Difference between revisions of "Team:OUC-China/Parts"

Line 189: Line 189:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615003</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615003">BBa_K2615003</a></td>
 
       <td>Translational_Unit</td>
 
       <td>Translational_Unit</td>
 
       <td>Made up of Csy4-WT and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4 can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. </td>
 
       <td>Made up of Csy4-WT and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4 can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. </td>
Line 196: Line 196:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615004</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615004">BBa_K2615004</a></td>
 
       <td>Translational_Unit</td>
 
       <td>Translational_Unit</td>
 
       <td>Made up of Csy4-Q104A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Q104A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAG(encoding Gln) to GCG(encoding Ala) on the 104th site based on Csy4-WT. </td>
 
       <td>Made up of Csy4-Q104A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Q104A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAG(encoding Gln) to GCG(encoding Ala) on the 104th site based on Csy4-WT. </td>
Line 203: Line 203:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615005</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615005">BBa_K2615005</a></td>
 
       <td>Translational_Unit</td>
 
       <td>Translational_Unit</td>
 
       <td>Made up of Csy4-Y176F and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Y176F can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TAC(encoding Tyr) to TTT(encoding Phe) on the 176th site based on Csy4-WT. </td>
 
       <td>Made up of Csy4-Y176F and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Y176F can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TAC(encoding Tyr) to TTT(encoding Phe) on the 176th site based on Csy4-WT. </td>
Line 210: Line 210:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615006</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615006">BBa_K2615006</a></td>
 
       <td>Translational_Unit</td>
 
       <td>Translational_Unit</td>
 
       <td>Made up of Csy4-F155A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-F155A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TTC(encoding Phe) to GCG(encoding Ara) on the 155th site based on Csy4-WT.</td>
 
       <td>Made up of Csy4-F155A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-F155A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TTC(encoding Phe) to GCG(encoding Ara) on the 155th site based on Csy4-WT.</td>
Line 217: Line 217:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615007</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615007">BBa_K2615007</a></td>
 
       <td>Translational_Unit</td>
 
       <td>Translational_Unit</td>
 
       <td>Made up of Csy4-H29A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-H29A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA.  And this part design by point mutation, we change the CAC(encoding His ) to GCG(encoding Ara) on the 29th site based on Csy4-WT.</td>
 
       <td>Made up of Csy4-H29A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-H29A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA.  And this part design by point mutation, we change the CAC(encoding His ) to GCG(encoding Ara) on the 29th site based on Csy4-WT.</td>
Line 224: Line 224:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615008</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615008">BBa_K2615008</a></td>
 
       <td>Device</td>
 
       <td>Device</td>
 
       <td>This part is the miniToe family test system No.1, which consists of promoter J23119, miniToe-1 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 
       <td>This part is the miniToe family test system No.1, which consists of promoter J23119, miniToe-1 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
Line 231: Line 231:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615009</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615009">BBa_K2615009</a></td>
 
       <td>Device</td>
 
       <td>Device</td>
 
       <td>This part is the miniToe family test system No.2, which consists of promoter J23119, miniToe-2 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 
       <td>This part is the miniToe family test system No.2, which consists of promoter J23119, miniToe-2 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
Line 238: Line 238:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615010</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615010">BBa_K2615010</a></td>
 
       <td>Device</td>
 
       <td>Device</td>
 
       <td>This part is the miniToe family test system No.3, which consists of promoter J23119, miniToe-3 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 
       <td>This part is the miniToe family test system No.3, which consists of promoter J23119, miniToe-3 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
Line 245: Line 245:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615011</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615011">BBa_K2615011</a></td>
 
       <td>Device</td>
 
       <td>Device</td>
 
       <td>This part is the miniToe family test system No.4, which consists of promoter J23119, miniToe-4 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 
       <td>This part is the miniToe family test system No.4, which consists of promoter J23119, miniToe-4 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
Line 252: Line 252:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615012</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615012">BBa_K2615012</a></td>
 
       <td>Device</td>
 
       <td>Device</td>
 
       <td>This part is the miniToe family test system No.5, which consists of promoter J23119, miniToe-5 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 
       <td>This part is the miniToe family test system No.5, which consists of promoter J23119, miniToe-5 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
Line 259: Line 259:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615013</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615013">BBa_K2615013</a></td>
 
