Difference between revisions of "Team:OUC-China/Parts"

(Prototype team page)
 
 
(34 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
{{OUC-China}}
 
{{OUC-China}}
 
<html>
 
<html>
 +
<head>
 +
<title>Team OUC-China: Main</title>
 +
<meta charset="utf-8" />
 +
<meta name="viewport" content="width=device-width, initial-scale=1" />
 +
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />
 +
<link rel="stylesheet" href="https://2018.igem.org/Team:OUC-China/CSS6?action=raw&ctype=text/css" />
  
 +
 +
<style>
  
−
<div class="column full_size">
+
#bodyContent{
−
<h1>Parts</h1>
+
margin:0;
−
<p>Each team will make new parts during iGEM and will submit them to the Registry of Standard Biological Parts. The iGEM software provides an easy way to present the parts your team has created. The <code>&lt;groupparts&gt;</code> tag (see below) will generate a table with all of the parts that your team adds to your team sandbox.</p>
+
padding:0;  
−
<p>Remember that the goal of proper part documentation is to describe and define a part, so that it can be used without needing to refer to the primary literature. Registry users in future years should be able to read your documentation and be able to use the part successfully. Also, you should provide proper references to acknowledge previous authors and to provide for users who wish to know more.</p>
+
position:absolute;
−
</div>
+
top:0 !important;
 +
width:100%;
 +
}
  
−
<div class="column full_size">
+
#class td /*设置表格文字左右和上下居中对齐*/
−
<div class="highlight decoration_background">
+
{ 
−
<h3>Note</h3>
+
    vertical-align: middle;
−
<p>Note that parts must be documented on the <a href="http://parts.igem.org/Main_Page"> Registry</a>. This page serves to <i>showcase</i> the parts you have made. Future teams and other users and are much more likely to find parts by looking in the Registry than by looking at your team wiki.</p>
+
    text-align: center; 
−
</div>
+
}
−
</div>
+
  
−
<div class="clear extra_space"></div>
+
.copyright1 {
−
<div class="line_divider"></div>
+
text-align: center;
−
<div class="clear extra_space"></div>
+
padding-top: 20px;
 +
padding-bottom: 20px;
 +
background-color: gray;
 +
color: #FFFFFF;
 +
text-transform: uppercase;
 +
font-weight: lighter;
 +
letter-spacing: 2px;
 +
border-top-width: 2px;
 +
        position:absolute;
 +
        bottom: 0;
 +
        width:100%
 +
}
  
 +
 +
.nb{
 +
background-color:#F7F7F7;
 +
}
 +
 +
 +
.sk{
 +
width:1000px;
 +
padding:0px 50px 0px 50px;
 +
    margin-left: auto;
 +
    margin-right: auto;
 +
background-color:white;
 +
}
 +
  
  
 +
#myBtn {
 +
  display: none;
 +
  position: fixed;
 +
  bottom: 5px;
 +
  right: 30px;
 +
  z-index: 99;
 +
  border: none;
 +
  outline: none;
 +
  background-color: gray;
 +
  color: white;
 +
  cursor: pointer;
 +
  padding: 15px;
 +
  border-radius: 10px;
 +
}
  
 +
#myBtn:hover {
 +
  background-color: #555;
 +
}
  
−
<div class="column two_thirds_size">
 
−
<div class="highlight decoration_B_full">
 
  
−
<h3>Adding parts to the registry</h3>
+
</style>
−
<p>You can add parts to the Registry at our <a href="http://parts.igem.org/Add_a_Part_to_the_Registry">Add a Part to the Registry</a> link.</p>
+
  
−
<p>We encourage teams to start completing documentation for their parts on the Registry as soon as you have it available. The sooner you put up your parts, the better you will remember all the details about your parts. Remember, you don't need to send us the DNA sample before you create an entry for a part on the Registry. (However, you <b>do</b> need to send us the DNA sample before the Jamboree. If you don't send us a DNA sample of a part, that part will not be eligible for awards and medal criteria.)</p>
 
−
<div class="button_link">
 
−
<a href="http://parts.igem.org/Add_a_Part_to_the_Registry">
 
−
ADD PARTS
 
−
</a>
 
−
</div>
 
  
−
</div>
 
−
</div>
 
  
 +
</head>
 +
<body class="homepage">
  
 +
<button onclick="topFunction()" id="myBtn" title="回顶部">TOP</button>
  
−
<div class="column third_size">
+
<div id="page-wrapper" >
−
<div class="highlight decoration_A_full">
+
−
<h3>Inspiration</h3>
+
−
<p>We have a created  a <a href="http://parts.igem.org/Well_Documented_Parts">collection of well documented parts</a> that can help you get started.</p>
+
  
