Difference between revisions of "Team:SDSZ China/Experiment A"

 
(7 intermediate revisions by 2 users not shown)
Line 25: Line 25:
 
  <body>
 
  <body>
  
−
<!-- One -->
 
−
  <section id="One" class="wrapper style3" background="">
 
−
    <div class="inner">
 
−
      <header class="align-center">
 
  
−
<img src="https://static.igem.org/mediawiki/2018/9/9f/T--SDSZ_China--chitin.jpg" class="rounded mx-auto d-block" alt="..." width="100%" height="100%" style="Padding:0px">
 
−
      <!--<h2>MODULES</h2>-->
 
−
      </header>
 
−
    </div>
 
−
    </section>
 
−
 
−
 
−
  <blockquote></blockquote>
 
  
  
Line 257: Line 245:
 
     </div>
 
     </div>
 
   </section>
 
   </section>
−
    
+
   <section id="two" class="wrapper style2">
 +
    <div class="inner">
 +
    <div>
 +
      <div>
 +
      <header class="align-center">
 +
       
 +
        <h2>Transfection </h2>
 +
      </header>
 +
  <p style="color:black;font-size:35px;">
 +
The plasmid was diluted 1000-fold and 10000-fold, and the competent bacteria BL-21 was added for 30 minutes in an ice bath. Then we heated the bacteria at 42 degrees for one minute, and ice-bathed for five more minutes. After that, we added 400 ml of LB without Kana antibiotic and shook the bacterial fluid. Finally, the bacteria were sprayed on a petri dish with kana antibiotics.
 +
<header class="align-center">
 +
       
 +
        <h2>Bacterial Fluid PCR to filter positive clones</h2>
 +
      </header>
 +
  <p style="color:black;font-size:35px;">To insure the plasmids were successfully transfected, we conducted bacterial fluid PCR.
 +
Our groupmates take ten 1.5 ml EP tubes, add 200 μl of kana resistant medium separately, directly draw a single clone with a small pipette tip and push the TIP directly into an EP tube. We covered the EP tube and shake the bacteria at 37 degrees for 2-3 hours. Then 1μl of the bacterial solution was used as a template to identify the PCR positive clone. DNA gel electrophoresis was used to see if there was a target strip to judge.
 +
</p>
 +
 
 +
</div>
 +
    </div>
 +
    </div>
 +
  </section>
 +
 
 +
<section id="two" class="wrapper style2">
 +
    <div class="inner">
 +
    <div>
 +
      <div>
 +
      <header class="align-center">
 +
       
 +
        <h2>Inducing Expression </h2>
 +
      </header>
 +
  <p style="color:black;font-size:35px;">
 +
We set up various conditions to discover the most effecient condition. In total, we induced the sample in 180 different conditions.  The samples are divided into different groups- the experiment group and the control group
 +
 
 +
</p>
 +
 
 +
</div>
 +
    </div>
 +
    </div>
 +
  </section>
 +
 
 +
 
 +
 
 +
<!-- One -->
 +
  <section id="One" class="wrapper style3" background="">
 +
    <div class="inner">
 +
      <header class="align-center">
 +
 
 +
<img src="https://static.igem.org/mediawiki/2018/e/ed/T--SDSZ_China--6.jpeg" class="rounded mx-auto d-block" alt="..." width="100%" height="100%" style="Padding:0px">
 +
      <!--<h2>MODULES</h2>-->
 +
      </header>
 +
    </div>
 +
    </section>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<!-- One -->
 +
  <section id="One" class="wrapper style3" background="">
 +
    <div class="inner">
 +
      <header class="align-center">
 +
 
 +
<img src="https://static.igem.org/mediawiki/2018/7/7f/T--SDSZ_China--9.jpeg" class="rounded mx-auto d-block" alt="..." width="100%" height="100%" style="Padding:0px">
 +
      <!--<h2>MODULES</h2>-->
 +
      </header>
 +
    </div>
 +
    </section>
 +
<section id="two" class="wrapper style2">
 +
    <div class="inner">
 +
    <div>
 +
      <div>
 +
      <header class="align-center">
 +
       
 +
        <h2>Detecting Ability </h2>
 +
      </header>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<header class="align-center">
 +
       