       <td>Coding</td>
 
       <td>Coding</td>
 
       <td>Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 
       <td>Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
Line 266: Line 266:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615014</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615014">BBa_K2615014</a></td>
 
       <td>Coding</td>
 
       <td>Coding</td>
 
       <td>Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 
       <td>Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
Line 273: Line 273:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615015</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615015">BBa_K2615015</a></td>
 
       <td>Coding</td>
 
       <td>Coding</td>
 
       <td>Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 
       <td>Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
Line 280: Line 280:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615016</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615016">BBa_K2615016</a></td>
 
       <td>Coding</td>
 
       <td>Coding</td>
 
       <td>Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 
       <td>Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
Line 287: Line 287:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615017</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615017">BBa_K2615017</a></td>
 
       <td>Regulatory</td>
 
       <td>Regulatory</td>
 
       <td>MiniToe-6, a member of miniToe family. We design it by point mutation.</td>
 
       <td>MiniToe-6, a member of miniToe family. We design it by point mutation.</td>
Line 294: Line 294:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615018</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615018">BBa_K2615018</a></td>
 
       <td>Device</td>
 
       <td>Device</td>
 
       <td>MiniToe polycistron A, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. </td>
 
       <td>MiniToe polycistron A, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. </td>
Line 301: Line 301:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615019</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615019">BBa_K2615019</a></td>
 
       <td>Device</td>
 
       <td>Device</td>
 
       <td>MiniToe polycistron B, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. </td>
 
       <td>MiniToe polycistron B, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. </td>
Line 308: Line 308:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615020</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615020">BBa_K2615020</a></td>
 
       <td>Regulatory</td>
 
       <td>Regulatory</td>
 
       <td>MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4.</td>
 
       <td>MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4.</td>
Line 315: Line 315:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615021</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615021">BBa_K2615021</a></td>
 
       <td>Regulatory</td>
 
       <td>Regulatory</td>
 
       <td>MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT.</td>
 
       <td>MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT.</td>
Line 322: Line 322:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615022</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615022">BBa_K2615022</a></td>
 
       <td>Regulatory</td>
 
       <td>Regulatory</td>
 
       <td>MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT.</td>
 
       <td>MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT.</td>
Line 329: Line 329:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615023</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615023">BBa_K2615023</a></td>
 
       <td>Regulatory</td>
 
       <td>Regulatory</td>
 
       <td>MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT.</td>
 
       <td>MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT.</td>
Line 336: Line 336:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615024</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615024">BBa_K2615024</a></td>
 
       <td>Regulatory</td>
 
       <td>Regulatory</td>
 
       <td>MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT.</td>
 
       <td>MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT.</td>
Line 343: Line 343:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615025</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615025">BBa_K2615025</a></td>
 
       <td>Regulatory</td>
 
       <td>Regulatory</td>
 
       <td>MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT.</td>
 
       <td>MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT.</td>
Line 350: Line 350:
 
     </tr>
 
     </tr>
 
     <tr>
 
     <tr>
−
       <td>BBa_K2615026</td>
+
       <td><a href="http://parts.igem.org/Part:BBa_K2615026">BBa_K2615026</a></td>
 
       <td>Device</td>
 
       <td>Device</td>
 
       <td>MiniToe-motA, a new system using miniToe, which consists of promoter J23119, miniToe and motA. The intensity of upstream regulatory element can be characterized by motility of bacteria.</td>
 
       <td>MiniToe-motA, a new system using miniToe, which consists of promoter J23119, miniToe and motA. The intensity of upstream regulatory element can be characterized by motility of bacteria.</td>

Revision as of 03:03, 17 October 2018

Team OUC-China: Main

Parts

Silver part: Designing a new part

This year, our project can be divided into four systems. Between the different systems, there are different protocols. And we have sorted out these experimentals in detail.

