Difference between revisions of "Team:OUC-China/Parts"

 
(31 intermediate revisions by 2 users not shown)
Line 11: Line 11:
 
<style>
 
<style>
  
 +
#bodyContent{
 +
margin:0;
 +
padding:0;   
 +
position:absolute;
 +
top:0 !important;
 +
width:100%;
 +
}
 +
 +
#class td /*设置表格文字左右和上下居中对齐*/
 +
 +
    vertical-align: middle;
 +
    text-align: center; 
 +
}
  
 
.copyright1 {
 
.copyright1 {
Line 22: Line 35:
 
letter-spacing: 2px;
 
letter-spacing: 2px;
 
border-top-width: 2px;
 
border-top-width: 2px;
 +
        position:absolute;
 +
        bottom: 0;
 +
        width:100%
 
}
 
}
  
 
+
 +
.nb{
 +
background-color:#F7F7F7;
 +
}
 +
 +
 +
.sk{
 +
width:1000px;
 +
padding:0px 50px 0px 50px;
 +
    margin-left: auto;
 +
    margin-right: auto;
 +
background-color:white;
 +
}
 +
  
  
Line 30: Line 59:
 
   display: none;
 
   display: none;
 
   position: fixed;
 
   position: fixed;
   bottom: 20px;
+
   bottom: 5px;
 
   right: 30px;
 
   right: 30px;
 
   z-index: 99;
 
   z-index: 99;
Line 45: Line 74:
 
   background-color: #555;
 
   background-color: #555;
 
}
 
}
 +
 +
 
</style>
 
</style>
  
Line 78: Line 109:
 
</ul>
 
</ul>
 
</li>
 
</li>
<li><a href="https://2018.igem.org/Team:OUC-China/Model">Model</a>
+
<li><a href="#">Model</a>
 +
                                                <ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Model">Overview</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/miniToe">miniToe</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/miniToe Family">miniToe Family</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/polycistron">polycistron</a></li>
 +
</ul>
 
</li>
 
</li>
<li><a href="https://2018.igem.org/Team:OUC-China/Parts">Parts</a>
+
  <li><a href="#">Parts</a>
 +
<ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Parts">List</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Improve">Improve</a></li>
 +
</ul>
 
</li>
 
</li>
<li><a href="#">Human_Practices</a>
+
<li><a href="#">HP</a>
 
<ul>
 
<ul>
<li><a href="https://2018.igem.org/Team:OUC-China/Human_Practices">Human_Practices</a></li>
+
<li><a href="https://2018.igem.org/Team:OUC-China/Human_Practices">Human Practices</a></li>
<li><a href="https://2018.igem.org/Team:OUC-China/Public_Engagement">Public_Engagement</a></li>
+
<li><a href="https://2018.igem.org/Team:OUC-China/Public_Engagement">Public Engagement</a></li>
 
</ul>
 
</ul>
 
</li>
 
</li>
 
<li><a href="#">Team</a>
 
<li><a href="#">Team</a>
 
<ul>
 
<ul>
<li><a href="https://2018.igem.org/Team:OUC-China/Team">Team_Member</a></li>
+
<li><a href="https://2018.igem.org/Team:OUC-China/Team">Team Member</a></li>
 
<li><a href="https://2018.igem.org/Team:OUC-China/Collaborations">Collaborations</a></li>
 
<li><a href="https://2018.igem.org/Team:OUC-China/Collaborations">Collaborations</a></li>
 
<li><a href="https://2018.igem.org/Team:OUC-China/Attributions">Attributions</a></li>
 
<li><a href="https://2018.igem.org/Team:OUC-China/Attributions">Attributions</a></li>
Line 102: Line 143:
 
<!-- Banner -->
 
<!-- Banner -->
 
 
<img src="https://static.igem.org/mediawiki/2018/7/71/T--OUC-China--project.jpg"alt="banner"width="100%">
+
<img src="https://static.igem.org/mediawiki/2018/f/fe/T--OUC-China--partlist.jpg"width="100%">
 
 
 
</div>
 
</div>
 
<!-- Main -->
 
<!-- Main -->
<div id="main" class="container">
+
<div class="nb">
 
 
 
 
 
