Difference between revisions of "Team:OUC-China/Basic Part"

Line 1: Line 1:
 
{{OUC-China}}
 
{{OUC-China}}
 
<html>
 
<html>
 +
<head>
 +
<title>Team OUC-China: Main</title>
 +
<meta charset="utf-8" />
 +
<meta name="viewport" content="width=device-width, initial-scale=1" />
 +
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />
 +
<link rel="stylesheet" href="https://2018.igem.org/Team:OUC-China/CSS6?action=raw&ctype=text/css" />
  
 +
 +
<style>
  
 +
#bodyContent{
 +
margin:0;
 +
padding:0;   
 +
position:absolute;
 +
top:0 !important;
 +
width:100%;
 +
}
  
 +
#class td /*设置表格文字左右和上下居中对齐*/
 +
{ 
 +
    vertical-align: middle;
 +
    text-align: center; 
 +
}
  
 +
.copyright1 {
 +
text-align: center;
 +
padding-top: 20px;
 +
padding-bottom: 20px;
 +
background-color: gray;
 +
color: #FFFFFF;
 +
text-transform: uppercase;
 +
font-weight: lighter;
 +
letter-spacing: 2px;
 +
border-top-width: 2px;
 +
        position:absolute;
 +
        bottom: 0;
 +
        width:100%
 +
}
  
−
<div class="column full_size">
+
−
<h1>Basic Parts</h1>
+
.nb{
−
<p>
+
background-color:#F7F7F7;
−
A <b>basic part</b> is a functional unit of DNA that cannot be subdivided into smaller component parts. <a href="http://parts.igem.org/wiki/index.php/Part:BBa_R0051">BBa_R0051</a> is an example of a basic part, a promoter regulated by lambda cl.
+
}
−
</p>
+
 +
 +
.sk{
 +
width:1000px;
 +
padding:0px 50px 0px 50px;
 +
    margin-left: auto;
 +
    margin-right: auto;
 +
background-color:white;
 +
}
 +
  
−
<p>Most genetically-encoded functions have not yet been converted to BioBrick parts. Thus, there are <b>many</b> opportunities to find new, cool, and important genetically encoded functions, and refine and convert the DNA encoding these functions into BioBrick standard biological parts. </p>
 
−
</div>
 
  
 +
#myBtn {
 +
  display: none;
 +
  position: fixed;
 +
  bottom: 5px;
 +
  right: 30px;
 +
  z-index: 99;
 +
  border: none;
 +
  outline: none;
 +
  background-color: gray;
 +
  color: white;
 +
  cursor: pointer;
 +
  padding: 15px;
 +
  border-radius: 10px;
 +
}
  
−
<div class="column full_size">
+
#myBtn:hover {
−
<div class="highlight decoration_background">
+
  background-color: #555;
−
<h3>Note</h3>
+
}
−
<p>This page should list all the basic parts your team has made during your project. You must add all characterization information for your parts on the Registry. You should not put characterization information on this page. Remember judges will only look at the first part in the list for the Best Basic Part award, so put your best part first!</p>
+
−
</div>
+
−
</div>
+
  
  
−
<div class="column full_size">
+
</style>
−
<h3>Best Basic Part Special Prize</h3>
+
  
−
<p> To be eligible for this award, this part must adhere to <a href="http://parts.igem.org/DNA_Submission">Registry sample submission guidelines</a> and have been sent to the Registry of Standard Biological Parts. If you have a part you wish to nominate your team for this <a href="https://2018.igem.org/Judging/Awards">special prize</a>, make sure you add your part number to your <a href="https://2018.igem.org/Judging/Judging_Form">judging form</a> and delete the box at the top of this page.
 
  
−
<br><br>
 
−
<b>Please note:</b> Judges will only look at the first part number you list, so please only enter ONE (1) part number in the judging form for this prize. </p>
 