This year, we design a basic part called miniToe, which consists of RBS, Csy4 recognition site and cis-repressive RNA element. As a regulatory element, it can be specifically recognized and cleaved by Csy4 to regulate the expression of its downstream genes from the RNA level. MiniToe is the core of our project design, is RFC10 compatible and works as expected. We have documented its experimental characterization on Part's Main Page on the Registry and submitted the sample to the Registry. Certainly, this part is different from the new part documented for Gold#2. See the page for more details: parts.igem.org/Part:BBa_K2615020

At the same time, the Csy4 (BBa_K2615003) is one of the key role in our system. We also submitted it to registry. We also apply miniToe to polycistron to create miniToe polycistron (BBa_K2615019).

Gold parts: Improving an existing part

Improving an existing Part Standardization and building up on existing parts are the fundaments of iGEM. We have created FOUR new BioBrick Part (BBa_K2615004, BBa_K2615005, BBa_K2615006, BBa_K2615007) that has a functional improvement upon an existing BioBrick Part (BBa_K1062004). The sequences of four new parts and existing part are different, and the new parts are changed by point mutation. We have showed experiments with both parts to demonstrate this improvement.

See the pages below for details:
The existing part
parts.igem.org/Part:BBa_K1062004:Experience

The four improved parts
parts.igem.org/Part:BBa_K2615004
parts.igem.org/Part:BBa_K2615005
parts.igem.org/Part:BBa_K2615006
parts.igem.org/Part:BBa_K2615007
Name Type Description Designer Length
BBa_K2615003 Translational_Unit Made up of Csy4-WT and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4 can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. Yunqian Zhang 588
BBa_K2615004 Translational_Unit Made up of Csy4-Q104A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Q104A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAG(encoding Gln) to GCG(encoding Ala) on the 104th site based on Csy4-WT. Yunqian Zhang 588
BBa_K2615005 Translational_Unit Made up of Csy4-Y176F and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Y176F can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TAC(encoding Tyr) to TTT(encoding Phe) on the 176th site based on Csy4-WT. Yunqian Zhang 588
BBa_K2615006 Translational_Unit Made up of Csy4-F155A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-F155A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TTC(encoding Phe) to GCG(encoding Ara) on the 155th site based on Csy4-WT. Anyi Li 588
BBa_K2615007 Translational_Unit Made up of Csy4-H29A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-H29A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAC(encoding His ) to GCG(encoding Ara) on the 29th site based on Csy4-WT. Anyi Li 588
BBa_K2615008 Device This part is the miniToe family test system No.1, which consists of promoter J23119, miniToe-1 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Yunqian Zhang 901
BBa_K2615009 Device This part is the miniToe family test system No.2, which consists of promoter J23119, miniToe-2 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Anyi Li 901
BBa_K2615010 Device This part is the miniToe family test system No.3, which consists of promoter J23119, miniToe-3 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Yunqian Zhang 901
BBa_K2615011 Device This part is the miniToe family test system No.4, which consists of promoter J23119, miniToe-4 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Yunqian Zhang 901
BBa_K2615012 Device This part is the miniToe family test system No.5, which consists of promoter J23119, miniToe-5 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Anyi Li 901
BBa_K2615013 Coding Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Yunqian Zhang 564
BBa_K2615014 Coding Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615015 Coding Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615016 Coding Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615017 Regulatory MiniToe-6, a member of miniToe family. We design it by point mutation. Yunqian Zhang 75
BBa_K2615018 Device MiniToe polycistron A, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. Yunqian Zhang 1764
BBa_K2615019 Device MiniToe polycistron B, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. Yunqian Zhang 1764
BBa_K2615020 Regulatory MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. Yunqian Zhang 68
BBa_K2615021 Regulatory MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT. Anyi Li 74
BBa_K2615022 Regulatory MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT. Anyi Li 74
BBa_K2615023 Regulatory MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT. Anyi Li 74
BBa_K2615024 Regulatory MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT. Anyi Li 74
BBa_K2615025 Regulatory MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT. Yunqian Zhang 74
BBa_K2615026 Device MiniToe-motA, a new system using miniToe, which consists of promoter J23119, miniToe and motA. The intensity of upstream regulatory element can be characterized by motility of bacteria. Yunqian Zhang 1084



Contact Us : oucigem@163.com | ©2018 OUC IGEM.All Rights Reserved. | …………