 
<div class="12u">
+
<div class="sk">
  
 
<!-- Features -->
 
<!-- Features -->
 
<section class="box features">
 
<section class="box features">
<h2 class="major"><span>MEMBER'S ATTRIBUTION</span></h2>
 
 
<p align="justify">
 
  
&emsp;&emsp;From the beginning of 2018, OUC-China have brand new members for this competition season. With the help of experienced team leaders before, we build a team consists of 8 undergraduate students from different majors and two grades. And by sharing happiness and woe this season, now we become close friends and have the tacit understanding. All the members in 2018 OUC-China devoted the best of themselves to develop the project. At the same time, we would have gone nowhere without the help from many other people from our school, other institutions and the society. We sincerely appreciate all the help!
 
 
 
<br />&emsp;&emsp;Yunqian Zhang, captain of OUC-China iGEM 2018 and general affair supervisor, was responsible for designing our project and experiment. She designed and checked all the circuit as well as the primers used in PCR and part standardization. She provided basic experimental scheme for lab administrator. She was responsible for construct and test by microplate reader of polycistron circuit. Also she arranged journals for all people to CCiC and Boston.
 
  
<br />&emsp;&emsp;Yanju Chen, vice-captain of our team, pushed the preceding of human practice and communication with other teams. She keep connection with all the professors who helped us. She is also responsible for submitting parts and document the experimental characterization. Also she arranged journals for all people to Beijing.
+
<h2 class="major"><span>Parts</span></h2>
  
<br />&emsp;&emsp;Jiacheng Huang, vice-captain of our team. He selected all the csy4 mutants and hairpin mutants to meet our goal. He was in charge of modeling and excavated deeply in theory who also is one of wiki designer.
+
<p align="justify">
 +
<h3>Silver part: Designing a new part</h3>
  
