToe-2 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 
       <td>This part is the miniToe family test system No.2, which consists of promoter J23119, miniToe-2 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
−
       <td>&nbsp;</td>
+
       <td>Anyi Li</td>
−
       <td>&nbsp;</td>
+
       <td>901</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
Line 216: Line 71:
 
       <td>This part is the miniToe family test system No.3, which consists of promoter J23119, miniToe-3 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 
       <td>This part is the miniToe family test system No.3, which consists of promoter J23119, miniToe-3 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 
       <td>Yunqian Zhang</td>
 
       <td>Yunqian Zhang</td>
−
       <td>&nbsp;</td>
+
       <td>901</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
Line 222: Line 77:
 
       <td>Device</td>
 
       <td>Device</td>
 
       <td>This part is the miniToe family test system No.4, which consists of promoter J23119, miniToe-4 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 
       <td>This part is the miniToe family test system No.4, which consists of promoter J23119, miniToe-4 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
−
       <td>&nbsp;</td>
+
       <td>Yunqian Zhang</td>
−
       <td>&nbsp;</td>
+
       <td>901</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
Line 229: Line 84:
 
       <td>Device</td>
 
       <td>Device</td>
 
       <td>This part is the miniToe family test system No.5, which consists of promoter J23119, miniToe-5 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 
       <td>This part is the miniToe family test system No.5, which consists of promoter J23119, miniToe-5 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
−
       <td>&nbsp;</td>
+
       <td> Anyi Li </td>
−
       <td>&nbsp;</td>
+
       <td>901</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615013</td>
−
       <td>&nbsp;</td>
+
       <td>Coding</td>
−
       <td>&nbsp;</td>
+
       <td>Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
−
       <td>&nbsp;</td>
+
       <td>Yunqian Zhang</td>
−
       <td>&nbsp;</td>
+
       <td>564</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615014</td>
−
       <td>&nbsp;</td>
+
       <td>Coding</td>
−
       <td>&nbsp;</td>
+
       <td>Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
−
       <td>&nbsp;</td>
+
       <td>Anyi Li</td>
−
       <td>&nbsp;</td>
+
       <td>564</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615015</td>
−
       <td>&nbsp;</td>
+
       <td>Coding</td>
−
       <td>&nbsp;</td>
+
       <td>Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
−
       <td>&nbsp;</td>
+
       <td>Anyi Li</td>
−
       <td>&nbsp;</td>
+
       <td>564</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615016</td>
−
       <td>&nbsp;</td>
+
       <td>Coding</td>
−
       <td>&nbsp;</td>
+
       <td>Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
−
       <td>&nbsp;</td>
+
       <td>Anyi Li</td>
−
       <td>&nbsp;</td>
+
       <td>564</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615017</td>
−
       <td>&nbsp;</td>
+
       <td>Regulatory</td>
−
       <td>&nbsp;</td>
+
       <td>MiniToe-6, a member of miniToe family. We design it by point mutation.</td>
−
       <td>&nbsp;</td>
+
       <td>Yunqian Zhang</td>
−
       <td>&nbsp;</td>
+
       <td>75</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615018</td>
−
       <td>&nbsp;</td>
+
       <td>Device</td>
−
       <td>&nbsp;</td>
+
       <td>MiniToe polycistron A, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. </td>
−
       <td>&nbsp;</td>
+
       <td>Yunqian Zhang</td>
−
       <td>&nbsp;</td>
+
       <td>1764</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615019</td>
−
       <td>&nbsp;</td>
+
       <td>Device</td>
−
       <td>&nbsp;</td>
+
       <td>MiniToe polycistron B, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. </td>
−
       <td>&nbsp;</td>
+
       <td>Yunqian Zhang</td>
−
       <td>&nbsp;</td>
+
       <td>1764</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615020</td>
−
       <td>&nbsp;</td>
+
       <td>Regulatory</td>
−
       <td>&nbsp;</td>
+
       <td>MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4.</td>
−
       <td>&nbsp;</td>
+
       <td>Yunqian Zhang</td>
−
       <td>&nbsp;</td>
+
       <td>68</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615021</td>
−
       <td>&nbsp;</td>
+
       <td>Regulatory</td>
−
       <td>&nbsp;</td>
+
       <td>MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT.</td>
−
       <td>&nbsp;</td>
+
       <td>Anyi Li</td>
−
       <td>&nbsp;</td>
+
       <td>74</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615022</td>
−
       <td>&nbsp;</td>
+
       <td>Regulatory</td>
−
       <td>&nbsp;</td>
+
       <td>MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT.</td>
−
       <td>&nbsp;</td>
+
       <td>Anyi Li</td>
−
       <td>&nbsp;</td>
+
       <td>74</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615023</td>
−
       <td>&nbsp;</td>
+
       <td>Regulatory</td>
−
       <td>&nbsp;</td>
+
       <td>MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT.</td>
−
       <td>&nbsp;</td>
+
       <td>Anyi Li</td>
−
       <td>&nbsp;</td>
+
       <td>74</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615024</td>
−
       <td>&nbsp;</td>
+
       <td>Regulatory</td>
−
       <td>&nbsp;</td>
+
       <td>MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT.</td>
−
       <td>&nbsp;</td>
+
       <td>Anyi Li</td>
−
       <td>&nbsp;</td>
+
       <td>74</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615025</td>
−
       <td>&nbsp;</td>
+
       <td>Regulatory</td>
−
       <td>&nbsp;</td>
+
       <td>MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT.</td>
−
       <td>&nbsp;</td>
+
       <td>Yunqian Zhang</td>
−
       <td>&nbsp;</td>
+
       <td>74</td>
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>&nbsp;</td>
+
       <td>BBa_K2615026</td>
−
       <td>&nbsp;</td>
+
       <td>Device</td>
−
       <td>&nbsp;</td>
+
       <td>MiniToe-motA, a new system using miniToe, which consists of promoter J23119, miniToe and motA. The intensity of upstream regulatory element can be characterized by motility of bacteria.</td>
−
       <td>&nbsp;</td>
+
       <td>Yunqian Zhang</td>
−
       <td>&nbsp;</td>
+
       <td>1084</td>
 
