JeffHusdsz (Talk | contribs) |
JeffHusdsz (Talk | contribs) |
||
(15 intermediate revisions by 2 users not shown) | |||
Line 25: | Line 25: | ||
<body> | <body> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
Line 54: | Line 42: | ||
</p> | </p> | ||
− | + | <header class="align-center"> | |
+ | |||
+ | <h2> chitin deacetylase 1 [Penaeus monodon] </h2> | ||
+ | </header> | ||
<p style="color:black;font-size:35px;"> | <p style="color:black;font-size:35px;"> | ||
− | + | 1 atggcaagag taagatgcgg tagttctctt gccctccttg gcattgtgct gccgagcggg<br> | |
61 tcaagaggca ggcagtttca gacacgaccg aggatggagc gaaccttcaa gagggaactg<br> | 61 tcaagaggca ggcagtttca gacacgaccg aggatggagc gaaccttcaa gagggaactg<br> | ||
121 tgcaaggata agggcgccgg cgagtggttc cgtctcagcc tcggtgactg tcgcgatgtg<br> | 121 tgcaaggata agggcgccgg cgagtggttc cgtctcagcc tcggtgactg tcgcgatgtg<br> | ||
Line 91: | Line 82: | ||
<blockquote></blockquote> | <blockquote></blockquote> | ||
+ | <section id="two" class="wrapper style2"> | ||
+ | <div class="inner"> | ||
+ | <div> | ||
+ | <div> | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2>PREDICTED: uncharacterized protein LOC108681649 [Hyalella azteca] </h2> | ||
+ | </header> | ||
+ | <p style="color:black;font-size:35px;"> | ||
+ | |||
+ | 1 atgctgatgc atgtagccat catgctcatg ctgctggatc agcacgctca aggttcagag<br> | ||
+ | 61 cggcaccccc ggcagagcag caacgccacc accacagagc agctctgcag aggccgcgac<br> | ||
+ | 121 tctgaggagt acttcagact ctctgccggc gacgactgca gagacgttgt tagatgtgac<br> | ||
+ | 181 cgcagtggac gctctggccc cagccgcctg gccgcagtgc ggtgccccaa cggcctcgcc<br> | ||
+ | 241 ttcgacgtcg acagacaagt ctgtgactgg aagaccaaag tccgcaactg cgacagactt<br> | ||
+ | 301 gagagaccgc ggaagattaa gccgctgctg gtgacggagg agccgctgtg ctcggggacg<br> | ||
+ | 361 gacctggcgt gcggcagcgg cgtgtgtgtc gccaaggagc tcttctgtga tggcaaacct<br> | ||
+ | 421 gactgtgatg acggttccga cgagaacacg tgtggtgtgg aagaagatcc aaaccgagcc<br> | ||
+ | 481 caggtgtgcg acaaaagtca atgcgttttg ccagaatgtt tctgttccgt ggacggcact<br> | ||
+ | 541 agaattcctg gtgatatcaa cccaaaacaa acaccgcaaa tgatcaccat cacattttca<br> | ||
+ | 601 ggagcaatca accttgataa tgtggatttg tacgatgaca tcttcaacgg ggaaagaaag<br> | ||
+ | 661 aatcccaacg gttgtcaagt gaaagcaacg ttcttcacgt cgcacaagta caccaattac<br> | ||
+ | 721 tccgcagttc aagaactaca caggaaaggc catgagatcg ctgtgttctc gatctcgaac<br> | ||
+ | 781 aaagaaagtc gagactattg gtcccatgga acatacgacg actggcttgc tgaaatggct<br> | ||
+ | 841 ggggccagac tcatcgtcga acgtttcgcc aatatcacag ataattccat cgtcgggtta<br> | ||
+ | 901 cgagcgccct acctcagggt tggaggaaac gctcagttcg acatgatgaa cgatcagttc<br> | ||
+ | 961 ttcttctacg acgcttcgat tacagcgcca ttggggaaac ttccgctatg gccgtacaca<br> | ||
+ | 1021 ttgtacttca ggatgcctca caaatgtcac gggaacggcc aaaattgtcc atcacgctcc<br> | ||
+ | 1081 caccccgtct gggaaatggt catgaacgaa atggacagaa gagacgaccc agagtttgac<br> | ||
+ | 1141 gaaggactat ctgggtgtca ttacgtcgac tcctgcacca acatccggac tccaaagcaa<br> | ||
+ | 1201 tttgcccatt tcctcgagca caacttcaga cgacactaca acacaaaccg tgcaccactc<br> | ||
+ | 1261 ggcttgcatt tccacgcttc ttggctaaaa ggaaacaaaa attttaaaaa ggaactcatc<br> | ||
+ | 1321 aatttcattc agtcaaaatc gggcaaccct gacgtgtatt tcgtgaccat gcttcaagtg<br> | ||
+ | 1381 attcaatgga tgcaagcacc gaccgaagtg gcaggacttc gcgatttccc agaatggaag<br> | ||
+ | 1441 gagaaatgcg acgtgcaagg tctgccattt tgctcattac caaacacttg cccggtgagg<br> | ||
+ | 1501 acacgagaga ttcctgacga gactttgagt ttgttcacct gcatggactg cccccgcaac<br> | ||
+ | 1561 tacccctggc tgctcgaccc taccggggat ggcgtggaaa ttatataa<br></p> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </section> | ||
+ | <blockquote></blockquote><section id="two" class="wrapper style2"> | ||