 +
        <h2>Page electrophoresis </h2>
 +
      </header>
 +
<p style="color:black;font-size:35px;">
 +
 
 +
When the bacteria were induced, the page electrophoresis is necessary to identify whether the protein could be expressed successfully or not. 
 +
</p>
 +
<header class="align-center">
 +
       
 +
        <h2>Measuring Enzyme Abilities </h2>
 +
      </header>
 +
<p style="color:black;font-size:35px;">
 +
We add 1 mL 200 m g / L of substrate to a clean test tube, 3mL 0.05 mol / L phosphate buffer , 3 min 50 ° C water bath temperature protection Min, and add 1 mL enzyme solution, mix and heat in 50 degrees water 15 min. After that, we used boiling water to terminate the enzymatic reaction, and add water to a volume of 10 mL. Evenly, the solution was centrifuged at 3000r /min for 10 min. Measure the OD value of the upper clear.
 +
Definition of enzyme unit: The amount of enzyme required to produce 1 gram of p-nitroaniline per hour under the above reaction conditions is defined as 1 enzyme activity  ( U /mL ).
 +
</p>
 +
</div>
 +
    </div>
 +
    </div>
 +
  </section>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
<section id="two" class="wrapper style2">
 +
    <div class="inner">
 +
    <div>
 +
      <div>
 +
     
 +
      <header class="align-center">
 +
       
 +
        <h2>References </h2>
 +
      </header>
 +
<p style="color:black;font-size:35px;">
 +
 
 +
Ding Guowei. Molecular characteristics and functional analysis of chitin deacetylase genes inOxya chinensis(Orthoptera:Acrididae). MS thesis. university of Shan Xi, 2015.
 +
Tokuyasu, Ken, Mayumi Ohnishi-Kameyama, and Kiyoshi Hayashi. "Purification and characterization of extracellular chitin deacetylase from Colletotrichum lindemuthianum." Bioscience, biotechnology, and biochemistry 60.10 (1996): 1598-1603.
 +
ElMekawy, Ahmed, et al. "Kinetic properties and role of bacterial chitin deacetylase in the bioconversion of chitin to chitosan." Recent patents on biotechnology 7.3 (2013): 234-241.
 +
 
 +
 
 +
</p>
 +
</div>
 +
    </div>
 +
    </div>
 +
  </section>
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
  
 
<!-- Scripts -->
 
<!-- Scripts -->

Latest revision as of 18:56, 17 October 2018

iGem SDSZ_China 2018

Obtaining Genes

Both fungal and bacterial acetylases have three functional domains- a deacetylase domain, a chitin binding zone, and a low density lipoprotein receptor region. By using the bioinformatics BLAST technique, a sequence highly conserved with known deacetylase domain sequences was searched in the NCBI soft armor gene database. 

chitin deacetylase 1 [Penaeus monodon]  

