Difference between revisions of "Team:ZJUT-China/Results"

(Prototype team page)
 
 
(29 intermediate revisions by 2 users not shown)
Line 1: Line 1:
−
{{ZJUT-China}}
+
CRISPR<html lang="en" dir="ltr" class="client-nojs">
−
<html>
+
<head>
 +
<meta charset="UTF-8" />
 +
<title>Team:ZJUT-China - 2018.igem.org</title>
 +
<meta name="generator" content="MediaWiki 1.24.1" />
 +
<link rel="alternate" type="application/x-wiki" title="Edit" href="/wiki/index.php?title=Team:ZJUT-China&amp;action=edit" />
 +
<link rel="edit" title="Edit" href="/wiki/index.php?title=Team:ZJUT-China&amp;action=edit" />
 +
<link rel="shortcut icon" href="/favicon.ico" />
 +
<link rel="search" type="application/opensearchdescription+xml" href="/wiki/opensearch_desc.php" title="2018.igem.org (en)" />
 +
<link rel="EditURI" type="application/rsd+xml" href="https://2018.igem.org/wiki/api.php?action=rsd" />
 +
<link rel="alternate" hreflang="x-default" href="/Team:ZJUT-China" />
 +
<link rel="copyright" href="http://creativecommons.org/licenses/by/3.0/" />
 +
<link rel="alternate" type="application/atom+xml" title="2018.igem.org Atom feed" href="/wiki/index.php?title=Special:RecentChanges&amp;feed=atom" />
 +
<link rel="stylesheet" href="https://2018.igem.org/wiki/load.php?debug=false&amp;lang=en&amp;modules=mediawiki.legacy.commonPrint%2Cshared%7Cmediawiki.skinning.content.externallinks%7Cmediawiki.skinning.interface%7Cmediawiki.ui.button%7Cskins.igem.styles&amp;only=styles&amp;skin=igem&amp;*" />
 +
<!--[if IE 6]><link rel="stylesheet" href="/wiki/skins/Igem/IE60Fixes.css?303" media="screen" /><![endif]-->
 +
<!--[if IE 7]><link rel="stylesheet" href="/wiki/skins/Igem/IE70Fixes.css?303" media="screen" /><![endif]--><meta name="ResourceLoaderDynamicStyles" content="" />
 +
<style>a:lang(ar),a:lang(kk-arab),a:lang(mzn),a:lang(ps),a:lang(ur){text-decoration:none}
 +
/* cache key: 2018_igem_org:resourceloader:filter:minify-css:7:4954c207eac863ca01279ce65317a567 */</style>
 +
<script src="https://2018.igem.org/wiki/load.php?debug=false&amp;lang=en&amp;modules=startup&amp;only=scripts&amp;skin=igem&amp;*"></script>
 +
<script>if(window.mw){
 +
mw.config.set({"wgCanonicalNamespace":"","wgCanonicalSpecialPageName":false,"wgNamespaceNumber":0,"wgPageName":"Team:ZJUT-China","wgTitle":"Team:ZJUT-China","wgCurRevisionId":27692,"wgRevisionId":27692,"wgArticleId":5971,"wgIsArticle":true,"wgIsRedirect":false,"wgAction":"view","wgUserName":"CW","wgUserGroups":["*","user","autoconfirmed"],"wgCategories":[],"wgBreakFrames":false,"wgPageContentLanguage":"en","wgPageContentModel":"wikitext","wgSeparatorTransformTable":["",""],"wgDigitTransformTable":["",""],"wgDefaultDateFormat":"dmy","wgMonthNames":["","January","February","March","April","May","June","July","August","September","October","November","December"],"wgMonthNamesShort":["","Jan","Feb","Mar","Apr","May","Jun","Jul","Aug","Sep","Oct","Nov","Dec"],"wgRelevantPageName":"Team:ZJUT-China","wgUserId":2241,"wgUserEditCount":108,"wgUserRegistration":1525510907000,"wgUserNewMsgRevisionId":null,"wgIsProbablyEditable":true,"wgRestrictionEdit":[],"wgRestrictionMove":[],"wgWikiEditorEnabledModules":{"toolbar":false,"dialogs":false,"hidesig":true,"preview":false,"previewDialog":false,"publish":false}});
 +
}</script><script>if(window.mw){
 +
mw.loader.implement("user.options",function($,jQuery){mw.user.options.set({"ccmeonemails":0,"cols":80,"date":"default","diffonly":0,"disablemail":0,"editfont":"default","editondblclick":0,"editsectiononrightclick":0,"enotifminoredits":0,"enotifrevealaddr":0,"enotifusertalkpages":1,"enotifwatchlistpages":1,"extendwatchlist":0,"fancysig":0,"forceeditsummary":0,"gender":"unknown","hideminor":0,"hidepatrolled":0,"imagesize":2,"math":1,"minordefault":0,"newpageshidepatrolled":0,"nickname":"","norollbackdiff":0,"numberheadings":0,"previewonfirst":0,"previewontop":1,"rcdays":7,"rclimit":50,"rows":25,"showhiddencats":0,"shownumberswatching":1,"showtoolbar":1,"skin":"igem","stubthreshold":0,"thumbsize":5,"underline":2,"uselivepreview":0,"usenewrc":1,"watchcreations":1,"watchdefault":1,"watchdeletion":0,"watchlistdays":3,"watchlisthideanons":0,"watchlisthidebots":0,"watchlisthideliu":0,"watchlisthideminor":0,"watchlisthideown":0,"watchlisthidepatrolled":0,"watchmoves":0,"watchrollback":0,
 +
"wllimit":250,"useeditwarning":1,"prefershttps":1,"language":"en","variant-gan":"gan","variant-iu":"iu","variant-kk":"kk","variant-ku":"ku","variant-shi":"shi","variant-sr":"sr","variant-tg":"tg","variant-uz":"uz","variant-zh":"zh","searchNs0":true,"searchNs1":false,"searchNs2":false,"searchNs3":false,"searchNs4":false,"searchNs5":false,"searchNs6":false,"searchNs7":false,"searchNs8":false,"searchNs9":false,"searchNs10":false,"searchNs11":false,"searchNs12":false,"searchNs13":false,"searchNs14":false,"searchNs15":false});},{},{});mw.loader.implement("user.tokens",function($,jQuery){mw.user.tokens.set({"editToken":"c6e2dcb2fbf926899bdc7f857ada9056+\\","patrolToken":"6b5be303424032e9a02c46b7ee95ffa6+\\","watchToken":"3499f4528beaf61c542ef91929335941+\\"});},{},{});
 +
/* cache key: 2018_igem_org:resourceloader:filter:minify-js:7:db3d5f234eeab805b248348b01726c64 */
 +
}</script>
 +
<script>if(window.mw){
 +
mw.loader.load(["mediawiki.page.startup","mediawiki.legacy.wikibits","mediawiki.legacy.ajax"]);
 +
}</script>
 +
</head>
 +
<body class="mediawiki ltr sitedir-ltr ns-0 ns-subject page-Team_ZJUT-China skin-igem action-view">
  
 +
        <script type='text/javascript'        src ='/common/tablesorter/jquery.tablesorter.min.js'></script>
 +
        <link rel='stylesheet' type='text/css' href='/common/tablesorter/themes/groupparts/style.css' />
 +
        <link rel='stylesheet' type='text/css' href='/common/table_styles.css' />
  
−
<div class="column full_size">
+
        <script type='text/javascript'        src ='/wiki/skins/Igem/resources/2018_skin.js'></script>
−
<h1>Results</h1>
+
−
<p>Here you can describe the results of your project and your future plans. </p>
+
−
</div>
+
  
  
−
<div class="column third_size" >
+
    <div id='globalWrapper'>
 +
        <div id='top_menu_under' class='noprint'></div>
 +
        <div id='top_menu_14' class='noprint'>Loading menubar.....</div> <!-- Will be replaced with the jQuery.load -->
 +
<script>jQuery('#top_menu_14').load('https://2018.igem.org/cgi/top_menu_14/menubar_reply.cgi',
 +
    {  t:"Team%3AZJUT-China",
 +
a:"View+%2FTeam%3AZJUT-China++Edit+%2Fwiki%2Findex.php%3Ftitle%3DTeam%3AZJUT-China%26action%3Dedit++History+%2Fwiki%2Findex.php%3Ftitle%3DTeam%3AZJUT-China%26action%3Dhistory++Move+%2FSpecial%3AMovePage%2FTeam%3AZJUT-China++Watch+%2Fwiki%2Findex.php%3Ftitle%3DTeam%3AZJUT-China%26action%3Dwatch%26token%3D38ed5adef107ee533cb1558664ce82b1%252B%255C++Page+%2FTeam%3AZJUT-China++Discussion+%2Fwiki%2Findex.php%3Ftitle%3DTalk%3ATeam%3AZJUT-China%26action%3Dedit%26redlink%3D1++" });
 +
</script>
  
−
<h3>What should this page contain?</h3>
+
        <!-- Content div contains HQ_page for HQ styles, Logo and title div, and USER CONTENT -->
−
<ul>
+
<div id="content" class="mw-body" role="main">
−
<li> Clearly and objectively describe the results of your work.</li>
+
    <a id="top"></a>
−
<li> Future plans for the project. </li>
+
−
<li> Considerations for replicating the experiments. </li>
+
−
</ul>
+
−
</div>
+
  
 +
            <div id="top_title">
 +
                <div class="logo_2018">
 +
                    <a href="https://2018.igem.org">
 +
                    <img src="https://static.igem.org/mediawiki/2018/8/8b/HQ_page_logo.jpg" width="100px">
 +
                    </a>
 +
                </div>
  