     </tr>
 
     </tr>
 
   </tbody>
 
   </tbody>
 
</table>
 
</table>
  
−
</p>
+
−
</section>
+
</body>
−
 
+
−
</div>
+
−
</div>
+
−
 
+
−
 
+
−
+
−
 
+
−
 
+
−
 
+
−
 
+
−
 
+
−
 
+
−
 
+
−
<!-- Scripts -->
+
−
+
−
 
+
−
<script src="http://https://2018.igem.org/Team:OUC-China/jquery?action=raw&ctype=text/javascript"></script>
+
−
<script src="https://2018.igem.org/Team:OUC-China/dropotron?action=raw&ctype=text/javascript"></script>
+
−
<script src="https://2018.igem.org/Team:OUC-China/skeljs?action=raw&ctype=text/javascript"></script>
+
−
<script src="https://2018.igem.org/Team:OUC-China/skelviewport?action=raw&ctype=text/javascript"></script>
+
−
<script src="https://2018.igem.org/Team:OUC-China/utiljs?action=raw&ctype=text/javascript"></script>
+
−
<script src="https://2018.igem.org/Team:OUC-China/mainjs?action=raw&ctype=text/javascript"></script>
+
−
 
+
−
 
+
−
  <div class="copyright1">Contact Us : oucigem@163.com  | &copy;2018 OUC IGEM.All Rights Reserved.  |  ………… </div>
+
−
+
−
 
+
−
<script>
+
−
// 当网页向下滑动 20px 出现"返回顶部" 按钮
+
−
window.onscroll = function() {scrollFunction()};
+
−
+
−
function scrollFunction() {console.log(121);
+
−
    if (document.body.scrollTop > 20 || document.documentElement.scrollTop > 20) {
+
−
        document.getElementById("myBtn").style.display = "block";
+
−
    } else {
+
−
        document.getElementById("myBtn").style.display = "none";
+
−
    }
+
−
}
+
−
+
−
// 点击按钮，返回顶部
+
−
function topFunction() {
+
−
    document.body.scrollTop = 0;
+
−
    document.documentElement.scrollTop = 0;
+
−
}
+
−
</script>
+
−
 
+
−
 
+
−
</body>
+
−
 
+
−
 
+
 
</html>
 
</html>

Revision as of 14:57, 16 October 2018

<!doctype html> 无标题文档

Name Type Description Designer Length
BBa_K2615003 Translational_Unit Made up of Csy4-WT and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4 can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. Yunqian Zhang 588
BBa_K2615004 Translational_Unit Made up of Csy4-Q104A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Q104A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAG(encoding Gln) to GCG(encoding Ala) on the 104th site based on Csy4-WT. Yunqian Zhang 588
BBa_K2615005 Translational_Unit Made up of Csy4-Y176F and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Y176F can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TAC(encoding Tyr) to TTT(encoding Phe) on the 176th site based on Csy4-WT. Yunqian Zhang 588
BBa_K2615006 Translational_Unit Made up of Csy4-F155A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-F155A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TTC(encoding Phe) to GCG(encoding Ara) on the 155th site based on Csy4-WT. Anyi Li 588
BBa_K2615007 Translational_Unit Made up of Csy4-H29A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-H29A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAC(encoding His ) to GCG(encoding Ara) on the 29th site based on Csy4-WT. Anyi Li 588
BBa_K2615008 Device This part is the miniToe family test system No.1, which consists of promoter J23119, miniToe-1 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Yunqian Zhang 901
BBa_K2615009 Device This part is the miniToe family test system No.2, which consists of promoter J23119, miniToe-2 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Anyi Li 901
BBa_K2615010 Device This part is the miniToe family test system No.3, which consists of promoter J23119, miniToe-3 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Yunqian Zhang 901
BBa_K2615011 Device This part is the miniToe family test system No.4, which consists of promoter J23119, miniToe-4 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Yunqian Zhang 901
BBa_K2615012 Device This part is the miniToe family test system No.5, which consists of promoter J23119, miniToe-5 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Anyi Li 901
BBa_K2615013 Coding Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Yunqian Zhang 564
BBa_K2615014 Coding Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615015 Coding Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615016 Coding Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615017 Regulatory MiniToe-6, a member of miniToe family. We design it by point mutation. Yunqian Zhang 75
BBa_K2615018 Device MiniToe polycistron A, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. Yunqian Zhang 1764
BBa_K2615019 Device MiniToe polycistron B, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. Yunqian Zhang 1764
BBa_K2615020 Regulatory MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. Yunqian Zhang 68
BBa_K2615021 Regulatory MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT. Anyi Li 74
BBa_K2615022 Regulatory MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT. Anyi Li 74
BBa_K2615023 Regulatory MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT. Anyi Li 74
BBa_K2615024 Regulatory MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT. Anyi Li 74
BBa_K2615025 Regulatory MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT. Yunqian Zhang 74
BBa_K2615026 Device MiniToe-motA, a new system using miniToe, which consists of promoter J23119, miniToe and motA. The intensity of upstream regulatory element can be characterized by motility of bacteria. Yunqian Zhang 1084