1 atggcaagag taagatgcgg tagttctctt gccctccttg gcattgtgct gccgagcggg
       61 tcaagaggca ggcagtttca gacacgaccg aggatggagc gaaccttcaa gagggaactg
      121 tgcaaggata agggcgccgg cgagtggttc cgtctcagcc tcggtgactg tcgcgatgtg
      181 atccagtgta ccgacgccgg tcttcaggcg ctgcgttgcc cccacggcct ggccttcaac
      241 ctggagcagc agacctgcga ctggaaagcc aacgtcaaga actgcgacag gaaggagaag
      301 acgaaggtcg tgaagcctct cttcaacacc gtcgagcccc tttgccagga aaaccagttg
      361 gcgtgcggtg acggcacctg tctggatagg caggtcttct gtgatggaaa agaagattgt
      421 accgatggtt ctgacgagac cgcatgtgac gtgaaaaatg accccaacag cgctcccatc
      481 tgcaacaccg aggactgccg cctccccgat tgctactgct acaacgaccc tagcgagatg
      541 ccccacaaca tgaagccttc cgaagtgcct cagatggtca ccatcacttt cgacgatgcc
      601 atcaacatca acaacatgga cctgtacgag ctcatcttca agcagcgctt caaccccaac
      661 ggctgctcca tcaagtccac cttcttcgtt tctcacaaat acaacaacta caccgccact
      721 caggagatgc accgtctggg tcacgagatc gctgttcact ccatcaccca cgcaaacaac
      781 gagactttct ggtcccacgc aagcgaagac gagtacgagc gcgaaatggg tggtgcccgc
      841 gtcatcatcg aacgcttcgc caacatcacc gaccagtcca tcatcggcat gcgtaatccc
      901 ttcctccgtg tgggcggcaa cagccagttc aggatgatgg agaagaacac cttcctgtac
      961 gactccacca tcactgcccc cctgtcctcc atgcccctgt ggccctacac cctgtactac
     1021 cgcatgcccc acccctgcca tggaaacctc cagaactgcc ccactcgctc cttcgcagtg
     1081 tgggagatgg tcatgaacga gatggaccgt cgcgaggaac ccacttacga ggacggcctc
     1141 cccggatgcc acatggtcga ttcctgcttc gccaccaagc ccgagcccga gcagttctac
     1201 aacttcctgc agaacaactt caaccgccac tacaagtcaa accgcgctcc cttcggtctg
     1261 ttcttccact ctgccttcct gaagaacaac cccgacatcc tggacacctt cctctactgg
     1321 ctggacgaga ccctgaagaa ccagaaggac gtttacttcg tcaccatgac ccaggtcatc
     1381 cagtggatgc aggacccccg ccccgtcggc cagctgaaca actacgaggc ctggaaggag
     1441 aagtgcgtcg tcgacggccc acccttctgc tacggcggca acaactgcga gctggacact
     1501 gacgagctcc ctggccagac cctccacctg tccacctgca tgcggtgccc caacaattat
  1561 ccctggacaa gggacccatt gggcgaggga ttcttctaa

PREDICTED: uncharacterized protein LOC108681649 [Hyalella azteca]  

1 atgctgatgc atgtagccat catgctcatg ctgctggatc agcacgctca aggttcagag
       61 cggcaccccc ggcagagcag caacgccacc accacagagc agctctgcag aggccgcgac
      121 tctgaggagt acttcagact ctctgccggc gacgactgca gagacgttgt tagatgtgac
      181 cgcagtggac gctctggccc cagccgcctg gccgcagtgc ggtgccccaa cggcctcgcc
      241 ttcgacgtcg acagacaagt ctgtgactgg aagaccaaag tccgcaactg cgacagactt
      301 gagagaccgc ggaagattaa gccgctgctg gtgacggagg agccgctgtg ctcggggacg
      361 gacctggcgt gcggcagcgg cgtgtgtgtc gccaaggagc tcttctgtga tggcaaacct
      421 gactgtgatg acggttccga cgagaacacg tgtggtgtgg aagaagatcc aaaccgagcc
      481 caggtgtgcg acaaaagtca atgcgttttg ccagaatgtt tctgttccgt ggacggcact
      541 agaattcctg gtgatatcaa cccaaaacaa acaccgcaaa tgatcaccat cacattttca
      601 ggagcaatca accttgataa tgtggatttg tacgatgaca tcttcaacgg ggaaagaaag
      661 aatcccaacg gttgtcaagt gaaagcaacg ttcttcacgt cgcacaagta caccaattac
      721 tccgcagttc aagaactaca caggaaaggc catgagatcg ctgtgttctc gatctcgaac
      781 aaagaaagtc gagactattg gtcccatgga acatacgacg actggcttgc tgaaatggct
      841 ggggccagac tcatcgtcga acgtttcgcc aatatcacag ataattccat cgtcgggtta
      901 cgagcgccct acctcagggt tggaggaaac gctcagttcg acatgatgaa cgatcagttc
      961 ttcttctacg acgcttcgat tacagcgcca ttggggaaac ttccgctatg gccgtacaca
     1021 ttgtacttca ggatgcctca caaatgtcac gggaacggcc aaaattgtcc atcacgctcc
     1081 caccccgtct gggaaatggt catgaacgaa atggacagaa gagacgaccc agagtttgac
     1141 gaaggactat ctgggtgtca ttacgtcgac tcctgcacca acatccggac tccaaagcaa
     1201 tttgcccatt tcctcgagca caacttcaga cgacactaca acacaaaccg tgcaccactc
     1261 ggcttgcatt tccacgcttc ttggctaaaa ggaaacaaaa attttaaaaa ggaactcatc
     1321 aatttcattc agtcaaaatc gggcaaccct gacgtgtatt tcgtgaccat gcttcaagtg
     1381 attcaatgga tgcaagcacc gaccgaagtg gcaggacttc gcgatttccc agaatggaag
     1441 gagaaatgcg acgtgcaagg tctgccattt tgctcattac caaacacttg cccggtgagg
     1501 acacgagaga ttcctgacga gactttgagt ttgttcacct gcatggactg cccccgcaac
     1561 tacccctggc tgctcgaccc taccggggat ggcgtggaaa ttatataa