 +
        <h1 id="firstHeading" class="firstHeading">
 +
            <span dir="auto">Team:ZJUT-China</span>
 +
        </h1>
 +
            </div>
  
 +
            <div id="HQ_page">
 +
                <div id="bodyContent">
 +
            <div id="mw-content-text" lang="en" dir="ltr" class="mw-content-ltr"><p>
 +
<script>
 +
////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////
  
−
<div class="column two_thirds_size" >
+
$(document).ready(function() {
−
<h3>Describe what your results mean </h3>
+
−
<ul>
+
−
<li> Interpretation of the results obtained during your project. Don't just show a plot/figure/graph/other, tell us what you think the data means. This is an important part of your project that the judges will look for. </li>
+
−
<li> Show data, but remember all measurement and characterization data must be on part pages in the Registry. </li>
+
−
<li> Consider including an analysis summary section to discuss what your results mean. Judges like to read what you think your data means, beyond all the data you have acquired during your project. </li>
+
−
</ul>
+
−
</div>
+
  
 +
$("#HQ_page").attr('id','');
  
−
<div class="clear extra_space"></div>
 
  
 +
//highlight current page on the menu
 +
highlight_current_page_menu();
  
 +
//accessing submenus
 +
$(".menu_item").click(function(){
 +
$(".submenu_control_icon", this).toggleClass("open");
 +
$(this).next(".submenu").fadeToggle(400);
 +
});
  
−
<div class="column two_thirds_size" >
+
//mobile menu access
−
<h3> Project Achievements </h3>
+
$(".igem_2018_team_mobile_bar").click(function(){
 +
$(this).next().toggleClass("displaying_menu");
 +
});
  
−
<p>You can also include a list of bullet points (and links) of the successes and failures you have had over your summer. It is a quick reference page for the judges to see what you achieved during your summer.</p>
+
});
  
−
<ul>
 
−
<li>A list of linked bullet points of the successful results during your project</li>
 
−
<li>A list of linked bullet points of the unsuccessful results during your project. This is about being scientifically honest. If you worked on an area for a long time with no success, tell us so we know where you put your effort.</li>
 
−
</ul>
 
  
−
</div>
+
function highlight_current_page_menu() {
  
 +
var page_url="https://2018.igem.org/";
 +
page_url = page_url + wgPageName;
 +
$("a[href$='"+ page_url +"']").children().addClass("current_page");
  
 +
//if the page is in a submenu, open the submenu and make the appropiate changes
 +
if( $( ".current_page" ).hasClass( "submenu_item" )){
  
−
<div class="column third_size" >
+
$(".current_page").parent().parent().fadeToggle(400);
−
<div class="highlight decoration_A_full">
+
$(".current_page").parent().parent().prev().addClass("current_page");
−
<h3>Inspiration</h3>
+
$(".menu_item.current_page > .submenu_control_icon").toggleClass("open");
−
<p>See how other teams presented their results.</p>
+
 
−
<ul>
+
}
−
<li><a href="https://2014.igem.org/Team:TU_Darmstadt/Results/Pathway">2014 TU Darmstadt </a></li>
+
}
−
<li><a href="https://2014.igem.org/Team:Imperial/Results">2014 Imperial </a></li>
+
 
−
<li><a href="https://2014.igem.org/Team:Paris_Bettencourt/Results">2014 Paris Bettencourt </a></li>
+
 
−
</ul>
+
////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////////
−
</div>
+
</script>
 +
 
 +
 
 +
<style>
 +
/**************************************************************************************************************************************************************************************************/
 +
 
 +
 
 +
/* igem祖传代码 */
 +
/**************************************************************************************************************************************************************************************************/
 +
/* DEFAULT WIKI SETTINGS */
 +
/**************************************************************************************************************************************************************************************************/
 +
 
 +
 
 +
#home_logo, #sideMenu { display:none; }
 +
#sideMenu, #top_title, .patrollink  {display:none;}
 +
#content { margin-left:0px; margin-top:-7px; padding:0px; width:100%;}
 +
body {background-color:white; }
 +
#bodyContent h1, #bodyContent h2, #bodyContent h3, #bodyContent h4, #bodyContent h5 { margin-bottom: 0px; }
 +
 
 +
 
 +
/**************************************************************************************************************************************************************************************************/
 +
/* MENU */
 +
/**************************************************************************************************************************************************************************************************/
 +
 
 +
/*this wraps the whole of the menu*/
 +
 
 +
.igem_2018_team_menu {
 +
background-color:#c4baba;
 +
border-left: 1px solid #c4baba;
 +
display:block;
 +
float:right;
 +
height:100vh;
 +
max-width: 270px;
 +
overflow-y: auto;
 +
overflow-x: hidden;
 +
padding:0px;
 +
position:fixed;
 +
right:0%;
 +
text-align:left;
 +
width: 15%;
 +
}
 +
 
 +
}
 +
.submenu{
 +
  display: none;
 +
}
 +
.igem_2018_title_menu_item:hover .submenu{
 +
  display: block;
 +
  background-color: #ecb656;
 +
  height: 20px;
 +
  padding: 30px 0;
 +
  border: 1px solid #eee;
 +
}
 +
.igem_2018_team_menu.displaying_menu{
 +
display:block;
 +
}
 +
 
 +
.igem_2018_team_menu  a {
 +
color: #484848;
 +
text-decoration:none;
 +
}
 +
 
 +
.igem_2018_team_menu img {
 +
width:100%;
 +
}
 +
 
 +
 
 +
.igem_2018_team_menu .menu_item {
 +
    background-color: #c4baba;
 +
    border-bottom: 1px solid #928b8b;
 +
    clear: both;
 +
color: #484848;
 +
    cursor: pointer;
 +
float: left;
 +
    font-size: 120%;
 +
    font-weight: bold;
 +
    padding: 15px 0px 15px 5%;
 +
  width: 100%;
 +
}
 +
 
 +
.igem_2018_team_menu .menu_item.direct_link {
 +
color: #484848;
 +
padding-left: 15%;
 +
}
 +
.igem_2018_team_menu .menu_item:hover {
 +
background-color: #D0D0D0;
 +
}
 +
 
 +
 
 +
.igem_2018_team_menu .menu_item .submenu_control_icon {
 +
color: #484848;
 +
float: left;
 +
width: 10%;
 +
}
 +
 
 +
/* submenu icon "+"  "-"*/
 +
.igem_2018_team_menu .menu_item .submenu_control_icon::before {
 +
content: "+";
 +
}
 +
 
 +
/* submenu icon "+"  "-"*/
 +
.igem_2018_team_menu .menu_item .submenu_control_icon.open::before {
 +
content: "-";
 +
}
 +
 
 +
/*submenu wrapper*/
 +
/*styling for a submenu item*/
 +
.igem_2018_team_menu .submenu .submenu_item {
 +
border-bottom: 1px solid #c4baba;
 +
  color: #635d5d;
 +
    height: 30px;
 +
  float: left;
 +
    font-size: 110%;
 +
font-weight: bold;
 +
    padding: 12px 0px 0px 15%;
 +
    width: 100%;
 +
}
 +
 
 +
.igem_2018_team_menu .submenu .submenu_item:hover {
 +
background-color: #f3bd5d;
 +
}
 +
 
 +
 
 +
.igem_2018_team_menu .submenu .submenu_item.current_page,
 +
.igem_2018_team_menu .menu_item.current_page,
 +
.igem_2018_team_menu .menu_item.direct_link.current_page {
 +
background-color:#7acbd8;
 +
}
 +
 
 +
 
 +
 
 +
/*mobile menu bar styling*/
 +
/**************************************************************************************************************************************************************************************************/
 +
 
 +
 
 +
.igem_2018_team_mobile_bar {
 +
background-color:#e4dede;
 +
border-bottom: 1px solid #c4baba;
 +
cursor:pointer;
 +
display:none;
 +
float:left;
 +
margin-top: 0;
 +
padding: 5px 0;
 +
position:fixed;
 +
width:100%;
 +
}
 +
 
 +
.igem_logo_mobile img {
 +
width:70px;
 +
}
 +
 
 +
.igem_logo_mobile {
 +
float:left;
 +
padding-left: 5%;
 +
width: 30%;
 +
}
 +
 
 +
.igem_menu_control_mobile img {
 +
width:25px;
 +
}
 +
 
 +
.igem_menu_control_mobile {
 +
float:right;
 +
padding-right:5%;
 +
padding-top:5px;
 +
text-align:right;
 +
width: 30%;
 +
}
 +
 
 +
 
 +
 
 +
/**************************************************************************************************************************************************************************************************/
 +
/* CONTENT OF THE PAGE */
 +
/**************************************************************************************************************************************************************************************************/
 +
 
 +
/* general wrapper for the content */
 +
.igem_2018_team_content {
 +
background-color:white;
 +
display:block;
 +
width: 87%;
 +
}
 +
 
 +
/* subwrapper to center content */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper {
 +
margin:auto;
 +
max-width: 1400px;
 +
width:90%;
 +
}
 +
 
 +
 
 +
 
 +
/*general styling*/
 +
/**************************************************************************************************************************************************************************************************/
 +
 
 +
.igem_2018_team_content .igem_2018_team_column_wrapper h1 { font-size: 210%;}
 +
.igem_2018_team_content .igem_2018_team_column_wrapper h2 { font-size: 190%;}
 +
.igem_2018_team_content .igem_2018_team_column_wrapper h3 { font-size: 170%;}
 +
.igem_2018_team_content .igem_2018_team_column_wrapper h4 { font-size: 150%;}
 +
.igem_2018_team_content .igem_2018_team_column_wrapper h5 { font-size: 140%;}
 +
.igem_2018_team_content .igem_2018_team_column_wrapper h6 { font-size: 130%;}
 +
 