−
<p> You can also take a look at how other teams have documented their parts in their wiki:</p>
 
−
<ul>
 
−
<li><a href="https://2014.igem.org/Team:MIT/Parts"> 2014 MIT </a></li>
 
−
<li><a href="https://2014.igem.org/Team:Heidelberg/Parts"> 2014 Heidelberg</a></li>
 
−
<li><a href="https://2014.igem.org/Team:Tokyo_Tech/Parts">2014 Tokyo Tech</a></li>
 
−
</ul>
 
−
</div>
 
−
</div>
 
  
 +
<!-- Nav -->
 +
<nav id="nav">
 +
<ul>
 +
<li ><a href="https://2018.igem.org/Team:OUC-China">Main</a>
 +
</li>
 +
<li>
 +
<a href="#">Project</a>
 +
<ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Description">Overview</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Design">Design</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Results">Results</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Demonstrate">Demonstrate</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="#">Lab WORK</a>
 +
<ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Experiments">Experiments</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Safety">Safety</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/InterLab">InterLab</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="#">Model</a>
 +
                                                <ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Model">Overview</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/miniToe">miniToe</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/miniToe Family">miniToe Family</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/polycistron">polycistron</a></li>
 +
</ul>
 +
</li>
 +
  <li><a href="#">Parts</a>
 +
<ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Parts">List</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Improve">Improve</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="#">HP</a>
 +
<ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Human_Practices">Human Practices</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Public_Engagement">Public Engagement</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="#">Team</a>
 +
<ul>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Team">Team Member</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Collaborations">Collaborations</a></li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Attributions">Attributions</a></li>
 +
</ul>
 +
</li>
 +
<li><a href="https://2018.igem.org/Team:OUC-China/Notebook">Notebook</a></li>
  
−
<div class="clear extra_space"></div>
+
</ul>
 +
</nav>
  
 +
<!-- Banner -->
 +
 +
<img src="https://static.igem.org/mediawiki/2018/f/fe/T--OUC-China--partlist.jpg"width="100%">
 +
 +
</div>
 +
<!-- Main -->
 +
<div class="nb">
 +
 +
 +
 +
<div class="sk">
  
 +
<!-- Features -->
 +
<section class="box features">
  
  
−
<div class="column full_size">
+
<h2 class="major"><span>Parts</span></h2>
  
−
<h3>What information do I need to start putting my parts on the Registry?</h3>
+
<p align="justify">
−
<p>The information needed to initially create a part on the Registry is:</p>
+
<h3>Silver part: Designing a new part</h3>
−
<ul>
+
−
<li>Part Name</li>
+
−
<li>Part type</li>
+
−
<li>Creator</li>
+
−
<li>Sequence</li>
+
−
<li>Short Description (60 characters on what the DNA does)</li>
+
−
<li>Long Description (Longer description of what the DNA does)</li>
+
−
<li>Design considerations</li>
+
−
</ul>
+
  