PREDICTED: uncharacterized protein LOC108681651 [Hyalella azteca] 

1 atgtctagat taagattcgt ccttgtgcta ttgttcgcag cagcggcagt cttagctgag
       61 gagcgtgaga agcgacaggc agcggaggcc gaggcgacgg tagacgagga tgccgtggac
      121 gctttcacca gggagctgtg cgccagcaag ggcgcgcagg agtacttcag actcagcacg
      181 caggattgca gaaaagtcat ccagtgcaca gaagtcggtc tggagagtct agtgtgcccc
      241 cctagtcttg cattcgacct ggaactgcaa gcatgcaact ggaaggaaga ggtgaagaat
      301 tgtgccaaga ccaccaaaga caagaaagtc aggcctctca ctgccaccaa ggaccccttg
      361 tgcgagggcg gtaagctggc atgtggagac ggtgtgtgta tagcgaaaga gttgttctgc
      421 gacggcaagc ctgactgtgc cgataattca gatgagaact tttgcgacat caactcagat
      481 ccaaacagag ctcctcaatg taacaaggcc gaatgccagc tgccgaactg cttctgcatt
      541 aacaacccta atgagacccc caacaatatc gaccctaagg atgtaccaca gatgatcatg
      601 atcactttcg atgacgctgt caacaacaac aacgttgatc tctacgacct catcttcagt
      661 ggccgcgcaa atccaaatgg ctgtgacatc aaagccacat tcttcgtgtc gcataaatac
      721 acgaattaca ccgcagtcag cgaactacac cgcaaaggac acgaaatcgc cgtccactcc
      781 atcagtcaca acgattccgc taccttctgg acggaagcca ctgtccaaga ctggaccaac
      841 gaaatggcgg gagctcgaca gattgtcaat catttcgcca acatcactga taccacagtc
      901 gtgggcgtcc gcgctcctta ccttcgagtg ggaggaaaca accaattcct catgatggaa
      961 gagcaaggtt tcctctacga ttccaccatt gttgctcctt tggctgatgt gccactttgg
     1021 ccctatattt tgtactaccg tatgcctcat gagtgtcatg ggcacattca ggtttgccct
     1081 actcgggcat acgctgtttg ggaaatggtc atgaacgaaa tggaccgtcg tgaagaccct
     1141 cttcatgaag agcctcttcc tggttgcgct atggtggact cctgcttctc gaacaggccg
     1201 acaggcgatc aattttataa tttcttgaac aacaacttca accgccacta caactccaac
     1261 cgcgctccta tgggactctt tttccactct gctttcctca agaacaaccc tgagatcctg
     1321 gatgccttta cgttctggct cgacgaaatt cttagcactc acaaggacgt ctacttcgta
     1381 accatgactc aagctcttta ctggctccag gatattgttc caattagtca agttgctaac
     1441 ttcgagccct ggaaggataa gtgtgcagtc caaggccctc catcgtgcca gaacggagga
     1501 aataactgta aattggacac tgctgaactg cccggcgaaa ccgtacgcct gtctacctgc
     1561 atgccttgcc ccagcaggta cccctggttg ttggacccca atggtgatgg actattctaa

Verm 

1 atgctgaccg ttgatggagc agtgaacgac ctgaactatg aaacctacag cagcgtcttc
       61 cgccccgatc gcaccaaccc caatggctgc cctatccgag gcaccttctt tgtctcccat
      121 gagtacacca actaccagca gggggaggac ctctacagca gagggcacga gattgctgtt
      181 ggctccgtca gccgccgtgc cggtctagag gatgaagggg aagagtcctg gactggagag
      241 atggtgacaa tgcgagaaat tcttactaaa tttgctggag tgcgcactga ggatctgaag
      301 ggacagcgag gacctcacct caagcctggc agggaggctc agtatgaggt gctcagtgcc
      361 tatgggttca cttgggactc taccatcaac aaccctccca caaaacacct agtttggccc
      421 tactccctgg aatgcaagat gccccatgag tgccgagctg gttcctgccc cacacgatcc
      481 ttccccggag tgtgggagct gcctatgaac tcccacttca aggacaccag tttccaggga
      541 ggcttttgcc cttacctgga ccagtgcaac ttcagctact ag