+ | <div class="inner"> | ||
+ | <div> | ||
+ | <div> | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2> PREDICTED: uncharacterized protein LOC108681651 [Hyalella azteca] </h2> | ||
+ | </header> | ||
+ | <p style="color:black;font-size:35px;"> | ||
+ | |||
+ | 1 atgtctagat taagattcgt ccttgtgcta ttgttcgcag cagcggcagt cttagctgag<br> | ||
+ | 61 gagcgtgaga agcgacaggc agcggaggcc gaggcgacgg tagacgagga tgccgtggac<br> | ||
+ | 121 gctttcacca gggagctgtg cgccagcaag ggcgcgcagg agtacttcag actcagcacg<br> | ||
+ | 181 caggattgca gaaaagtcat ccagtgcaca gaagtcggtc tggagagtct agtgtgcccc<br> | ||
+ | 241 cctagtcttg cattcgacct ggaactgcaa gcatgcaact ggaaggaaga ggtgaagaat<br> | ||
+ | 301 tgtgccaaga ccaccaaaga caagaaagtc aggcctctca ctgccaccaa ggaccccttg<br> | ||
+ | 361 tgcgagggcg gtaagctggc atgtggagac ggtgtgtgta tagcgaaaga gttgttctgc<br> | ||
+ | 421 gacggcaagc ctgactgtgc cgataattca gatgagaact tttgcgacat caactcagat<br> | ||
+ | 481 ccaaacagag ctcctcaatg taacaaggcc gaatgccagc tgccgaactg cttctgcatt<br> | ||
+ | 541 aacaacccta atgagacccc caacaatatc gaccctaagg atgtaccaca gatgatcatg<br> | ||
+ | 601 atcactttcg atgacgctgt caacaacaac aacgttgatc tctacgacct catcttcagt<br> | ||
+ | 661 ggccgcgcaa atccaaatgg ctgtgacatc aaagccacat tcttcgtgtc gcataaatac<br> | ||
+ | 721 acgaattaca ccgcagtcag cgaactacac cgcaaaggac acgaaatcgc cgtccactcc<br> | ||
+ | 781 atcagtcaca acgattccgc taccttctgg acggaagcca ctgtccaaga ctggaccaac<br> | ||
+ | 841 gaaatggcgg gagctcgaca gattgtcaat catttcgcca acatcactga taccacagtc<br> | ||
+ | 901 gtgggcgtcc gcgctcctta ccttcgagtg ggaggaaaca accaattcct catgatggaa<br> | ||
+ | 961 gagcaaggtt tcctctacga ttccaccatt gttgctcctt tggctgatgt gccactttgg<br> | ||
+ | 1021 ccctatattt tgtactaccg tatgcctcat gagtgtcatg ggcacattca ggtttgccct<br> | ||
+ | 1081 actcgggcat acgctgtttg ggaaatggtc atgaacgaaa tggaccgtcg tgaagaccct<br> | ||
+ | 1141 cttcatgaag agcctcttcc tggttgcgct atggtggact cctgcttctc gaacaggccg<br> | ||
+ | 1201 acaggcgatc aattttataa tttcttgaac aacaacttca accgccacta caactccaac<br> | ||
+ | 1261 cgcgctccta tgggactctt tttccactct gctttcctca agaacaaccc tgagatcctg<br> | ||
+ | 1321 gatgccttta cgttctggct cgacgaaatt cttagcactc acaaggacgt ctacttcgta<br> | ||
+ | 1381 accatgactc aagctcttta ctggctccag gatattgttc caattagtca agttgctaac<br> | ||
+ | 1441 ttcgagccct ggaaggataa gtgtgcagtc caaggccctc catcgtgcca gaacggagga<br> | ||
+ | 1501 aataactgta aattggacac tgctgaactg cccggcgaaa ccgtacgcct gtctacctgc<br> | ||
+ | 1561 atgccttgcc ccagcaggta cccctggttg ttggacccca atggtgatgg actattctaa<br> | ||
+ | </p> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </section> | ||
+ | <blockquote></blockquote> | ||
+ | <section id="two" class="wrapper style2"> | ||
+ | <div class="inner"> | ||
+ | <div> | ||
+ | <div> | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2>Verm </h2> | ||
+ | </header> | ||
+ | <p style="color:black;font-size:35px;"> | ||
+ | 1 atgctgaccg ttgatggagc agtgaacgac ctgaactatg aaacctacag cagcgtcttc<br> | ||
+ | 61 cgccccgatc gcaccaaccc caatggctgc cctatccgag gcaccttctt tgtctcccat<br> | ||
+ | 121 gagtacacca actaccagca gggggaggac ctctacagca gagggcacga gattgctgtt<br> | ||
+ | 181 ggctccgtca gccgccgtgc cggtctagag gatgaagggg aagagtcctg gactggagag<br> | ||
+ | 241 atggtgacaa tgcgagaaat tcttactaaa tttgctggag tgcgcactga ggatctgaag<br> | ||
+ | 301 ggacagcgag gacctcacct caagcctggc agggaggctc agtatgaggt gctcagtgcc<br> | ||
+ | 361 tatgggttca cttgggactc taccatcaac aaccctccca caaaacacct agtttggccc<br> | ||
+ | 421 tactccctgg aatgcaagat gccccatgag tgccgagctg gttcctgccc cacacgatcc<br> | ||
+ | 481 ttccccggag tgtgggagct gcctatgaac tcccacttca aggacaccag tttccaggga<br> | ||