−
<p>
+
<br />This year, we design a basic part called miniToe, which consists of RBS, Csy4 recognition site (hairpin) and cis-repressive RNA element. As a regulatory element, it can be specifically recognized and cleaved by Csy4 to regulate the expression of its downstream genes on the RNA level. MiniToe is the key of our project, is RFC10  compatible and works as expected. We have documented its experimental characterization on Part's Main Page on the Registry and submitted the sample to the Registry. Certainly, this part is different from the new part documented for Gold#2. See the page for more details:<a href="http://parts.igem.org/Part:BBa_K2615020"> parts.igem.org/Part:BBa_K2615020</a>
−
We encourage you to put up <em>much more</em> information as you gather it over the summer. If you have images, plots, characterization data and other information, please also put it up on the part page. </p>
+
<br /><br />
 +
At the same time, the Csy4 (BBa_K2615003) is one of the key role in our system. We also submitted it to registry. We also apply miniToe to polycistron to create miniToe polycistron (BBa_K2615019).
 +
<br /><br />
 +
<h3>Gold parts: Improving an existing part</h3>
 +
Improving an existing Part Standardization and building up on existing parts are the fundaments of iGEM. We have created FOUR new BioBrick Part (BBa_K2615004, BBa_K2615005, BBa_K2615006, BBa_K2615007) that has a functional improvement upon an existing BioBrick Part (BBa_K1062004). The sequences of four new parts and existing part are different, and the new parts are changed by point mutation. We have showed experiments with both parts to demonstrate this improvement.
 +
<br /><br />See the pages below for details:
 +
<br />The existing part
 +
<br /><a href="http://parts.igem.org/Part:BBa_K1062004">parts.igem.org/Part:BBa_K1062004:Experience</a>
 +
<br /><br />
 +
The four improved parts
 +
<br /><a href="http://parts.igem.org/Part:BBa_K2615004">parts.igem.org/Part:BBa_K2615004</a>
 +
<br /><a href="http://parts.igem.org/Part:BBa_K2615005">parts.igem.org/Part:BBa_K2615005</a>
 +
<br /><a href="http://parts.igem.org/Part:BBa_K2615006">parts.igem.org/Part:BBa_K2615006</a>
 +
<br /><a href="http://parts.igem.org/Part:BBa_K2615007">parts.igem.org/Part:BBa_K2615007</a>
 +
<div id="class" align="center" style= "margin: 0cm 0cm 0pt; text-align: left"> 
 +
 +
<table width="200" border="1">
 +
  <tbody>
 +
    <tr>
 +
      <th scope="col">Part number</th>
 +
      <th scope="col">Type</th>
 +
      <th scope="col">Description</th>
 +
      <th scope="col">Designer</th>
 +
      <th scope="col">Length（bp）</th>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615003">BBa_K2615003</a></td>
 +
      <td>Translational_Unit</td>
 +
      <td>Made up of Csy4-WT and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4 can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. </td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>588</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615004">BBa_K2615004</a></td>
 +
      <td>Translational_Unit</td>
 +
      <td>Made up of Csy4-Q104A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Q104A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAG(encoding Gln) to GCG(encoding Ala) on the 104th site based on Csy4-WT. </td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>588</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615005">BBa_K2615005</a></td>
 +
      <td>Translational_Unit</td>
 +
      <td>Made up of Csy4-Y176F and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Y176F can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TAC(encoding Tyr) to TTT(encoding Phe) on the 176th site based on Csy4-WT. </td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>588</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615006">BBa_K2615006</a></td>
 +
      <td>Translational_Unit</td>
 +
      <td>Made up of Csy4-F155A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-F155A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TTC(encoding Phe) to GCG(encoding Ara) on the 155th site based on Csy4-WT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>588</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615007">BBa_K2615007</a></td>
 +
      <td>Translational_Unit</td>
 +
      <td>Made up of Csy4-H29A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-H29A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA.  And this part design by point mutation, we change the CAC(encoding His ) to GCG(encoding Ara) on the 29th site based on Csy4-WT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>588</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615008">BBa_K2615008</a></td>
 +
      <td>Device</td>
 +
      <td>This part is the miniToe family test system No.1, which consists of promoter J23119, miniToe-1 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>901</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615009">BBa_K2615009</a></td>
 +
      <td>Device</td>
 +
      <td>This part is the miniToe family test system No.2, which consists of promoter J23119, miniToe-2 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 +
      <td>Anyi Li</td>
 +
      <td>901</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615010">BBa_K2615010</a></td>
 +
      <td>Device</td>
 +
      <td>This part is the miniToe family test system No.3, which consists of promoter J23119, miniToe-3 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>901</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615011">BBa_K2615011</a></td>
 +
      <td>Device</td>
 +
      <td>This part is the miniToe family test system No.4, which consists of promoter J23119, miniToe-4 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>901</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615012">BBa_K2615012</a></td>
 +
      <td>Device</td>
 +
      <td>This part is the miniToe family test system No.5, which consists of promoter J23119, miniToe-5 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence.</td>
 +
      <td> Anyi Li </td>
 +
      <td>901</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615013">BBa_K2615013</a></td>
 +
      <td>Coding</td>
 +
      <td>Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>564</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615014">BBa_K2615014</a></td>
 +
      <td>Coding</td>
 +
      <td>Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 +
      <td>Anyi Li</td>
 +
      <td>564</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615015">BBa_K2615015</a></td>
 +
      <td>Coding</td>
 +
      <td>Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 +
      <td>Anyi Li</td>
 +
      <td>564</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615016">BBa_K2615016</a></td>
 +
      <td>Coding</td>
 +
      <td>Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.</td>
 +
      <td>Anyi Li</td>
 +
      <td>564</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615017">BBa_K2615017</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-6, a member of miniToe family. We design it by point mutation.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>75</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615018">BBa_K2615018</a></td>
 +
      <td>Device</td>
 +
      <td>MiniToe polycistron A, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. </td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>1764</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615019">BBa_K2615019</a></td>
 +
      <td>Device</td>
 +
      <td>MiniToe polycistron B, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. </td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>1764</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615020">BBa_K2615020</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>68</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615021">BBa_K2615021</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615022">BBa_K2615022</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615023">BBa_K2615023</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615024">BBa_K2615024</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT.</td>
 +
      <td>Anyi Li</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615025">BBa_K2615025</a></td>
 +
      <td>Regulatory</td>
 +
      <td>MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>74</td>
 +
    </tr>
 +
    <tr>
 +
      <td><a href="http://parts.igem.org/Part:BBa_K2615026">BBa_K2615026</a></td>
 +
      <td>Device</td>
 +
      <td>MiniToe-motA, a new system using miniToe, which consists of promoter J23119, miniToe and motA. The intensity of upstream regulatory element can be characterized by motility of bacteria.</td>
 +
      <td>Yunqian Zhang</td>
 +
      <td>1084</td>
 +
    </tr>
 +
  </tbody>
 +
</table>
 +
</div>
 +
<br /><br /><br /><br /><br />
  