 +
 
 +
/* styling for the titles h1, h2*/
 +
.igem_2018_team_content .igem_2018_team_column_wrapper h1, .igem_2018_team_content .igem_2018_team_column_wrapper h2 {
 +
border-bottom:0px;
 +
color: #635d5d;
 +
font-family: "Arial Black", Gadget, sans-serif;
 +
padding: 10px 0px;
 +
}
 +
 
 +
/* styling for the titles h3, h3, h5, h6 */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper h3,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper h4,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper h5,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper h6 {
 +
border-bottom:0px;
 +
color: #928b8b;
 +
font-family: "Arial Black", Gadget, sans-serif;
 +
padding: 5px 0px;
 +
}
 +
 
 +
/* text */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper p {
 +
font-size: 130%;
 +
font-family: Arial, Helvetica, sans-serif;
 +
padding: 5px 0px;
 +
text-align: left;
 +
color: #484848;
 +
}
 +
 
 +
/* Links */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper a {
 +
color: #5bc7d8;
 +
font-weight: bold;
 +
text-decoration: underline;
 +
text-decoration-color:#5bc7d8;
 +
transition: all 0.4s ease;
 +
-webkit-transition: all 0.4s ease;
 +
-moz-transition: all 0.4s ease;
 +
-ms-transition: all 0.4s ease;
 +
-o-transition: all 0.4s ease;
 +
}
 +
 
 +
/* hover for the links */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper a:hover {
 +
color: #f8b732;
 +
text-decoration:none;
 +
}
 +
 
 +
 
 +
/* Table */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper table {
 +
border: 1px solid #928b8b;
 +
border-collapse: collapse;
 +
font-size: 130%;
 +
width: 100%;
 +
}
 +
 
 +
/* table cells */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper td {
 +
border: 1px solid #c4baba;
 +
border-collapse: collapse;
 +
font-size: 105%;
 +
padding: 10px;
 +
vertical-align: text-top;
 +
}
 +
 
 +
/* table headers */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper th {
 +
background-color:#c4baba;
 +
border: 1px solid #928b8b;
 +
border-collapse: collapse;
 +
font-size: 110%;
 +
padding: 10px;
 +
vertical-align: text-top;
 +
}
 +
 
 +
 
 +
 
 +
/* non numbered lists */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper ul, .igem_2018_team_content .igem_2018_team_column_wrapper ol {
 +
font-size: 130%;
 +
font-family: Arial, Helvetica, sans-serif;
 +
padding:0px 20px;
 +
}
 +
 
 +
 
 +
.igem_2018_team_content .igem_2018_team_column_wrapper ul ul li, .igem_2018_team_content .igem_2018_team_column_wrapper ul ul ul li,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper ul ol li, .igem_2018_team_content .igem_2018_team_column_wrapper ul ul ol li,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper ol ol li, .igem_2018_team_content .igem_2018_team_column_wrapper ul ol ul li,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper ol ul li, .igem_2018_team_content .igem_2018_team_column_wrapper ul ol ol li,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper ol ul ul li, .igem_2018_team_content .igem_2018_team_column_wrapper ol ol ul li,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper ol ol ol li, .igem_2018_team_content .igem_2018_team_column_wrapper ol ul ol li{ font-size: 76%; }
 +
 
 +
 
 +
 
 +
/*layout classes*/
 +
/**************************************************************************************************************************************************************************************************/
 +
 
 +
/*main layout class */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .column  {
 +
float:left;
 +
margin: 1% 2%;
 +
padding: 0px;
 +
}
 +
 
 +
/* 100% */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .column.full_size { width:96%; }
 +
 
 +
/* 66% */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .column.two_thirds_size { width: 62.6%; }
 +
 
 +
/* 33% */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .column.third_size { width: 29.3%; }
 +
 
 +
 
 +
 
 +
 
 +
/*styling for all images*/
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .column.full_size img,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .column.two_thirds_size img,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .column.third_size img {
 +
margin-bottom: 15px;
 +
width: 100%;
 +
}
 +
 
 +
 
 +
/* page break */
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .clear {
 +
clear:both;
 +
}
 +
/*add extra space to page break with clear class*/
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .clear.extra_space {
 +
height: 30px;
 +
}
 +
 
 +
/* horizontal line to divide the page*/
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .line_divider {
 +
    border-top: 1px solid #c4baba;
 +
  margin: auto;
 +
  width: 98%;
 +
}
 +
 
 +
 
 +
 
 +
 
 +
/*support classes*/
 +
/**************************************************************************************************************************************************************************************************/
 +
 
 +
 
 +
/*Button  */
 +
/************************************************/
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .button_link {
 +
font-size: 130%;
 +
margin: 30px auto;
 +
text-align: center;
 +
}
 +
 
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .button_link a  {
 +
background-color: #5bc7d8;
 +
color: #635d5d !important;
 +
font-weight: bold;
 +
margin: auto;
 +
text-decoration: none !important;
 +
padding: 10px 15px;
 +
}
 +
 
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .button_link a:hover {
 +
background-color: #f8b732 !important;
 +
}
 +
 
 +
 
 +
 
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight {
 +
padding: 15px 20px;
 +
}
 +
 
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight p,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight h1,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight h2,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight h3,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight h4,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight h5,
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight h6 {
 +
padding: 5px 15px;
 +
}
 +
 
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight.decoration_background {
 +
background-color: #e4dede;
 +
}
 +
 
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight.decoration_A_top {
 +
    border-top: 4px solid #5bc7d8;
 +
}
 +
 
 +
 
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight.decoration_A_full {
 +
    border: 4px solid #5bc7d8;
 +
}
 +
 
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight.decoration_B_top {
 +
    border-top: 4px solid #f8b732
 +
}
 +
 
 +
 
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .highlight.decoration_B_full {
 +
    border: 4px solid #f8b732;
 +
}
 +
 
 +
 
 +
 
 +
 
 +
/*mobile*/
 +
/**************************************************************************************************************************************************************************************************/
 +
 
 +
 
 +
/* 1800px  */
 +
/************************************************/
 +
@media only screen and (max-width: 1800px) {
 +
.igem_2018_team_content { width: 100%;}
 +
.igem_2018_team_menu {display:block;}
 +
}
 +
 
 +
/* 1400px  */
 +
/************************************************/
 +
@media only screen and (max-width: 1400px) {
 +
.igem_2018_team_menu .menu_item { font-size:100%;}
 +
.igem_2018_team_menu .submenu .submenu_item { font-size:90%;}
 +
.igem_2018_team_menu {display:block;}
 +
}
 +
 
 +
@media only screen and (max-width: 1001px) {
 +
.igem_2018_team_menu {display:block;}
 +
}
 +
 
 +
/* 1000px  */
 +
/************************************************/
 +
@media only screen and (max-width: 1000px) {
 +
.igem_2018_team_content {width:100%; margin-left:0px;}
 +
.igem_2018_team_menu {display:none; margin-top: 45px; min-width:50%; width:50%;}
 +
.igem_2018_team_mobile_bar {display:block;}
 +
.igem_2018_team_content .igem_2018_team_column_wrapper .column.full_size, .igem_2018_team_content .igem_2018_team_column_wrapper .column.two_thirds_size,.igem_2018_team_content .igem_2018_team_column_wrapper .column.third_size {width:96%; }
 +
 
 +
}
 +
 
 +
 
 +
@media only screen and (max-width: 500px) {
 +
.igem_2018_team_menu {min-width:100%; width:100%; }
 +
}
 +
 
 +
 
 +
/**************************************************************************************************************************************************************************************************/
 +
 
 +
/*my styles  */
 +
/************************************************/
 +
img{
 +
  max-width：100%;
 +
 
 +
}
 +
.homepage_img{
 +
  text-align: center;
 +
  margin-top: 20px;
 +
  background: url(https://static.igem.org/mediawiki/2018/7/70/T--ZJUT-China--project.jpg);
 +
  background-size:cover;
 +
  width: 100% ;
 +
  min-height: 800px;
 +
  height: auto;
 +
  clear: both;
 +
  background-repeat: no-repeat;
 +
  background-size: 100% 100%;
 +
  overflow: hidden;
 +
}
 +
 
 +
.container{
 +
padding:0 30px 0 30px;
 +
display: block;
 +
}
 +
.side-bar{
 +
  float: left;
 +
  width: 15%;
 +
  margin: 20px 0 0 30px;
 +
  }
 +
.main{
 +
  float: right;
 +
  width: 80%;}
 +
.side-bar .nav a,
 +
.side-bar  a
 +
{
 +
color: #888;
 +
padding: 5px;
 +
display: block;
 +
-webkit-transition: color 200ms ;
 +
-o-transition: color 200ms ;
 +
transition: color 200ms ;
 +
}
 +
.side-bar .nav a:hover,
 +
.side-bar  a :hover{
 +
color: #7D7DFF;
 +
}
 +
.side-bar .nav a {
 +
font-weight: 700;
 +
}
 +
.homepage_img{
 +
  text-align: center;
 +
  padding:0 0 20px 0;
 +
}
 +
/* 顶栏固定 */
 +
.topbar{
 +
  position: fixed;
 +
  top: 0px;
 +
  height: 51px;
 +
  width: 100%;
 +
  padding-top: 18px;
 +
}
 +
/* 下拉按钮样式 */
 +
.dropbkgd{
 +
    background-image: url(https://static.igem.org/mediawiki/2018/c/ca/T--ZJUT-China--topbar1.jpg);
 +
    min-height: 51px;
 +
    height: auto;
 +
    width: 100% ;
 +
    clear: both;
 +
    background-repeat: no-repeat;
 +
    background-size: 100% 100%;
 +
    overflow: hidden;
 +
  }
 +
.drop{
 +
  color: transparent;
 +
  font-size: 20px;
 +
  line-height: 51px;
 +
  width: 100%;
 +
  height: 100%;
 +
}
 +
 