+ | 541 ggcttttgcc cttacctgga ccagtgcaac ttcagctact ag<br> | ||
+ | </p> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </section> | ||
+ | <blockquote></blockquote> | ||
+ | <section id="two" class="wrapper style2"> | ||
+ | <div class="inner"> | ||
+ | <div> | ||
+ | <div> | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2>Inserting expression vector </h2> | ||
+ | </header> | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2>Choosing prokaryotic expression vector (pET-28a)</h2> | ||
+ | </header> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </section> | ||
+ | <blockquote></blockquote> | ||
+ | |||
+ | |||
+ | <section id="two" class="wrapper style2"> | ||
+ | <div class="inner"> | ||
+ | <div> | ||
+ | <div> | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2>Designing primers and restriction sites </h2> | ||
+ | </header> | ||
+ | <p style="color:black;font-size:35px;"> | ||
+ | Chitin deacetylase 1 p5 GGATCCATGGCAAGAGTAAGATGCGG<br> | ||
+ | Chitin deacetylase 1 p3 AAGCTTTTAGAATCCCTCGCCC<br> | ||
+ | <br> | ||
+ | LOC108681649 p5 GGATCCATGCTGATGCATGTAGCCATC<br> | ||
+ | LOC108681649 p3 AAGCTTTTATATAATTTCCACGCCATCC<br> | ||
+ | <br> | ||
+ | LOC 108681651 p5 GGATCCATGTCTAGATTAAGATTCGTCC<br> | ||
+ | LOC 108681651 p3 AAGCTTTTAGAATAGTCCATCACCATTGG<br> | ||
+ | <br> | ||
+ | Verm p5 CGCGGATCCATGCTGACCGTTGAT<br> | ||
+ | Verm p3 GATTCGTGGTAGCTGAAGTTGCACTGGTC<br> | ||
+ | <br> | ||
+ | ChinB p5 CTTCAGCTACACCACGAATCCGGGTGTTAGC<br> | ||
+ | ChinB p3 CCGGAATTCCTACTGGAGTTGCCAC<br> | ||
+ | <br> | ||
+ | The restriction enzyme cutting sites of our experiment are BamH I (198) and Hind III (173)<br> | ||
+ | </p> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </section> | ||
+ | <section id="two" class="wrapper style2"> | ||
+ | <div class="inner"> | ||
+ | <div> | ||
+ | <div> | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2>Transfection </h2> | ||
+ | </header> | ||
+ | <p style="color:black;font-size:35px;"> | ||
+ | The plasmid was diluted 1000-fold and 10000-fold, and the competent bacteria BL-21 was added for 30 minutes in an ice bath. Then we heated the bacteria at 42 degrees for one minute, and ice-bathed for five more minutes. After that, we added 400 ml of LB without Kana antibiotic and shook the bacterial fluid. Finally, the bacteria were sprayed on a petri dish with kana antibiotics. | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2>Bacterial Fluid PCR to filter positive clones</h2> | ||
+ | </header> | ||
+ | <p style="color:black;font-size:35px;">To insure the plasmids were successfully transfected, we conducted bacterial fluid PCR. | ||
+ | Our groupmates take ten 1.5 ml EP tubes, add 200 μl of kana resistant medium separately, directly draw a single clone with a small pipette tip and push the TIP directly into an EP tube. We covered the EP tube and shake the bacteria at 37 degrees for 2-3 hours. Then 1μl of the bacterial solution was used as a template to identify the PCR positive clone. DNA gel electrophoresis was used to see if there was a target strip to judge. | ||
+ | </p> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </section> | ||
+ | |||
+ | <section id="two" class="wrapper style2"> | ||
+ | <div class="inner"> | ||
+ | <div> | ||
+ | <div> | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2>Inducing Expression </h2> | ||
+ | </header> | ||
+ | <p style="color:black;font-size:35px;"> | ||
+ | We set up various conditions to discover the most effecient condition. In total, we induced the sample in 180 different conditions. The samples are divided into different groups- the experiment group and the control group | ||