−
</div>
+
</p> </section>
  
 +
</div>
 +
</div>
  
−
<div class="clear extra_space"></div>
 
−
<div class="line_divider"></div>
 
−
<div class="clear extra_space"></div>
 
  
−
<div class="column full_size">
+
−
<h3>Part Table </h3>
+
  
−
<p>Please include a table of all the parts your team has made during your project on this page. Remember part characterization and measurement data must go on your team part pages on the Registry. </p>
 
  
−
</html>
 
−
<groupparts>iGEM18 OUC-China</groupparts>
 
−
<html>
 
−
</div>
 
  
  
 +
 +
 +
 +
<!-- Scripts -->
 +
 +
 +
<script src="http://https://2018.igem.org/Team:OUC-China/jquery?action=raw&ctype=text/javascript"></script>
 +
<script src="https://2018.igem.org/Team:OUC-China/dropotron?action=raw&ctype=text/javascript"></script>
 +
<script src="https://2018.igem.org/Team:OUC-China/skeljs?action=raw&ctype=text/javascript"></script>
 +
<script src="https://2018.igem.org/Team:OUC-China/skelviewport?action=raw&ctype=text/javascript"></script>
 +
<script src="https://2018.igem.org/Team:OUC-China/utiljs?action=raw&ctype=text/javascript"></script>
 +
<script src="https://2018.igem.org/Team:OUC-China/mainjs?action=raw&ctype=text/javascript"></script>
 +
 +
 +
  <div class="copyright1">Contact Us : oucigem@163.com  | &copy;2018 OUC IGEM.All Rights Reserved. <br />
 +
<img src="https://static.igem.org/mediawiki/2017/b/b4/T--OUC-China--foot1.jpeg"alt="banner"width="80px">
 +
<img src="https://static.igem.org/mediawiki/2017/6/62/T--OUC-China--foot2.jpeg"alt="banner"width="80px">
 +
<img src="https://static.igem.org/mediawiki/2018/f/f3/T--OUC-China--lalala.png"alt="banner"width="80px">
 +
<img src="https://static.igem.org/mediawiki/2017/5/51/T--OUC-China--NSG.png"alt="banner"height="65px">
 +
<img src="https://static.igem.org/mediawiki/2017/2/2a/T--OUC-China--ML.png"alt="banner"height="65px">&emsp;
 +
</div>
 +
 +
 +
<script>
 +
// 当网页向下滑动 20px 出现"返回顶部" 按钮
 +
window.onscroll = function() {scrollFunction()};
 +
 +
function scrollFunction() {console.log(121);
 +
    if (document.body.scrollTop > 20 || document.documentElement.scrollTop > 20) {
 +
        document.getElementById("myBtn").style.display = "block";
 +
    } else {
 +
        document.getElementById("myBtn").style.display = "none";
 +
    }
 +
}
 +
 +
// 点击按钮，返回顶部
 +
function topFunction() {
 +
    document.body.scrollTop = 0;
 +
    document.documentElement.scrollTop = 0;
 +
}
 +
</script>
 +
 +
 +
</body>
  
  
 
</html>
 
</html>

Latest revision as of 19:31, 17 October 2018

Team OUC-China: Main

Parts

Silver part: Designing a new part


This year, we design a basic part called miniToe, which consists of RBS, Csy4 recognition site (hairpin) and cis-repressive RNA element. As a regulatory element, it can be specifically recognized and cleaved by Csy4 to regulate the expression of its downstream genes on the RNA level. MiniToe is the key of our project, is RFC10 compatible and works as expected. We have documented its experimental characterization on Part's Main Page on the Registry and submitted the sample to the Registry. Certainly, this part is different from the new part documented for Gold#2. See the page for more details: parts.igem.org/Part:BBa_K2615020

At the same time, the Csy4 (BBa_K2615003) is one of the key role in our system. We also submitted it to registry. We also apply miniToe to polycistron to create miniToe polycistron (BBa_K2615019).