 +
.dropposition{
 +
    position: absolute;
 +
    left: 15.2%;
 +
    width: 100%;
 +
    height: 51px;
 +
}
 +
.drop:hover{
 +
  background-color: #BACD32;
 +
  color: white;
 +
}
 +
.drop a{
 +
  color: transparent;
 +
  text-decoration: none;
 +
  display: inline-block;
 +
    width: 100%;
 +
    height: 100%;
 +
}
 +
.drop a:hover{
 +
    color: white;
 +
}
 +
 
 +
/* 容器 <div> - 需要定位下拉内容 */
 +
.dropdown1,
 +
.dropdown2,
 +
.dropdown3,
 +
.dropdown4,
 +
.dropdown5,
 +
.dropdown6,
 +
.dropdown7,
 +
.dropdown8{
 +
  position: relative;
 +
  display: inline-block;
 +
  float:left;
 +
  text-align: center;
 +
  width: 8%;
 +
  height: 100%;
 +
}
 +
.dropdown1 {
 +
    width: 7%;
 +
}
 +
.dropdown2{
 +
    width: 7%;
 +
    left: 2%;
 +
}
 +
.dropdown3{
 +
  width: 8%;
 +
  left: 3%;
 +
}
 +
.dropdown4{
 +
  width:7%;
 +
  left:5%;
 +
}
 +
.dropdown5{
 +
  width: 7%;
 +
  left:6%;
 +
}
 +
.dropdown6{
 +
  width:15.2%;
 +
  left: 7%;
 +
}
 +
.dropdown7{
 +
  width:12%;
 +
  left: 7%;
 +
}
 +
.dropdown8{
 +
  width:12%;
 +
  left: 8%;
 +
}
 +
 
 +
/* 下拉内容 (默认隐藏) */
 +
.dropdown-content {
 +
    display: none;
 +
    position: absolute;
 +
    color: #DACD32;
 +
    width: 180px;
 +
    box-shadow: 0px 8px 16px 0px rgba(0,0,0,0.2);
 +
    float: left;
 +
    background-color: rgba(0,0,0,0.2);
 +
}
 +
.dropdown6 .dropdown-content{
 +
  width:230.4px;
 +
}
 +
 
 +
/* 下拉菜单的链接 */
 +
.dropdown-content a {
 +
    color: white;
 +
    text-decoration: none;
 +
    display: block;
 +
    width: 100%;
 +
    height: 100%;
 +
}
 +
 
 +
/* 鼠标移上去后修改下拉菜单链接颜色 */
 +
.dropdown-content a:hover {background-color:  #7D7DFF}
 +
 
 +
/* 在鼠标移上去后显示下拉菜单 */
 +
.dropdown2:hover .dropdown-content {
 +
    display: block;
 +
}
 +
.dropdown3:hover .dropdown-content {
 +
    display: block;
 +
}
 +
.dropdown4:hover .dropdown-content {
 +
    display: block;
 +
}
 +
.dropdown5:hover .dropdown-content {
 +
    display: block;
 +
}
 +
.dropdown6:hover .dropdown-content {
 +
    display: block;
 +
}
 +
.dropdown7:hover .dropdown-content {
 +
    display: block;
 +
}
 +
.dropdown8:hover .dropdown-content {
 +
    display: block;
 +
}
 +
 
 +
  .container .col-10 {
 +
    margin:auto;
 +
    max-width: 1400px;
 +
    width:88%;
 +
    padding: 20px 0 0 0 ;
 +
  }
 +
 
 +
  .container .col-10 h1 { font-size: 210%;}
 +
.container .col-10 h2 { font-size: 190%;}
 +
.container .col-10 h3 { font-size: 170%;}
 +
.container .col-10 h4 { font-size: 150%;}
 +
.container .col-10 h5 { font-size: 140%;}
 +
.container .col-10 h6 { font-size: 130%;}
 +
  p{
 +
    text-indent:2em!important; 
 +
  }
 +
 
 +
 
 +
/* styling for the titles h1, h2*/
 +
  .container .col-10 h1, .container .col-10 h2 {
 +
border-bottom:0px;
 +
font-family: 'Tempus Sans ITC',georgia !important;
 +
padding: 10px 0px;
 +
}
 +
  .container .col-10 h1{
 +
    font-size: 38px!important;
 +
    padding: 20 20 20 20!important;
 +
    text-align: center;
 +
    color: #9ACD32;
 +
  }
 +
  .container .col-10 h2 {
 +
    font-size: 30px!important;
 +
    color: #6495ED;
 +
  }
 +
 
 +
 
 +
 
 +
/* styling for the titles h3, h3, h5, h6 */
 +
.container .col-10 h3,
 +
  .container .col-10 h4,
 +
.container .col-10 h5,
 +
.container .col-10 h6 {
 +
border-bottom:0px;
 +
color: #9ACD32;
 +
font-family: "Arial Black", Gadget, sans-serif;
 +
padding: 5px 0px;
 +
}
 +
 
 +
/* text */
 +
  .container .col-10 p {
 +
font-family: Arial, Helvetica, sans-serif;
 +
padding: 5px 0px;
 +
text-align: left;
 +
color: #000000;
 +
    font-size: 20px!important;
 +
}
 +
  .img-10{
 +
  text-align: center ;
 +
  weight: 600px;
 +
  }
 +
.side-bar .igem_2018_title_menu{
 +
    position: fixed;
 +
}
 +
.note{
 +
  font-size:15px;
 +
  color:#708090;
 +
  text-align: center;
 +
}
 +
.homeindex{
 +
  width: 20%;
 +
  min-height: 1px;
 +
  float: left;
 +
  margin: 15px;
 +
  text-align: center;
 +
  padding-left: 25px;
 +
 
 +
}
 +
.homeindex img{
 +
    border-radius: 30px;
 +
}
 +
/* 底部 */
 +
  .footer{
 +
    background: #eee;
 +
    margin-top: 30px;
 +
    padding: 30px 0;
 +
    width: 100%;
 +
  }
 +
  .foottop{
 +
    height: 330px;
 +
    width: 100%;
 +
  }
 +
  .footbottom{
 +
    height:50px;
 +
    width: 100%;
 +
  }
 +
  .footbottom .note{
 +
    padding-top: 40px;
 +
  }
 +
  .footmessage-left,
 +
  .footmessage-left2,
 +
  .footmessage-right,
 +
  .footmessage-middle {
 +
    width: 24%;
 +
    float: left;
 +
    height: 100%;
 +
  }
 +
  .footmessage-middle img{
 +
    width: 60%;
 +
    padding-top: 60px;
 +
  }
 +
  .footmessage-right img{
 +
    width: 80%;
 +
    max-height: 100%;
 +
    padding-top: 10px;
 +
    padding-left: 30px;
 +
  }
 +
  .footmessage-left2 img{
 +
    width: 80%;
 +
    padding-left: 30px;
 +
    padding-top: 15px;
 +
  }
 +
  .footmessage-left img{
 +
    padding-top: 60px;
 +
    padding-left: 30px;
 +
    width: 80%;
 +
    max-height: 100%;
 +
  }
 +
  .footmessage-right h3{
 +
    font-size: 30px;
 +
  }
 +
  .footmessage-right{
 +
    padding-left: 30px;
 +
  }
 +
  .footmessage-right p{
 +
    font-size: 15px!important;
 +
  }
 +
.designimg{
 +
  width: 100%;
 +
  text-align: center;
 +
}
 +
.designimg img{
 +
  padding: 10 0 10 0;
 +
}
 +
.btn{
 +
  width:15%;
 +
  display: inline-block;
 +
  padding-left: 15px;
 +
}
 +
button{
 +
  font-family:'Tempus Sans ITC';
 +
  font-size: 20px;
 +
  background: #9ACD32;
 +
  padding: 5px;
 +
    float: left;
 +
    color:white;
 +
  text-decoration: none;
 +
  cursor: pointer;
 +
  border-radius:15px;
 +
  outline:none;
 +
  width: 100%;
 +
  height: 66px;
 +
}
 +
.designimg{
 +
  text-align: center;
 +
}
 +
.footmessage-middle img{
 +
      padding-left: 60px;
 +
        }
 +
</style>
 +
 
 +
 
 +
 
 +
 
 +
<!------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------->
 +
<!--- THIS IS WHERE THE HTML BEGINS --->
 +
<!------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------->
 +
 
 +
<head>
 +
 
 +
<!-- This tells the browser that your page is responsive -->
 +
<meta name="viewport" content="width=device-width, initial-scale=1">
 +
 
