(2 intermediate revisions by 2 users not shown) | |||
Line 161: | Line 161: | ||
<p align="justify"> | <p align="justify"> | ||
<h3>Silver part: Designing a new part</h3> | <h3>Silver part: Designing a new part</h3> | ||
− | + | ||
− | + | <br />This year, we design a basic part called miniToe, which consists of RBS, Csy4 recognition site (hairpin) and cis-repressive RNA element. As a regulatory element, it can be specifically recognized and cleaved by Csy4 to regulate the expression of its downstream genes on the RNA level. MiniToe is the key of our project, is RFC10 compatible and works as expected. We have documented its experimental characterization on Part's Main Page on the Registry and submitted the sample to the Registry. Certainly, this part is different from the new part documented for Gold#2. See the page for more details:<a href="http://parts.igem.org/Part:BBa_K2615020"> parts.igem.org/Part:BBa_K2615020</a> | |
<br /><br /> | <br /><br /> | ||
At the same time, the Csy4 (BBa_K2615003) is one of the key role in our system. We also submitted it to registry. We also apply miniToe to polycistron to create miniToe polycistron (BBa_K2615019). | At the same time, the Csy4 (BBa_K2615003) is one of the key role in our system. We also submitted it to registry. We also apply miniToe to polycistron to create miniToe polycistron (BBa_K2615019). | ||
Line 170: | Line 170: | ||
<br /><br />See the pages below for details: | <br /><br />See the pages below for details: | ||
<br />The existing part | <br />The existing part | ||
− | <br /><a href="http://parts.igem.org/Part:BBa_K1062004 | + | <br /><a href="http://parts.igem.org/Part:BBa_K1062004">parts.igem.org/Part:BBa_K1062004:Experience</a> |
<br /><br /> | <br /><br /> | ||
The four improved parts | The four improved parts | ||
Line 359: | Line 359: | ||
</table> | </table> | ||
</div> | </div> | ||
− | <br /><br /><br /> | + | <br /><br /><br /><br /><br /> |
</p> </section> | </p> </section> |
Latest revision as of 19:31, 17 October 2018
Parts
Silver part: Designing a new part
This year, we design a basic part called miniToe, which consists of RBS, Csy4 recognition site (hairpin) and cis-repressive RNA element. As a regulatory element, it can be specifically recognized and cleaved by Csy4 to regulate the expression of its downstream genes on the RNA level. MiniToe is the key of our project, is RFC10 compatible and works as expected. We have documented its experimental characterization on Part's Main Page on the Registry and submitted the sample to the Registry. Certainly, this part is different from the new part documented for Gold#2. See the page for more details: parts.igem.org/Part:BBa_K2615020
At the same time, the Csy4 (BBa_K2615003) is one of the key role in our system. We also submitted it to registry. We also apply miniToe to polycistron to create miniToe polycistron (BBa_K2615019).
Gold parts: Improving an existing part
Improving an existing Part Standardization and building up on existing parts are the fundaments of iGEM. We have created FOUR new BioBrick Part (BBa_K2615004, BBa_K2615005, BBa_K2615006, BBa_K2615007) that has a functional improvement upon an existing BioBrick Part (BBa_K1062004). The sequences of four new parts and existing part are different, and the new parts are changed by point mutation. We have showed experiments with both parts to demonstrate this improvement.See the pages below for details:
The existing part
parts.igem.org/Part:BBa_K1062004:Experience
The four improved parts
parts.igem.org/Part:BBa_K2615004
parts.igem.org/Part:BBa_K2615005
parts.igem.org/Part:BBa_K2615006
parts.igem.org/Part:BBa_K2615007
Part number | Type | Description | Designer | Length(bp) |
---|---|---|---|---|
BBa_K2615003 | Translational_Unit | Made up of Csy4-WT and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4 can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. | Yunqian Zhang | 588 |
BBa_K2615004 | Translational_Unit | Made up of Csy4-Q104A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Q104A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAG(encoding Gln) to GCG(encoding Ala) on the 104th site based on Csy4-WT. | Yunqian Zhang | 588 |
BBa_K2615005 | Translational_Unit | Made up of Csy4-Y176F and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Y176F can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TAC(encoding Tyr) to TTT(encoding Phe) on the 176th site based on Csy4-WT. | Yunqian Zhang | 588 |
BBa_K2615006 | Translational_Unit | Made up of Csy4-F155A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-F155A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TTC(encoding Phe) to GCG(encoding Ara) on the 155th site based on Csy4-WT. | Anyi Li | 588 |
BBa_K2615007 | Translational_Unit | Made up of Csy4-H29A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-H29A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAC(encoding His ) to GCG(encoding Ara) on the 29th site based on Csy4-WT. | Anyi Li | 588 |
BBa_K2615008 | Device | This part is the miniToe family test system No.1, which consists of promoter J23119, miniToe-1 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. | Yunqian Zhang | 901 |
BBa_K2615009 | Device | This part is the miniToe family test system No.2, which consists of promoter J23119, miniToe-2 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. | Anyi Li | 901 |
BBa_K2615010 | Device | This part is the miniToe family test system No.3, which consists of promoter J23119, miniToe-3 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. | Yunqian Zhang | 901 |
BBa_K2615011 | Device | This part is the miniToe family test system No.4, which consists of promoter J23119, miniToe-4 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. | Yunqian Zhang | 901 |
BBa_K2615012 | Device | This part is the miniToe family test system No.5, which consists of promoter J23119, miniToe-5 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. | Anyi Li | 901 |
BBa_K2615013 | Coding | Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. | Yunqian Zhang | 564 |
BBa_K2615014 | Coding | Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. | Anyi Li | 564 |
BBa_K2615015 | Coding | Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. | Anyi Li | 564 |
BBa_K2615016 | Coding | Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. | Anyi Li | 564 |
BBa_K2615017 | Regulatory | MiniToe-6, a member of miniToe family. We design it by point mutation. | Yunqian Zhang | 75 |
BBa_K2615018 | Device | MiniToe polycistron A, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. | Yunqian Zhang | 1764 |
BBa_K2615019 | Device | MiniToe polycistron B, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. | Yunqian Zhang | 1764 |
BBa_K2615020 | Regulatory | MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. | Yunqian Zhang | 68 |
BBa_K2615021 | Regulatory | MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT. | Anyi Li | 74 |
BBa_K2615022 | Regulatory | MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT. | Anyi Li | 74 |
BBa_K2615023 | Regulatory | MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT. | Anyi Li | 74 |
BBa_K2615024 | Regulatory | MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT. | Anyi Li | 74 |
BBa_K2615025 | Regulatory | MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT. | Yunqian Zhang | 74 |
BBa_K2615026 | Device | MiniToe-motA, a new system using miniToe, which consists of promoter J23119, miniToe and motA. The intensity of upstream regulatory element can be characterized by motility of bacteria. | Yunqian Zhang | 1084 |
Contact Us : oucigem@163.com | ©2018 OUC IGEM.All Rights Reserved.