<br />&emsp;&emsp;Qinbo Qiao, lab administrator and arranged the journal to get visa. Her major work was part standardization and extracted a mount of DNA.
+
<br />This year, we design a basic part called miniToe, which consists of RBS, Csy4 recognition site (hairpin) and cis-repressive RNA element. As a regulatory element, it can be specifically recognized and cleaved by Csy4 to regulate the expression of its downstream genes on the RNA level. MiniToe is the key of our project, is RFC10  compatible and works as expected. We have documented its experimental characterization on Part's Main Page on the Registry and submitted the sample to the Registry. Certainly, this part is different from the new part documented for Gold#2. See the page for more details:<a href="http://parts.igem.org/Part:BBa_K2615020"> parts.igem.org/Part:BBa_K2615020</a>
 +
<br /><br />
 +
At the same time, the Csy4 (BBa_K2615003) is one of the key role in our system. We also submitted it to registry. We also apply miniToe to polycistron to create miniToe polycistron (BBa_K2615019).
 +
<br /><br />
 +
<h3>Gold parts: Improving an existing part</h3>
 +
Improving an existing Part Standardization and building up on existing parts are the fundaments of iGEM. We have created FOUR new BioBrick Part (BBa_K2615004, BBa_K2615005, BBa_K2615006, BBa_K2615007) that has a functional improvement upon an existing BioBrick Part (BBa_K1062004). The sequences of four new parts and existing part are different, and the new parts are changed by point mutation. We have showed experiments with both parts to demonstrate this improvement.
 +
<br /><br />See the pages below for details:
 +
<br />The existing part
 +
<br /><a href="http://parts.igem.org/Part:BBa_K1062004">parts.igem.org/Part:BBa_K1062004:Experience</a>
 +
<br /><br />
 +
The four improved parts
 +
<br /><a href="http://parts.igem.org/Part:BBa_K2615004">parts.igem.org/Part:BBa_K2615004</a>
 +
<br /><a href="http://parts.igem.org/Part:BBa_K2615005">parts.igem.org/Part:BBa_K2615005</a>
 +
<br /><a href="http://parts.igem.org/Part:BBa_K2615006">parts.igem.org/Part:BBa_K2615006</a>
 +
<br /><a href="http://parts.igem.org/Part:BBa_K2615007">parts.igem.org/Part:BBa_K2615007</a>
 +
<div id="class" align="center" style= "margin: 0cm 0cm 0pt; text-align: left"> 
 +
 +
<table width="200" border="1">
 +
  <tbody>
 +
    <tr>
 +
      <th scope="col">Part number</th>
 +
      <th scope="col">Type</th>
 +
      <th scope="col">Description</th>
 +
      <th scope="col">Designer</th>
 +
      <th scope="col">Length(bp)</th>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615003">BBa_K2615003</a></td>
 +
      <td>Translational_Unit</td>
 +
      <td>Made up of Csy4-WT and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4 can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. </td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>588</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615004">BBa_K2615004</a></td>
 +
      <td>Translational_Unit</td>
 +
      <td>Made up of Csy4-Q104A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Q104A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAG(encoding Gln) to GCG(encoding Ala) on the 104th site based on Csy4-WT. </td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>588</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615005">BBa_K2615005</a></td>
 +
      <td>Translational_Unit</td>
 +
      <td>Made up of Csy4-Y176F and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Y176F can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TAC(encoding Tyr) to TTT(encoding Phe) on the 176th site based on Csy4-WT. </td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>588</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615006">BBa_K2615006</a></td>
 +
      <td>Translational_Unit</td>
 +
      <td>Made up of Csy4-F155A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-F155A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TTC(encoding Phe) to GCG(encoding Ara) on the 155th site based on Csy4-WT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>588</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615007">BBa_K2615007</a></td>
 +
      <td>Translational_Unit</td>
 +
      <td>Made up of Csy4-H29A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-H29A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA.  And this part design by point mutation, we change the CAC(encoding His ) to GCG(encoding Ara) on the 29th site based on Csy4-WT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>588</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615008">BBa_K2615008</a></td>
 +
      <td>Device</td>
 +
      <td>This part is the miniToe family test system No.1, which consists of promoter J23119, miniToe-1 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>901</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615009">BBa_K2615009</a></td>
 +
      <td>Device</td>
 +
      <td>This part is the miniToe family test system No.2, which consists of promoter J23119, miniToe-2 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 +
      <td>Anyi Li</td>
 +
      <td>901</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615010">BBa_K2615010</a></td>
 +
      <td>Device</td>
 +
      <td>This part is the miniToe family test system No.3, which consists of promoter J23119, miniToe-3 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>901</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615011">BBa_K2615011</a></td>
 +
      <td>Device</td>
 +
      <td>This part is the miniToe family test system No.4, which consists of promoter J23119, miniToe-4 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>901</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615012">BBa_K2615012</a></td>
 +
      <td>Device</td>
 +
      <td>This part is the miniToe family test system No.5, which consists of promoter J23119, miniToe-5 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 +
      <td> Anyi Li </td>
 +
      <td>901</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615013">BBa_K2615013</a></td>
 +
      <td>Coding</td>
 +
      <td>Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>564</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615014">BBa_K2615014</a></td>
 +
      <td>Coding</td>
 +
      <td>Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 +
      <td>Anyi Li</td>
 +
      <td>564</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615015">BBa_K2615015</a></td>
 +
      <td>Coding</td>
 +
      <td>Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 +
      <td>Anyi Li</td>
 +
      <td>564</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615016">BBa_K2615016</a></td>
 +
      <td>Coding</td>
 +
      <td>Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 +
      <td>Anyi Li</td>
 +
      <td>564</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615017">BBa_K2615017</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-6, a member of miniToe family. We design it by point mutation.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>75</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615018">BBa_K2615018</a></td>
 +
      <td>Device</td>
 +
      <td>MiniToe polycistron A, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. </td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>1764</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615019">BBa_K2615019</a></td>
 +
      <td>Device</td>
 +
      <td>MiniToe polycistron B, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. </td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>1764</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615020">BBa_K2615020</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>68</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615021">BBa_K2615021</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615022">BBa_K2615022</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615023">BBa_K2615023</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615024">BBa_K2615024</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615025">BBa_K2615025</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615026">BBa_K2615026</a></td>
 +
      <td>Device</td>
 +
      <td>MiniToe-motA, a new system using miniToe, which consists of promoter J23119, miniToe and motA. The intensity of upstream regulatory element can be characterized by motility of bacteria.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>1084</td>
 +
    </tr>
 +
  </tbody>
 +
</table>
 +
</div>
 +
<br /><br /><br /><br /><br />
  