 +
</head>
 +
<!-- 导航栏 -->
 +
<div class="topbar">
 +
    <div class="dropbkgd">
 +
      <div class="dropposition">
 +
        <div class="dropdown1">
 +
          <div class="drop">
 +
            <a href="https://2018.igem.org/Team:ZJUT-China">Home</a>
 +
          </div>
 +
        </div>
 +
        <div class="dropdown2">
 +
          <div class="drop">
 +
              Team
 +
            <div class="dropdown-content">
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Team">Team Members</a>
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Attributions">Attributions</a>
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Collaborations">Collaborations</a>
 +
            </div>
 +
          </div>
 +
        </div>
 +
        <div class="dropdown3">
 +
          <div class="drop">
 +
              Project
 +
            <div class="dropdown-content">
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Description" >Description</a>
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Design">Design</a>
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Results">Results</a>
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Demonstrate">Demonstrate</a>
 +
            </div>
 +
          </div>
 +
        </div>
 +
        <div class="dropdown4">
 +
          <div class="drop">
 +
              Parts
 +
            <div class="dropdown-content">
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Parts">All parts</a>
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Improve">Improve</a>
 +
            </div>
 +
          </div>
 +
        </div>
 +
        <div class="dropdown5">
 +
          <div class="drop">
 +
            Lab
 +
            <div class="dropdown-content">
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Notebook">Notebook</a>
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Protocols2018">Protocols</a>
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Safety">Safety</a>
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/InterLab" >Interlab</a>
 +
            </div>
 +
          </div>
 +
        </div>
 +
        <div class="dropdown6">
 +
          <div class="drop">
 +
              Human Practices
 +
            <div class="dropdown-content">
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Human_Practices">Integrated hp</a>
 +
              <a href="https://2018.igem.org/Team:ZJUT-China/Public_Engagement">Public Engagement & Education</a>
 +
            </div>
 +
          </div>
 +
        </div>
 +
        <div class="dropdown7">
 +
          <div class="drop">
 +
            <a href="https://2018.igem.org/Team:ZJUT-China/Model"> Modeling</a>
 +
          </div>
 +
        </div>
 +
        <div class="dropdown8">
 +
          <div class="drop">
 +
            <a href="https://2018.igem.org/Team:ZJUT-China/Achievement2018"> Judging</a>
 +
          </div>
 +
        </div>
 +
      </div>
 +
    </div>
 +
  </div>
 +
<!-- 首页大图 -->
 +
<div class="homepage_img">
 
</div>
 
</div>
 +
<!-- 主体 -->
 +
<div class="container">
 +
  <div class="col-10">
  
 +
    <div>
 +
      <script>
 +
          window.onload=function(){
 +
              btn1.onclick=function(){
 +
                  div1.style.display =
 +
                      !div1.style.display||div1.style.display=='block' ? 'none':'block';
 +
                  div21.style.display='none';
 +
                  div31.style.display='none';
 +
                  div41.style.display='none';
 +
                  div51.style.display='none';
 +
                  div61.style.display='none';
  
 +
              }
 +
              btn2.onclick=function(){
 +
                div1.style.display='none';
 +
              }
 +
              btn21.onclick=function(){
 +
                  div21.style.display =
 +
                      !div21.style.display||div21.style.display=='block' ? 'none':'block';
 +
                      div1.style.display='none';
 +
                      div31.style.display='none';
 +
                      div41.style.display='none';
 +
                      div51.style.display='none';
 +
                      div61.style.display='none';
  
 +
              }
 +
              btn22.onclick=function(){
 +
                div21.style.display='none';
 +
              }
 +
              btn31.onclick=function(){
 +
                  div31.style.display =
 +
                      !div31.style.display||div31.style.display=='block' ? 'none':'block';
 +
                      div21.style.display='none';
 +
                      div1.style.display='none';
 +
                      div41.style.display='none';
 +
                      div51.style.display='none';
 +
                      div61.style.display='none';
 +
              }
 +
              btn32.onclick=function(){
 +
                div31.style.display='none';
 +
              }
 +
              btn41.onclick=function(){
 +
                  div41.style.display =
 +
                      !div41.style.display||div41.style.display=='block' ? 'none':'block';
 +
                      div21.style.display='none';
 +
                      div31.style.display='none';
 +
                      div1.style.display='none';
 +
                      div51.style.display='none';
 +
                      div61.style.display='none';
 +
              }
 +
              btn42.onclick=function(){
 +
                div41.style.display='none';
 +
              }
 +
              btn51.onclick=function(){
 +
                  div51.style.display =
 +
                      !div51.style.display||div51.style.display=='block' ? 'none':'block';
 +
                      div21.style.display='none';
 +
                      div31.style.display='none';
 +
                      div41.style.display='none';
 +
                      div1.style.display='none';
 +
                      div61.style.display='none';
 +
              }
 +
              btn52.onclick=function(){
 +
                div51.style.display='none';
 +
              }
 +
              btn61.onclick=function(){
 +
                  div61.style.display =
 +
                      !div61.style.display||div61.style.display=='block' ? 'none':'block';
 +
                      div21.style.display='none';
 +
                      div31.style.display='none';
 +
                      div41.style.display='none';
 +
                      div51.style.display='none';
 +
                      div1.style.display='none';
 +
              }
 +
              btn62.onclick=function(){
 +
                div61.style.display='none';
 +
              }
 +
          }
  
 +
        </script>
 +
        <div class="btn">
 +
          <button type="button" name="button" id="btn1">Light-controlled system</button>
 +
        </div>
 +
        <div class="btn">
 +
          <button type="button" name="button" id="btn21">sgRNA-cm</button>
 +
        </div>
 +
        <div class="btn">
 +
          <button type="button" name="button" id="btn31">P<sub>BAD</sub>-Cas9</button>
 +
        </div>
 +
        <div class="btn">
 +
          <button type="button" name="button" id="btn41">Light-controlled Cas9 system</button>
 +
        </div>
 +
        <div class="btn">
 +
          <button type="button" name="button" id="btn51">Repression system</button>
 +
        </div>
 +
        <div class="btn">
 +
          <button type="button" name="button" id="btn61">Lysis</button>
 +
        </div>
 +
        <div id="div1">
 +
          <h1>Light-controlled system</h1>
 +
          <h2>3.Experimental results</h2>
 +
          <h2>3.1.Comparison of the efficiency of the light-controlled gene expression system in different host <i>E. coli</i> strains</h2>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/2/29/T--ZJUT-China--designyu7.png" alt="">
 +
          </div>
 +
            <div class="note">Figure 5. Light-controlled gene expression system in DH5α</div>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/f/f2/T--ZJUT-China--designyu8.png" alt="">
 +
          </div>
 +
          <div class="note">Figure 6. Light-controlled gene expression system in BL21</div>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/d/de/T--ZJUT-China--designyu9.png" alt="">
 +
          </div>
 +
          <div class="note">Figure 7. Light-controlled gene expression system in MG1655</div>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/9/9e/T--ZJUT-China--designyu10.png" alt="">
 +
          </div>
 +
          <div class="note">Figure 8. Light-controlled gene expression system in BW25113</div>
 +
          <h2>3.2.Replacing the promoter PJ23100 with T7
 +
          </h2>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/a/ab/T--ZJUT-China--designyu11.png" alt="">
 +
          </div>
 +
          <div class="note">Figure 9. PCR amplification of T7 promoter and linearization of the vector for expressing the light-controlled system</div>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/b/b0/T--ZJUT-China--1018.png" alt="">
 +
          </div>
 +
          <h2>3.3.Elimination of the template plasmid with DpnI</h2>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/d/d6/T--ZJUT-China--designyu12.png" alt="">
 +
          </div>
 +
          <div class="note">Fig. 10 Degrading the template plasmid in the PCR product</div>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/3/35/T--ZJUT-China--10181.png" alt="">
 +
          </div>
 +
          <h2>3.4.The results of T7-involved light-controlled system effect detection</h2>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/3/3e/T--ZJUT-China--designyu14.png" alt="">
 +
          </div>
 +
          <div class="note">Figure 11. Effect of IPTG on T7 regulated light-controlled system</div>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/7/79/T--ZJUT-China--designyu16.png" alt="">
 +
          </div>
 +
          <button type="button" name="button"id="btn2">Back</button>
 +
          <p><br></p>
 +
        </div>
  
−
</html>
+
        <div id="div21">
 +
          <h1>sgRNA-cm</h1>
 +
          <h2>Test CRISPR/Cas9 system</h2>
 +
          <p>
 +
            We evaluated a CRISPR/Cas9 system with MG1655 and MG1655 ΔpanD. The two strains were transformed with pCas, which expresses Cas9. The sgRNA which targets to a site in the panD gene was expressed in a plasmid pTargetF-panD. The pTargetF-panD was able to transform MG1655 ΔpanD pCas9, but not MG1655 pCas9, indicating that CRISPR/Cas9 was able to recognize and cut DNA in the chromosomal gene.
 +
          </p>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/6/63/T--ZJUT-China--10182.png" alt="">
 +
          </div>
 +
          <div class="note">Table 1. Transformants culture result</div>
 +
          <p>Our target:</p>
 +
          <p>
 +
            GTCCTAGGTATAATACTAGTGGCAATGAAAGACGGTGAGCGTTTTAGAGCTAGAAATAGC
 +
          </p>
 +
          <h2>sequencing results :</h2>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/5/5d/T--ZJUT-China--design22.png" alt="">
 +
          </div>
 +
          <p>Sequencing results showed successful construction.</p>
 +
          <h2>Test pTargetF-cm</h2>
 +
          <p>
 +
          To test whether the CRISPR/Cas9 can cut an ARG, we designed an sgRNA which targeted to the chloramphenicol resistance gene. The sgRNA was expressed in pTargetF-cm. which was transformed into MG1655 ΔpanD carrying a chloramphenicol resistance gene. We observed that all transformants grew in the medium without chloramphenicol, but failed to grow in the medium with chloramphenicol. The experiment showed that the CRISPR/Cas9 system was able to cut ARG in the genome.
 +
          </p>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/b/b9/T--ZJUT-China--design23.png" alt="">
 +
          </div>
 +
          <div class="note">Figure 1. The result of culture</div>
 +
          <button type="button" name="button"id="btn22">Back</button>
 +
          <p><br></p>
 +
        </div>
 +
 