+ | |||
+ | </p> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </section> | ||
+ | |||
+ | |||
+ | |||
+ | <!-- One --> | ||
+ | <section id="One" class="wrapper style3" background=""> | ||
+ | <div class="inner"> | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2018/e/ed/T--SDSZ_China--6.jpeg" class="rounded mx-auto d-block" alt="..." width="100%" height="100%" style="Padding:0px"> | ||
+ | <!--<h2>MODULES</h2>--> | ||
+ | </header> | ||
+ | </div> | ||
+ | </section> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | <!-- One --> | ||
+ | <section id="One" class="wrapper style3" background=""> | ||
+ | <div class="inner"> | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <img src="https://static.igem.org/mediawiki/2018/7/7f/T--SDSZ_China--9.jpeg" class="rounded mx-auto d-block" alt="..." width="100%" height="100%" style="Padding:0px"> | ||
+ | <!--<h2>MODULES</h2>--> | ||
+ | </header> | ||
+ | </div> | ||
+ | </section> | ||
+ | <section id="two" class="wrapper style2"> | ||
+ | <div class="inner"> | ||
+ | <div> | ||
+ | <div> | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2>Detecting Ability </h2> | ||
+ | </header> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2>Page electrophoresis </h2> | ||
+ | </header> | ||
+ | <p style="color:black;font-size:35px;"> | ||
+ | |||
+ | When the bacteria were induced, the page electrophoresis is necessary to identify whether the protein could be expressed successfully or not. | ||
+ | </p> | ||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2>Measuring Enzyme Abilities </h2> | ||
+ | </header> | ||
+ | <p style="color:black;font-size:35px;"> | ||
+ | We add 1 mL 200 m g / L of substrate to a clean test tube, 3mL 0.05 mol / L phosphate buffer , 3 min 50 ° C water bath temperature protection Min, and add 1 mL enzyme solution, mix and heat in 50 degrees water 15 min. After that, we used boiling water to terminate the enzymatic reaction, and add water to a volume of 10 mL. Evenly, the solution was centrifuged at 3000r /min for 10 min. Measure the OD value of the upper clear. | ||
+ | Definition of enzyme unit: The amount of enzyme required to produce 1 gram of p-nitroaniline per hour under the above reaction conditions is defined as 1 enzyme activity ( U /mL ). | ||
+ | </p> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </section> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | <section id="two" class="wrapper style2"> | ||
+ | <div class="inner"> | ||
+ | <div> | ||
+ | <div> | ||
+ | |||
+ | <header class="align-center"> | ||
+ | |||
+ | <h2>References </h2> | ||
+ | </header> | ||
+ | <p style="color:black;font-size:35px;"> | ||
+ | |||
+ | Ding Guowei. Molecular characteristics and functional analysis of chitin deacetylase genes inOxya chinensis(Orthoptera:Acrididae). MS thesis. university of Shan Xi, 2015. | ||
+ | Tokuyasu, Ken, Mayumi Ohnishi-Kameyama, and Kiyoshi Hayashi. "Purification and characterization of extracellular chitin deacetylase from Colletotrichum lindemuthianum." Bioscience, biotechnology, and biochemistry 60.10 (1996): 1598-1603. | ||
+ | ElMekawy, Ahmed, et al. "Kinetic properties and role of bacterial chitin deacetylase in the bioconversion of chitin to chitosan." Recent patents on biotechnology 7.3 (2013): 234-241. | ||
+ | |||
+ | |||
+ | </p> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </section> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
− | + | <!-- Scripts --> | |
</body> | </body> | ||
</html> | </html> | ||
{{ SDSZ_China/footer }} | {{ SDSZ_China/footer }} |
Latest revision as of 18:56, 17 October 2018