<br />&emsp;&emsp;Xudong Liu, lab administrator, was in charge of construct circuits by using 3A assembly and detected the expression of proteins. Also he was responsible for the measurement of the growth rate of E.coli, providing experimental limits for model. He changed our experimental scheme with need at any moment.
+
</p> </section>
 
+
<br />&emsp;&emsp;Qingjie Li, the financial manager of our team and designer for our Video Game——Csy4 Go! She was also responsible for our motA test system. She designed the experiment for this system and finished all the lab work for this part by herself. She helped us with a lot of biological order for biotechnology companies.
+
 
+
<br />&emsp;&emsp;Kai Sun, the web designer and art designer who established the structure of our wiki, poster, team uniform and many other designing works. At the same time, he also take the task of Interlab measurement and primers design.
+
 
+
<br />&emsp;&emsp;Anyi Li, was responsible for primers design and plan for human practice. At the same time, she test the second system which contain many Csy4 mutants and hairpin mutants by flow cytometry for 6 times. And she writed our notebook and took part in some lab work.</p>
+
</section>
+
  
 
</div>
 
</div>
Line 144: Line 370:
  
  
 
 
 
<div id="main" class="container">
 
 
 
 
<div class="12u">
 
 
<!-- Features -->
 
<section class="box features">
 
<h2 class="major"><span>Acknowledgement for support</span></h2>
 
 
<p align="justify">
 
 
&emsp;&emsp;Every member in 2017 OUC-China iGEM gave us practical suggestions.
 
<br />&emsp;&emsp;Yang Liu, the Captain of OUC-China 2011 and Li Kang, the Captain of OUC-China 2012 helped improve the synthetic conception of our project. 
 
<br />&emsp;&emsp;Our PI Prof. Chenguang Liu and Prof. Xingguo Liang offered us constructive advice over our project and gave us long-term technical consulting support through the procedure.
 
<br />&emsp;&emsp;Prof Chunbo Lou and Pei Du, from Institute of Microbiology, provided us with original idea by their work and also taught us with some details about experiment and lab work.
 
<br />&emsp;&emsp;Our PI Prof.Xingguo Liang offered us experimental lab.
 
<br />&emsp;&emsp;Our PI Prof.Zhe Chi helped us with gene synthesis and financial problems, at the same time, he also provided us with unique advice about project.
 
<br />&emsp;&emsp;Prof. Xiaohua Zhang, from College of Marine Life, Ocean University of China, provided us instrument (Thermo Scientific NanoDrop) to measure the concentration of nucleic acid. 
 
<br />&emsp;&emsp;Prof Mingzhuang Zhu and Wei Yang provided us the flow cytometry which was really helpful for our second system. </p>
 
</section>
 
 
</div>
 
</div>
 
  
  
Line 187: Line 386:
  
  
   <div class="copyright1">Contact Us : oucigem@163.com  | &copy;2018 OUC IGEM.All Rights Reserved.  |  Based On Dreamweaver </div>
+
   <div class="copyright1">Contact Us : oucigem@163.com  | &copy;2018 OUC IGEM.All Rights Reserved. <br />
 +
<img src="https://static.igem.org/mediawiki/2017/b/b4/T--OUC-China--foot1.jpeg"alt="banner"width="80px">
 +
<img src="https://static.igem.org/mediawiki/2017/6/62/T--OUC-China--foot2.jpeg"alt="banner"width="80px">
 +
<img src="https://static.igem.org/mediawiki/2018/f/f3/T--OUC-China--lalala.png"alt="banner"width="80px">
 +
<img src="https://static.igem.org/mediawiki/2017/5/51/T--OUC-China--NSG.png"alt="banner"height="65px">
 +
<img src="https://static.igem.org/mediawiki/2017/2/2a/T--OUC-China--ML.png"alt="banner"height="65px">&emsp;
 +
  </div>
 
 
  
Line 214: Line 419:
  
 
</html>
 
</html>
<groupparts>iGEM18 OUC-China</groupparts>
 

Latest revision as of 19:31, 17 October 2018

Team OUC-China: Main

Parts

Silver part: Designing a new part


This year, we design a basic part called miniToe, which consists of RBS, Csy4 recognition site (hairpin) and cis-repressive RNA element. As a regulatory element, it can be specifically recognized and cleaved by Csy4 to regulate the expression of its downstream genes on the RNA level. MiniToe is the key of our project, is RFC10 compatible and works as expected. We have documented its experimental characterization on Part's Main Page on the Registry and submitted the sample to the Registry. Certainly, this part is different from the new part documented for Gold#2. See the page for more details: parts.igem.org/Part:BBa_K2615020

At the same time, the Csy4 (BBa_K2615003) is one of the key role in our system. We also submitted it to registry. We also apply miniToe to polycistron to create miniToe polycistron (BBa_K2615019).