 +
        <div id="div31">
 +
          <h1>P<sub>BAD</sub>-Cas9</h1>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/9/90/T--ZJUT-China--yuan2.png" alt="">
 +
          </div>
 +
          <div class="note">
 +
            Fig.1 Growth curve, add 10mM ara after 3 hours of culture
 +
          </div>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/c/c0/T--ZJUT-China--yuan3.png" alt="">
 +
          </div>
 +
          <div class="note">
 +
            Fig.2 Growth curve, add ara after 5 hours of culture
 +
          </div>
 +
          <p>
 +
            In our experiment we required transformation data and two growth curve in the end. Fig.1 shows that after adding arabinose, <i>E. coli</i> MG1655 with P<sub>BAD</sub>-Cas9 plasmid stopped growing. We used OD<sub>600</sub> to characterize the cells amount so to proving that the expression of Cas9 protein can be regulated by 10mM arabinose. Fig.2 shows how different concentrations of arabinose affects the Cas9 expression.
 +
 
 +
          </p>  <p>In the chloramphenicol gene cleavage experiment, we used a plate containing ara for transformation experiments, and the cleavage of the chloramphenicol gene could be characterized by transformation efficiency. The results are showed in Table 1:
 +
          </p>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/e/e7/T--ZJUT-China--yuan4.png" alt="">
 +
          </div>
 +
          <p>
 +
            Our results show that inducing the expression of Cas9 using ara has no effect on the transformation efficiency of wild type, and the transformation efficiency of <i>E. coli</i> cmR is greatly reduced. Therefore, we can conclude that the transformation efficiency is reduced because Cas9 cleaves the chloramphenicol gene on the genome under the guidance of sgRNA-cm. Moreover, when we did not add Ara, the transformation efficiency of <i>E. coli</i> cmR was also lower than that of <i>E. coli</i> wild type. This suggests that Cas9 exhibits high gene cleavage efficiency in bacteria because P<sub>BAD</sub> is a well-regulated promoter.
 +
          </p>
 +
            <button type="button" name="button"id="btn32">Back</button>
 +
                <p><br></p>
 +
        </div>
 +
 
 +
        <div id="div41">
 +
          <h1>Light-controlled Cas9 system</h1>
 +
          <p>Under light and dark conditions, the transformation efficiencies with pTargetF-panD were 1.185 and 1.295 folds of thoese with pTargetF-cm respectively, demonstrating that pTargetF-cm could guide Cas9 to the cm gene on the genome and resulted in the decrease of transformation efficiency. The result also reflects that the blue light provided cannot completely suppress the expression of CRISPR/Cas9. It is also remarkable that the transformation efficiency with pTargetF-cm under the dark condition was lower than that under the light condition, indicating that the CRISPR/Cas9 system showed stronger activity under dark condition, achieving the purpose of cutting a resistance gene with the light-controlled CRISPR/Cas9 system.
 +
          </p>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/2/20/T--ZJUT-China--design25.png" alt="">
 +
          </div>
 +
          <div class="note">Figure1. Transformation of the plasmid carrying the light-controlled CRISPR/Cas9 system under dark and light conditions</div>
 +
            <button type="button" name="button"id="btn42">Back</button>
 +
                      <p><br></p>
 +
        </div>
 +
 
 +
        <div id="div51">
 +
          <h1>Repression system</h1>
 +
          <h2>▶First step</h2>
 +
          <h2>Aim</h2>
 +
          <p>We’d like to achieve the following purposes:
 +
          </p>  <p>  1、Construct a part with repression system.
 +
          </p>  <p>    2、Maximize the repression effect.
 +
        </p>  <p>    3、Select a more suitable system through comparison.
 +
          </p>
 +
          <h2>Experimental details</h2>
 +
          <h2>●lacI-P<sub>lac</sub></h2>
 +
          <h2>（1）Obtain Objective strain</h2>
 +
          <p>For testing this device we used DH5α cells which contain the plasmid named pGLO-lacI. This plasmid contains the parts (BBa_K2556032) we wanted to test. The steps are as follow:
 +
        </p>  <p> ①pCAS was cultured in the test tube with liquid LB medium. After 12 hours, we extracted the plasmid DNA and measured the concentration.
 +
          </p>  <p>  ②We prepared the insertion fragment and the linearized carrier（pGLO）by PCR. Then the PCR products were de-templated by DpnⅠ, then purified by TaKaRa kit to prepare for ligation.
 +
          </p>  <p>  ③Construct plasmids named pGLO-lacI by One step cloning
 +
          </p>  <p> ④Transform the pGLO-lacI into <i>E. coli</i> DH5α by Heat Shock and 10-100μL plated on antibiotic selective media(AMP).
 +
        </p>  <p>  ⑤Colony PCR and ideal colonies were selected, sequenced by company. We preserved the strain and began to test the effectiveness of the repression system.
 +
          </p>
 +
          <h2>Verify the function of repression of lacI</h2>
 +
          <p>①Strain contained target plasmid was cultured in the test tubes with liquid minimal medium. Different conditions are set in each test tube and the conditions can be seen clearly from the chart below. (Parallel three groups)
 +
          </p>  <p>②OD<sub>600</sub> and GFP values of the bacterial culture were measured periodically with the automatic microplate reader. For green fluorescence, excitation and emission wavelengths were 395 and 509 nm.
 +
          </p>  <p>③Draw charts using measured data to verify the function of repression of lacI
 +
          </p>
 +
          <h2>（3）Maximize the repression effect.</h2>
 +
          <p>①Strain contained target plasmid was cultured in the test tubes with liquid minimal medium. And the concentration gradients of arabinose were set in these tubes(2×10<sup>-5</sup>M,4×10<sup>-5</sup>M,8×10<sup>-5</sup>M,1.6×10<sup>-4</sup>M,3.2×10<sup>-4</sup>M）.
 +
          </p>  <p>②OD<sub>600</sub> and GFP values of the bacterial culture were measured periodically with the automatic microplate reader. For green fluorescence, excitation and emission wavelengths were 395 and 509 nm.
 +
            </p>  <p>③Draw charts using measured data to observe the trends of repression.
 +
          </p>
 +
          <h2>●cI-P<sub>R</sub></h2>
 +
          <p>The same as above.</p>
 +
          <h2>●lacI-P<sub>lac</sub></h2>
 +
          <p>
 +
            (1)Verify the function of repression of lacI
 +
            </p>  <p>The time history plot of Relative Fluorescence Unit of the objective strain(The strain contains the plasmid named pGLO-lacI） under different conditions is shown in Fig.1
 +
          </p>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/3/31/T--ZJUT-China--10183.png" alt="">
 +
          </div>
 +
          <div class="note">Fig.1 The Relative Fluorescence Unit of the objective strain</div>
 +
          <h2>(2)Maximize the repression effect </h2>
 +
          <p>The time history plot of Relative Fluorescence Unit of the objective strain(The strain contains the plasmid named pGLO-lacI） under different concentration of arabinose is shown in Fig.2
 +
          </p>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/2/26/T--ZJUT-China--part12.png" alt="">
 +
          </div>
 +
          <div class="note">Fig.2 The Relative Fluorescence Unit of the objective strain</div>
 +
          <h2>●cI-P<sub>R</sub></h2>
 +
          <p>
 +
            The time history plot of Relative Fluorescence Unit of the objective strain(The strain contains the plasmid named pGLO-cI） under concentration of arabinose is shown in Fig.3
 +
          </p>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/1/1e/T--ZJUT-China--design523.png" alt="">
 +
          </div>
 +
          <div class="note">Fig.3 The Relative Fluorescence Unit of the objective strain</div>
 +
          <h2>Conclusions and analysis</h2>
 +
          <p>①We construct both two parts with repression function (lacI-P<sub>lac</sub>, cI-P<sub>R</sub>) successfully.
 +
          </p>  <p>  lacI-P<sub>lac</sub>: By adding arabinose to induce the expression of LacI protein, the Relative Fluorescence Unit of the objective strain is lower which illustrate the effect of repressor. And, when adding the IPTG, the Relative Fluorescence Unit of the objective strain is higher which also prove the expression of LacI protein.
 +
          </p>  <p>  cI-P<sub>R</sub>：By adding arabinose to induce the expression of cI protein, the Relative Fluorescence Unit of the objective strain is lower which illustrate the effect of repressor.
 +
          </p>  <p>  ②We gain two time history plots which are shown in Fig.2 and Fig.3 respectively.
 +
          </p>  <p>  lacI-P<sub>lac</sub>: When the concentration of arabinose is 2×10<sup>-5</sup>M and 8×10<sup>-5</sup>M,the repression effect of LacI repressor is relatively close. Compared with these concentration, repression effect of LacI repressor increases after 30h under the concentration of arabinose is 16×10<sup>-5</sup>M and decreases before 40h under the concentration of arabinose is 4×10<sup>-5</sup>M .
 +
          </p>  <p>  cI-P<sub>R</sub>：Only when the concentration of arabinose is 2×10<sup>-5</sup>M, this part could inhibit the transcription of downstream.
 +
          </p>  <p>  ②We select lacI-P<sub>lac</sub> as our final repression system. Because lacI-P<sub>lac</sub> can maintain the stable effect of repression at different concentrations but cI-PR didn’t show that.
 +
            </p>
 +
          <h2>▶Second step</h2>
 +
          <h2>Aim</h2>
 +
          <p>We aim to use the lacI repression system to regular the transcription of sgRNA which is designed to specifically bind to the gene panD on the <i>E. coli</i> genome.
 +
          </p>
 +
          <h2>Experimental details</h2>
 +
          <h2>●lacI-P<sub>lac</sub>-sgRNA</h2>
 +
          <p>We constructed two compatible plasmids containing the sgRNA-regulated transcriptional system (BBa_K2556042) and the Cas9 protein, respectively. And then we introduced two plasmids into <i>E. coli</i> MG1655. After obtaining the transformants, we tried to demonstrate the difference of the transcriptional level of sgRNA by analyzing the growth curves in four different conditions (①+2×10<sup>-5</sup>M Ara +2×10<sup>-5</sup>M IPTG ②+2×10<sup>-5</sup>M Ara ③+2×10<sup>-5</sup>M IPTG ④None) . If sgRNA transcribe correctly, the CRISPR/Cas9 system will be activated. That means the target gene panD will be cut and the <i>E. coli</i> couldn’t survive.
 +
          </p>
 +
          <h2>Results</h2>
 +
          <h2>●lacI-P<sub>lac</sub>-sgRNA</h2>
 +
          <p>
 +
            We did three sets of parallel experiments and the result is shown in Fig.4.
 +
          </p>
 +
          <div class="designimg">
 +
            <img src="https://static.igem.org/mediawiki/2018/c/ca/T--ZJUT-China--10184.png" alt="">
 +
          </div>
 +
          <div class="note">Fig.4 The growth curves in four different conditions</div>
 +
          <h2>Conclusions and analysis</h2>
 +
          <p>
 +
            Analysis of the experimental results revealed that the lacI repression system couldn’t regulate the transcription of sgRNA successfully, because the four growth curves in different conditions are very similar. We suspect the lac operator which directly links to the sgRNA affects its conformation so that the sgRNA can’t be unable to function properly.
 +
          </p>  <p> After consulting the literatures, we demonstrated it was exactly a DNA sequence before the sgRNA that prevented it from maturation. And it also didn’t work when we added a repeat artificially before sgRNA. Because it has been published that tracrRNA directs the maturation of crRNAs by the activities of the widely conserved endogenous RNase III and the CRISPR-associated Csn1 protein. This limits the use of the CRISPR/Cas9 system in <i>E. coli</i>.
 +
          </p>  <p>Here we present two solutions. First, try to find a suitable repression system to replace the lacI repression system, which means sgRNA should be linked directly to the transcription initiation site (TSS). Second, activate the type I CRISPR/Cas system in <i>E. coli</i> because of the less limitation in comparison with the type II CRISPR/Cas system.
 +
          </p>
 +
            <button type="button" name="button"id="btn52">Back</button>
 +
            <p><br></p>
 +
        </div>
 +
 