Gold parts: Improving an existing part

Improving an existing Part Standardization and building up on existing parts are the fundaments of iGEM. We have created FOUR new BioBrick Part (BBa_K2615004, BBa_K2615005, BBa_K2615006, BBa_K2615007) that has a functional improvement upon an existing BioBrick Part (BBa_K1062004). The sequences of four new parts and existing part are different, and the new parts are changed by point mutation. We have showed experiments with both parts to demonstrate this improvement.

See the pages below for details:
The existing part
parts.igem.org/Part:BBa_K1062004:Experience

The four improved parts
parts.igem.org/Part:BBa_K2615004
parts.igem.org/Part:BBa_K2615005
parts.igem.org/Part:BBa_K2615006
parts.igem.org/Part:BBa_K2615007
Part number Type Description Designer Length（bp）
BBa_K2615003 Translational_Unit Made up of Csy4-WT and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4 can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. Yunqian Zhang 588
BBa_K2615004 Translational_Unit Made up of Csy4-Q104A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Q104A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAG(encoding Gln) to GCG(encoding Ala) on the 104th site based on Csy4-WT. Yunqian Zhang 588
BBa_K2615005 Translational_Unit Made up of Csy4-Y176F and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-Y176F can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TAC(encoding Tyr) to TTT(encoding Phe) on the 176th site based on Csy4-WT. Yunqian Zhang 588
BBa_K2615006 Translational_Unit Made up of Csy4-F155A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-F155A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the TTC(encoding Phe) to GCG(encoding Ara) on the 155th site based on Csy4-WT. Anyi Li 588
BBa_K2615007 Translational_Unit Made up of Csy4-H29A and RBS, it can recognize and cleave a 22nt hairpin. As an important part in our project, Csy4-H29A can work with miniToe and some miniToe mutants to regulate the expression of downstream genes on the level of RNA. And this part design by point mutation, we change the CAC(encoding His ) to GCG(encoding Ara) on the 29th site based on Csy4-WT. Anyi Li 588
BBa_K2615008 Device This part is the miniToe family test system No.1, which consists of promoter J23119, miniToe-1 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Yunqian Zhang 901
BBa_K2615009 Device This part is the miniToe family test system No.2, which consists of promoter J23119, miniToe-2 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Anyi Li 901
BBa_K2615010 Device This part is the miniToe family test system No.3, which consists of promoter J23119, miniToe-3 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Yunqian Zhang 901
BBa_K2615011 Device This part is the miniToe family test system No.4, which consists of promoter J23119, miniToe-4 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Yunqian Zhang 901
BBa_K2615012 Device This part is the miniToe family test system No.5, which consists of promoter J23119, miniToe-5 and sfGFP. We use miniToe to regulate the downstream gene, so sfGFP is a symbol of target gene in this part. The intensity of upstream regulatory element can be characterized by fluorescence. Anyi Li 901
BBa_K2615013 Coding Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Yunqian Zhang 564
BBa_K2615014 Coding Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615015 Coding Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615016 Coding Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. Anyi Li 564
BBa_K2615017 Regulatory MiniToe-6, a member of miniToe family. We design it by point mutation. Yunqian Zhang 75
BBa_K2615018 Device MiniToe polycistron A, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. Yunqian Zhang 1764
BBa_K2615019 Device MiniToe polycistron B, a new system using miniToe. We insert miniToe into the polycistron and apply the interaction between the miniToe and Csy4 enzyme to achieve the regulation of different ratio of multiple gene expression levels, which can meet the requirements of expression of different genes. Yunqian Zhang 1764
BBa_K2615020 Regulatory MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. Yunqian Zhang 68
BBa_K2615021 Regulatory MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT. Anyi Li 74
BBa_K2615022 Regulatory MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT. Anyi Li 74
BBa_K2615023 Regulatory MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT. Anyi Li 74
BBa_K2615024 Regulatory MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT. Anyi Li 74
BBa_K2615025 Regulatory MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT. Yunqian Zhang 74
BBa_K2615026 Device MiniToe-motA, a new system using miniToe, which consists of promoter J23119, miniToe and motA. The intensity of upstream regulatory element can be characterized by motility of bacteria. Yunqian Zhang 1084





Contact Us : oucigem@163.com | ©2018 OUC IGEM.All Rights Reserved.
banner banner banner banner banner