Gold parts: Improving an existing part

Improving an existing Part Standardization and building up on existing parts are the fundaments of iGEM. We have created FOUR new BioBrick Part (BBa_K2615004, BBa_K2615005, BBa_K2615006, BBa_K2615007) that has a functional improvement upon an existing BioBrick Part (BBa_K1062004). The sequences of four new parts and existing part are different, and the new parts are changed by point mutation. We have showed experiments with both parts to demonstrate this improvement.

See the pages below for details:
The existing part
parts.igem.org/Part:BBa_K1062004:Experience

The four improved parts
parts.igem.org/Part:BBa_K2615004
parts.igem.org/Part:BBa_K2615005
parts.igem.org/Part:BBa_K2615006
parts.igem.org/Part:BBa_K2615007
Part number Type Description Designer Length(bp)
BBa_K2615003 Translational_Unit Made up of Csy4-WT and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4 can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. Yunqian Zhang 588
BBa_K2615004 Translational_Unit Made up of Csy4-Q104A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Q104A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAG(encoding Gln) to GCG(encoding Ala) on the 104th site based on Csy4-WT. Yunqian Zhang 588
BBa_K2615005 Translational_Unit Made up of Csy4-Y176F and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Y176F can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TAC(encoding Tyr) to TTT(encoding Phe) on the 176th site based on Csy4-WT. Yunqian Zhang 588
BBa_K2615006 Translational_Unit Made up of Csy4-F155A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-F155A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TTC(encoding Phe) to GCG(encoding Ara) on the 155th site based on Csy4-WT. Anyi Li 588
BBa_K2615007 Translational_Unit Made up of Csy4-H29A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-H29A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAC(encoding His ) to GCG(encoding Ara) on the 29th site based on Csy4-WT. Anyi Li 588
BBa_K2615008 Device This part is the miniToe family test system No.1, which consists of promoter J23119, miniToe-1 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Yunqian Zhang 901
BBa_K2615009 Device This part is the miniToe family test system No.2, which consists of promoter J23119, miniToe-2 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Anyi Li 901
BBa_K2615010 Device This part is the miniToe family test system No.3, which consists of promoter J23119, miniToe-3 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Yunqian Zhang 901
BBa_K2615011 Device This part is the miniToe family test system No.4, which consists of promoter J23119, miniToe-4 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Yunqian Zhang 901
BBa_K2615012 Device This part is the miniToe family test system No.5, which consists of promoter J23119, miniToe-5 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Anyi Li 901
BBa_K2615013 Coding Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Yunqian Zhang 564
BBa_K2615014 Coding Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615015 Coding Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615016 Coding Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615017 Regulatory MiniToe-6, a member of miniToe family. We design it by point mutation. Yunqian Zhang 75
BBa_K2615018 Device MiniToe polycistron A, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. Yunqian Zhang 1764
BBa_K2615019 Device MiniToe polycistron B, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. Yunqian Zhang 1764
BBa_K2615020 Regulatory MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. Yunqian Zhang 68
BBa_K2615021 Regulatory MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT. Anyi Li 74
BBa_K2615022 Regulatory MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT. Anyi Li 74
BBa_K2615023 Regulatory MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT. Anyi Li 74
BBa_K2615024 Regulatory MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT. Anyi Li 74
BBa_K2615025 Regulatory MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT. Yunqian Zhang 74
BBa_K2615026 Device MiniToe-motA, a new system using miniToe, which consists of promoter J23119, miniToe and motA. The intensity of upstream regulatory element can be characterized by motility of bacteria. Yunqian Zhang 1084





Contact Us : oucigem@163.com | ©2018 OUC IGEM.All Rights Reserved.
banner banner banner banner banner