Inserting expression vector 

Choosing prokaryotic expression vector (pET-28a)

Designing primers and restriction sites 

Chitin deacetylase 1 p5  GGATCCATGGCAAGAGTAAGATGCGG
Chitin deacetylase 1 p3  AAGCTTTTAGAATCCCTCGCCC

LOC108681649 p5  GGATCCATGCTGATGCATGTAGCCATC
LOC108681649 p3  AAGCTTTTATATAATTTCCACGCCATCC

LOC 108681651 p5  GGATCCATGTCTAGATTAAGATTCGTCC
LOC 108681651 p3  AAGCTTTTAGAATAGTCCATCACCATTGG

Verm p5  CGCGGATCCATGCTGACCGTTGAT
Verm p3  GATTCGTGGTAGCTGAAGTTGCACTGGTC

ChinB p5  CTTCAGCTACACCACGAATCCGGGTGTTAGC
ChinB p3  CCGGAATTCCTACTGGAGTTGCCAC

The restriction enzyme cutting sites of our experiment are BamH I (198) and Hind III (173)

Transfection 

The plasmid was diluted 1000-fold and 10000-fold, and the competent bacteria BL-21 was added for 30 minutes in an ice bath. Then we heated the bacteria at 42 degrees for one minute, and ice-bathed for five more minutes. After that, we added 400 ml of LB without Kana antibiotic and shook the bacterial fluid. Finally, the bacteria were sprayed on a petri dish with kana antibiotics.

Bacterial Fluid PCR to filter positive clones

To insure the plasmids were successfully transfected, we conducted bacterial fluid PCR. Our groupmates take ten 1.5 ml EP tubes, add 200 μl of kana resistant medium separately, directly draw a single clone with a small pipette tip and push the TIP directly into an EP tube. We covered the EP tube and shake the bacteria at 37 degrees for 2-3 hours. Then 1μl of the bacterial solution was used as a template to identify the PCR positive clone. DNA gel electrophoresis was used to see if there was a target strip to judge.

Inducing Expression 

We set up various conditions to discover the most effecient condition. In total, we induced the sample in 180 different conditions.  The samples are divided into different groups- the experiment group and the control group

...
...

Detecting Ability 

Page electrophoresis 

When the bacteria were induced, the page electrophoresis is necessary to identify whether the protein could be expressed successfully or not. 

Measuring Enzyme Abilities 

We add 1 mL 200 m g / L of substrate to a clean test tube, 3mL 0.05 mol / L phosphate buffer , 3 min 50 ° C water bath temperature protection Min, and add 1 mL enzyme solution, mix and heat in 50 degrees water 15 min. After that, we used boiling water to terminate the enzymatic reaction, and add water to a volume of 10 mL. Evenly, the solution was centrifuged at 3000r /min for 10 min. Measure the OD value of the upper clear. Definition of enzyme unit: The amount of enzyme required to produce 1 gram of p-nitroaniline per hour under the above reaction conditions is defined as 1 enzyme activity ( U /mL ).

References 

Ding Guowei. Molecular characteristics and functional analysis of chitin deacetylase genes inOxya chinensis(Orthoptera:Acrididae). MS thesis. university of Shan Xi, 2015. Tokuyasu, Ken, Mayumi Ohnishi-Kameyama, and Kiyoshi Hayashi. "Purification and characterization of extracellular chitin deacetylase from Colletotrichum lindemuthianum." Bioscience, biotechnology, and biochemistry 60.10 (1996): 1598-1603. ElMekawy, Ahmed, et al. "Kinetic properties and role of bacterial chitin deacetylase in the bioconversion of chitin to chitosan." Recent patents on biotechnology 7.3 (2013): 234-241.

©SDSZ_China 2018. All rights reserved.