−
</div>
 
  
 +
</head>
 +
<body class="homepage">
  
 +
<button onclick="topFunction()" id="myBtn" title="回顶部">TOP</button>
  
 +
<div id="page-wrapper" >
 +
 +
 +
<!-- Nav -->
 +
<nav id="nav">
 +
<ul>
 +
<li ><a href="https://2018.igem.org/Team:OUC-China">Main</a>
 +
</li>
 +
<li>
 +
<a href="#">Project</a>
 +
<ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Description">Overview</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Design">Design</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Results">Results</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Demonstrate">Demonstrate</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="#">Lab WORK</a>
 +
<ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Experiments">Experiments</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Safety">Safety</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/InterLab">InterLab</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="#">Model</a>
 +
                                                <ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Model">Overview</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/miniToe">miniToe</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/miniToe Family">miniToe Family</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/polycistron">polycistron</a></li>
 +
</ul>
 +
</li>
 +
  <li><a href="#">Parts</a>
 +
<ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Parts">List</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Improve">Improve</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="#">HP</a>
 +
<ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Human_Practices">Human Practices</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Public_Engagement">Public Engagement</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="#">Team</a>
 +
<ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Team">Team Member</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Collaborations">Collaborations</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Attributions">Attributions</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Notebook">Notebook</a></li>
 +
 +
</ul>
 +
</nav>
 +
 +
<!-- Banner -->
 +
 +
<img src="https://static.igem.org/mediawiki/2018/f/fe/T--OUC-China--partlist.jpg"width="100%">
 +
 +
</div>
 +
<!-- Main -->
 +
<div class="nb">
 +
 +
 +
 +
<div class="sk">
 +
 +
<!-- Features -->
 +
<section class="box features">
 +
 +
 +
<h2 class="major"><span>Basic Parts</span></h2>
 +
 +
<p align="justify">
 +
 +
 +
<table width="200" border="1">
 +
  <tbody>
 +
    <tr>
 +
      <th scope="col">Part number</th>
 +
      <th scope="col">Type</th>
 +
      <th scope="col">Description</th>
 +
      <th scope="col">Designer</th>
 +
      <th scope="col">Length（bp）</th>
 +
    </tr>   
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615020">BBa_K2615020</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>68</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615013">BBa_K2615013</a></td>
 +
      <td>Coding</td>
 +
      <td>Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>564</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615014">BBa_K2615014</a></td>
 +
      <td>Coding</td>
 +
      <td>Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 +
      <td>Anyi Li</td>
 +
      <td>564</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615015">BBa_K2615015</a></td>
 +
      <td>Coding</td>
 +
      <td>Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 +
      <td>Anyi Li</td>
 +
      <td>564</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615016">BBa_K2615016</a></td>
 +
      <td>Coding</td>
 +
      <td>Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 +
      <td>Anyi Li</td>
 +
      <td>564</td>
 +
    </tr>
 +
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615021">BBa_K2615021</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615022">BBa_K2615022</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615023">BBa_K2615023</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615024">BBa_K2615024</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615025">BBa_K2615025</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>74</td>
 +
    </tr>
 +
    </tr>
 +
  </tbody>
 +
</table>
 +
</div>
 +
<br /><br /><br />
 +
 +
</p> </section>
 +
 +
</div>
 +
</div>
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
<!-- Scripts -->
 +
 +
 +
<script src="http://https://2018.igem.org/Team:OUC-China/jquery?action=raw&ctype=text/javascript"></script>
 +
<script src="https://2018.igem.org/Team:OUC-China/dropotron?action=raw&ctype=text/javascript"></script>
 +
<script src="https://2018.igem.org/Team:OUC-China/skeljs?action=raw&ctype=text/javascript"></script>
 +
<script src="https://2018.igem.org/Team:OUC-China/skelviewport?action=raw&ctype=text/javascript"></script>
 +
<script src="https://2018.igem.org/Team:OUC-China/utiljs?action=raw&ctype=text/javascript"></script>
 +
<script src="https://2018.igem.org/Team:OUC-China/mainjs?action=raw&ctype=text/javascript"></script>
 +
 +
 +
  <div class="copyright1">Contact Us : oucigem@163.com  | &copy;2018 OUC IGEM.All Rights Reserved.  |  ………… </div>
 +
 +
 +
<script>
 +
// 当网页向下滑动 20px 出现"返回顶部" 按钮
 +
window.onscroll = function() {scrollFunction()};
 +
 +
function scrollFunction() {console.log(121);
 +
    if (document.body.scrollTop > 20 || document.documentElement.scrollTop > 20) {
 +
        document.getElementById("myBtn").style.display = "block";
 +
    } else {
 +
        document.getElementById("myBtn").style.display = "none";
 +
    }
 +
}
 +
 +
// 点击按钮，返回顶部
 +
function topFunction() {
 +
    document.body.scrollTop = 0;
 +
    document.documentElement.scrollTop = 0;
 +
}
 +
</script>
 +
 +
 +
</body>
  
  
 
</html>
 
</html>

Revision as of 03:11, 17 October 2018

Team OUC-China: Main

Basic Parts

Part number Type Description Designer Length（bp）
BBa_K2615020 Regulatory MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. Yunqian Zhang 68
BBa_K2615013 Coding Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Yunqian Zhang 564
BBa_K2615014 Coding Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615015 Coding Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615016 Coding Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615021 Regulatory MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT. Anyi Li 74
BBa_K2615022 Regulatory MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT. Anyi Li 74
BBa_K2615023 Regulatory MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT. Anyi Li 74
BBa_K2615024 Regulatory MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT. Anyi Li 74
BBa_K2615025 Regulatory MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT. Yunqian Zhang 74



Contact Us : oucigem@163.com | ©2018 OUC IGEM.All Rights Reserved. | …………