 +
        <div id="div61">
 +
          <h1>Lysis</h1>
 +
            <p>Before genome editing, we first tested the cleavage function of the part containing the genomic homology arm on the plasmid. Our part is built on the T vector. The result is shown in Fig 1:
 +
            </p>
 +
            <div class="designimg">
 +
              <img src="https://static.igem.org/mediawiki/2018/b/bf/T--ZJUT-China--partl2.png" alt="" alt="">
 +
            </div>
 +
            <div class="note">
 +
              Fig.1 Growth curve
 +
            </div>
 +
            <p>
 +
              Our results show that when we added arabinose(the concentration is 10mM) to induce <i>lysin</i> gene expression, the OD<sub>600</sub> value of the bacterial culture was significantly lower than that of the control group without arabinose induction. And comparing with adding arabinose after 4.5 h of culture, when we added arabinose at the beginning, the OD<sub>600</sub> is lower.
 +
            </p><p>Our vector experiments have initially confirmed that the expression of the <i>lysin</i> gene is effective for cell lysis. Based on the results of this experiment, we inserted the lysis part into the <i>E. coli</i> genome by CRISPR/Cas technology. In order to obtain a transformant that was successfully inserted the part into genome, we screened by plate streaking, and the experimental results are shown in Fig 2:
 +
            </p>
 +
            <div class="designimg">
 +
              <img src="https://static.igem.org/mediawiki/2018/9/91/T--ZJUT-China--partl3.png" alt="">
 +
            </div>
 +
              <div class="note">Fig.2 Result of plate streaking</div>
 +
             
 +
           
 +
           
 +
            <p>We selected 34 transformants for plate streaking, and 5 of them showed lysis effects on arabinose containing plates. They were probably the strain we have insert lysis part into genome. And finally we got a strain with a significant lysis effect0-9 after arabinose induction, and we named it <I>E. coli</i> MG1655-Lysis. You can see the result in Fig. 3.</p>
 +
            <div class="designimg">
 +
              <img src="https://static.igem.org/mediawiki/2018/8/8e/T--ZJUT-China--partl4.png" alt="" >
 +
            </div>
 +
              <div class="note">Fig.3 <i>E. coli</i> MG1655-Lysis cultured in tubes</div>
 +
 
 +
            <button type="button" name="button"id="btn62">Back</button>
 +
                <p><br></p>
 +
        </div>
 +
    </div>
 +
 
 +
  </div>
 +
</div>
 +
  <!-- 底部信息 -->
 +
  <div class="footer">
 +
    <div class="foottop">
 +
      <div class="footmessage-left">
 +
        <img src="https://static.igem.org/mediawiki/2018/4/4c/T--ZJUT-China--%E6%B5%99%E5%B7%A5%E5%A4%A7.jpg"  width="348px" alt="工大首页">
 +
        <img src="https://static.igem.org/mediawiki/2018/e/e8/T--ZJUT-China--%E6%B5%99%E5%B7%A5%E5%A4%A7%E7%94%9F%E5%B7%A5%E5%AD%A6%E9%99%A2.jpg" alt="生工首页">
 +
      </div>
 +
      <div class="footmessage-left2">
 +
        <img src="https://static.igem.org/mediawiki/2018/f/f6/T--ZJUT-China--logo5.png" alt="">
 +
        <img src="https://static.igem.org/mediawiki/2018/d/db/HQ_IDT_logo.jpg" alt="" >
 +
        <img src="https://static.igem.org/mediawiki/2018/1/1e/T--ZJUT-China--logo6.png" alt="">
 +
        <img src="https://static.igem.org/mediawiki/2018/f/fe/New-mathworks_logo.jpg" alt="">
 +
      </div>
 +
      <div class="footmessage-middle">
 +
          <img src="https://static.igem.org/mediawiki/2018/b/be/T--ZJUT-China--%E5%85%AC%E4%BC%97%E5%8F%B7%E4%BA%8C%E7%BB%B4%E7%A0%81.jpg" alt="公众号二维码">
 +
      </div>
 +
      <div class="footmessage-right">
 +
        <h3>Contact</h3>
 +
        <p>
 +
        <br><br>
 +
        College of Biotechnology and Bioengineering
 +
        <br><br>Zhejiang University of Technology
 +
        <br><br>Chaowang Rd. 18, 310014, Hangzhou, China
 +
        <br><br>E-mail: cbb@zjut.edu.cn  Tel: +86-571-88320391
 +
        </p>
 +
      </div>
 +
    </div>
 +
    <div class="footbottom">
 +
      <div class="note">
 +
      Copyright © 2018 ZJUT-China
 +
      </div>
 +
    </div>
 +
  </div>

Latest revision as of 01:15, 18 October 2018

CRISPR Team:ZJUT-China - 2018.igem.org

Loading menubar.....

Team:ZJUT-China

Home
Team
Team Members Attributions Collaborations
Project
Description Design Results Demonstrate
Parts
All parts Improve
Lab
Notebook Protocols Safety Interlab
Human Practices
Integrated hp Public Engagement & Education
Modeling
Judging

Light-controlled system

3.Experimental results

3.1.Comparison of the efficiency of the light-controlled gene expression system in different host E. coli strains

Figure 5. Light-controlled gene expression system in DH5α
Figure 6. Light-controlled gene expression system in BL21
Figure 7. Light-controlled gene expression system in MG1655
Figure 8. Light-controlled gene expression system in BW25113

3.2.Replacing the promoter PJ23100 with T7

Figure 9. PCR amplification of T7 promoter and linearization of the vector for expressing the light-controlled system

3.3.Elimination of the template plasmid with DpnI

Fig. 10 Degrading the template plasmid in the PCR product

3.4.The results of T7-involved light-controlled system effect detection

Figure 11. Effect of IPTG on T7 regulated light-controlled system


sgRNA-cm

Test CRISPR/Cas9 system

We evaluated a CRISPR/Cas9 system with MG1655 and MG1655 ΔpanD. The two strains were transformed with pCas, which expresses Cas9. The sgRNA which targets to a site in the panD gene was expressed in a plasmid pTargetF-panD. The pTargetF-panD was able to transform MG1655 ΔpanD pCas9, but not MG1655 pCas9, indicating that CRISPR/Cas9 was able to recognize and cut DNA in the chromosomal gene.

Table 1. Transformants culture result

Our target:

GTCCTAGGTATAATACTAGTGGCAATGAAAGACGGTGAGCGTTTTAGAGCTAGAAATAGC

sequencing results :

Sequencing results showed successful construction.

Test pTargetF-cm

To test whether the CRISPR/Cas9 can cut an ARG, we designed an sgRNA which targeted to the chloramphenicol resistance gene. The sgRNA was expressed in pTargetF-cm. which was transformed into MG1655 ΔpanD carrying a chloramphenicol resistance gene. We observed that all transformants grew in the medium without chloramphenicol, but failed to grow in the medium with chloramphenicol. The experiment showed that the CRISPR/Cas9 system was able to cut ARG in the genome.

Figure 1. The result of culture


PBAD-Cas9

Fig.1 Growth curve, add 10mM ara after 3 hours of culture
Fig.2 Growth curve, add ara after 5 hours of culture

In our experiment we required transformation data and two growth curve in the end. Fig.1 shows that after adding arabinose, E. coli MG1655 with PBAD-Cas9 plasmid stopped growing. We used OD600 to characterize the cells amount so to proving that the expression of Cas9 protein can be regulated by 10mM arabinose. Fig.2 shows how different concentrations of arabinose affects the Cas9 expression.

In the chloramphenicol gene cleavage experiment, we used a plate containing ara for transformation experiments, and the cleavage of the chloramphenicol gene could be characterized by transformation efficiency. The results are showed in Table 1:

Our results show that inducing the expression of Cas9 using ara has no effect on the transformation efficiency of wild type, and the transformation efficiency of E. coli cmR is greatly reduced. Therefore, we can conclude that the transformation efficiency is reduced because Cas9 cleaves the chloramphenicol gene on the genome under the guidance of sgRNA-cm. Moreover, when we did not add Ara, the transformation efficiency of E. coli cmR was also lower than that of E. coli wild type. This suggests that Cas9 exhibits high gene cleavage efficiency in bacteria because PBAD is a well-regulated promoter.


Light-controlled Cas9 system

Under light and dark conditions, the transformation efficiencies with pTargetF-panD were 1.185 and 1.295 folds of thoese with pTargetF-cm respectively, demonstrating that pTargetF-cm could guide Cas9 to the cm gene on the genome and resulted in the decrease of transformation efficiency. The result also reflects that the blue light provided cannot completely suppress the expression of CRISPR/Cas9. It is also remarkable that the transformation efficiency with pTargetF-cm under the dark condition was lower than that under the light condition, indicating that the CRISPR/Cas9 system showed stronger activity under dark condition, achieving the purpose of cutting a resistance gene with the light-controlled CRISPR/Cas9 system.

Figure1. Transformation of the plasmid carrying the light-controlled CRISPR/Cas9 system under dark and light conditions


Repression system

▶First step

Aim

We’d like to achieve the following purposes:

1、Construct a part with repression system.

2、Maximize the repression effect.

3、Select a more suitable system through comparison.

Experimental details

●lacI-Plac

（1）Obtain Objective strain

For testing this device we used DH5α cells which contain the plasmid named pGLO-lacI. This plasmid contains the parts (BBa_K2556032) we wanted to test. The steps are as follow:

①pCAS was cultured in the test tube with liquid LB medium. After 12 hours, we extracted the plasmid DNA and measured the concentration.

②We prepared the insertion fragment and the linearized carrier（pGLO）by PCR. Then the PCR products were de-templated by DpnⅠ, then purified by TaKaRa kit to prepare for ligation.

③Construct plasmids named pGLO-lacI by One step cloning

④Transform the pGLO-lacI into E. coli DH5α by Heat Shock and 10-100μL plated on antibiotic selective media(AMP).

⑤Colony PCR and ideal colonies were selected, sequenced by company. We preserved the strain and began to test the effectiveness of the repression system.

Verify the function of repression of lacI

①Strain contained target plasmid was cultured in the test tubes with liquid minimal medium. Different conditions are set in each test tube and the conditions can be seen clearly from the chart below. (Parallel three groups)

②OD600 and GFP values of the bacterial culture were measured periodically with the automatic microplate reader. For green fluorescence, excitation and emission wavelengths were 395 and 509 nm.

③Draw charts using measured data to verify the function of repression of lacI

（3）Maximize the repression effect.

①Strain contained target plasmid was cultured in the test tubes with liquid minimal medium. And the concentration gradients of arabinose were set in these tubes(2×10-5M,4×10-5M,8×10-5M,1.6×10-4M,3.2×10-4M）.

②OD600 and GFP values of the bacterial culture were measured periodically with the automatic microplate reader. For green fluorescence, excitation and emission wavelengths were 395 and 509 nm.

③Draw charts using measured data to observe the trends of repression.

●cI-PR

The same as above.

●lacI-Plac

(1)Verify the function of repression of lacI

The time history plot of Relative Fluorescence Unit of the objective strain(The strain contains the plasmid named pGLO-lacI） under different conditions is shown in Fig.1

Fig.1 The Relative Fluorescence Unit of the objective strain

(2)Maximize the repression effect

The time history plot of Relative Fluorescence Unit of the objective strain(The strain contains the plasmid named pGLO-lacI） under different concentration of arabinose is shown in Fig.2

Fig.2 The Relative Fluorescence Unit of the objective strain

●cI-PR

The time history plot of Relative Fluorescence Unit of the objective strain(The strain contains the plasmid named pGLO-cI） under concentration of arabinose is shown in Fig.3

Fig.3 The Relative Fluorescence Unit of the objective strain

Conclusions and analysis

①We construct both two parts with repression function (lacI-Plac, cI-PR) successfully.

lacI-Plac: By adding arabinose to induce the expression of LacI protein, the Relative Fluorescence Unit of the objective strain is lower which illustrate the effect of repressor. And, when adding the IPTG, the Relative Fluorescence Unit of the objective strain is higher which also prove the expression of LacI protein.

cI-PR：By adding arabinose to induce the expression of cI protein, the Relative Fluorescence Unit of the objective strain is lower which illustrate the effect of repressor.

②We gain two time history plots which are shown in Fig.2 and Fig.3 respectively.

lacI-Plac: When the concentration of arabinose is 2×10-5M and 8×10-5M,the repression effect of LacI repressor is relatively close. Compared with these concentration, repression effect of LacI repressor increases after 30h under the concentration of arabinose is 16×10-5M and decreases before 40h under the concentration of arabinose is 4×10-5M .

cI-PR：Only when the concentration of arabinose is 2×10-5M, this part could inhibit the transcription of downstream.

②We select lacI-Plac as our final repression system. Because lacI-Plac can maintain the stable effect of repression at different concentrations but cI-PR didn’t show that.

▶Second step

Aim

We aim to use the lacI repression system to regular the transcription of sgRNA which is designed to specifically bind to the gene panD on the E. coli genome.

Experimental details

●lacI-Plac-sgRNA

We constructed two compatible plasmids containing the sgRNA-regulated transcriptional system (BBa_K2556042) and the Cas9 protein, respectively. And then we introduced two plasmids into E. coli MG1655. After obtaining the transformants, we tried to demonstrate the difference of the transcriptional level of sgRNA by analyzing the growth curves in four different conditions (①+2×10-5M Ara +2×10-5M IPTG ②+2×10-5M Ara ③+2×10-5M IPTG ④None) . If sgRNA transcribe correctly, the CRISPR/Cas9 system will be activated. That means the target gene panD will be cut and the E. coli couldn’t survive.

Results

●lacI-Plac-sgRNA

We did three sets of parallel experiments and the result is shown in Fig.4.

Fig.4 The growth curves in four different conditions

Conclusions and analysis

Analysis of the experimental results revealed that the lacI repression system couldn’t regulate the transcription of sgRNA successfully, because the four growth curves in different conditions are very similar. We suspect the lac operator which directly links to the sgRNA affects its conformation so that the sgRNA can’t be unable to function properly.

After consulting the literatures, we demonstrated it was exactly a DNA sequence before the sgRNA that prevented it from maturation. And it also didn’t work when we added a repeat artificially before sgRNA. Because it has been published that tracrRNA directs the maturation of crRNAs by the activities of the widely conserved endogenous RNase III and the CRISPR-associated Csn1 protein. This limits the use of the CRISPR/Cas9 system in E. coli.

Here we present two solutions. First, try to find a suitable repression system to replace the lacI repression system, which means sgRNA should be linked directly to the transcription initiation site (TSS). Second, activate the type I CRISPR/Cas system in E. coli because of the less limitation in comparison with the type II CRISPR/Cas system.


Lysis

Before genome editing, we first tested the cleavage function of the part containing the genomic homology arm on the plasmid. Our part is built on the T vector. The result is shown in Fig 1:

Fig.1 Growth curve

Our results show that when we added arabinose(the concentration is 10mM) to induce lysin gene expression, the OD600 value of the bacterial culture was significantly lower than that of the control group without arabinose induction. And comparing with adding arabinose after 4.5 h of culture, when we added arabinose at the beginning, the OD600 is lower.

Our vector experiments have initially confirmed that the expression of the lysin gene is effective for cell lysis. Based on the results of this experiment, we inserted the lysis part into the E. coli genome by CRISPR/Cas technology. In order to obtain a transformant that was successfully inserted the part into genome, we screened by plate streaking, and the experimental results are shown in Fig 2:

Fig.2 Result of plate streaking

We selected 34 transformants for plate streaking, and 5 of them showed lysis effects on arabinose containing plates. They were probably the strain we have insert lysis part into genome. And finally we got a strain with a significant lysis effect0-9 after arabinose induction, and we named it E. coli MG1655-Lysis. You can see the result in Fig. 3.

Fig.3 E. coli MG1655-Lysis cultured in tubes


工大首页 生工首页
公众号二维码

Contact



College of Biotechnology and Bioengineering

Zhejiang University of Technology

Chaowang Rd. 18, 310014, Hangzhou, China

E-mail: cbb@zjut.edu.cn Tel: +86-571-88320391

Copyright © 2018 ZJUT-China