Difference between revisions of "Team:TUDelft/Wetlab/Protocols"

Latest revision as of 02:20, 18 October 2018

Preparation of a 1000X antibiotic stock solution:

Weigh X grams of the specific antibiotic of interest.
Resolve in 95% ethanol (Chloramphenicol) or MilliQ (other antibiotics).

This protocol is based on the Pierce BCA protein assay kitby Thermo Scientific protocol.

Prepare a set of protein standards using one 2mg/mL Albumin Standard (BSA) ampule according to the table below:
NOTE: Use the same diluent as the samples. The expected working range = 20-2000µg/mL.

Vial	Volume of MilliQ (µL)	Source of BSA	Volume of source BSA (µL)	Final BSA concentration (µg/µL)
A	0	Stock	300	2000
B	125	Stock	375	1500
C	325	Stock	325	1000
D	175	Vial B	175	750
E	325	Vial C	325	500
F	325	Vial E	325	250
G	325	Vial F	325	125
H	400	Vial G	100	25
I	400	n/a	0	0

Determine the amount of total volume of working reagent (WR) required by using the following formula:
Total volume WR = (# standards + # unknowns) × (# replicates) × (200 µL)
NOTE: With pipetting you always take a bit extra (e.g. 10%), so not exactly the amount needed for x samples
Prepare the BCA working reagent by mixing 50 parts of BCA Reagent A with 1 part of BCA Reagent B (50:1, Reagent A:B).
NOTE: The WR is stable for several days when stored in a closed container at room temperature.
Pipette 25µL of each standard or unknown sample replicate into a microplate well.
Add 200µL of the WR to each well and mix plate thoroughly.
Cover plate and incubate at 37 °C for 30 minutes.
Cool plate to room temperature.
Measure the absorbance at or near 562nm on a plate reader.

Thaw the ligase buffer on ice, to prevent damaging the ATP

For phosphorylation, prepare a sample a sample as follows:

Component	Volume (µL)
10x Ligase buffer	2.5
T4 DNA Ligase	1
ATP	2.5
T4 PNK enzyme	1
DNA vector	X (~250 ng)
DNA fragment	Y*
MilliQ	Up to 25 µL

* NOTE: The desired vector:insert ratio will be 1:3. Use a ligation calculator to calculate the amounts of vector DNA and insert DNA to be added.

Incubate for at one hour at 37 °C.
Cancel phosphorylation process by incubating for 30 minutes at 65 °C.
Add 1 µL of Ligase T4 and incubate for at least four hours at 4 °C.

Centrifuge the whole blood (9mL EDTA anticoagulated tube) at 1200 x g for 10 minutes.
Pipet of the plasma carefully (approximately 4 to 4.5mL) and put in a separate tube. When you only want the cfDNA and not the white blood cells be sure to not disturb the buffycoat with the pipet.
Centrifuge the plasma at 24000 x g for 20 minutes.
Take of the plasma without disturbing the pallet and aliquot into 1.5mL tubes, 1mL per tube.
Store at -20 °C.
For every follow up steps frozen aliquots can be taken from the freezer and thawed at room temperature. When thawed, the samples should be directly processed. Avoid thawing and freezing cycles, since this will cause degradation of cfDNA.

F. Thurik (2016). Cell-free placental DNA beyond Down syndrome.

NOTE: All work is performed under asceptic conditions.

For one cryostock, take a 1.5mL sample from an overnight liquid culture.
Centrifuge the 2mL tubes at 2000rpm for 10 min.
Decant the supernatant without disturbing the pellet.
Add fresh sterile LB medium to the pellet, 1/3 volume of the starting volume of the culture.
Completely resuspended the pellet by vortexing the tube.
Add sterile 80% glycerol solution, the same volume as fresh LB in step 4.
Mix by vortexing.
Make a 1mL aliquot in cryotubes and label it with the cell type, plasmid type, protein type, operator and date.
Store the vials at -80 ºC and update the inventory.

This protocol s over 3 days of execution time, starting from a -80 °C mother stock. Throughout the protocol, it is recommended to work under aseptic conditions in order to prevent contamination risks.

Day 1

Keep the -80 °C strain stock of interest on ice.
Streak the strain on solid selective medium and incubate overnight at 37 °C while shaking.

Day 2

Prepare a 10mL liquid starter culture with one of the colonies that grew on the selective plate. Let the culture grow overnight at 37 °C, shaking at 180rpm.
Sterilise solutions of 100 mM CaCl₂ and of 100 mM CaCl₂ + 15 % Glycerol in advance.
NOTE: Volumes depend on the total culture volume to be prepared in step 5. For example, if 1L is used in step 7, 300mL of 100mM CaCl₂ and 10mL of 100mM CaCl₂ + 15% glycerol will be used.

Day 3

Inoculate 1:100 of overnight culture in the desired volume of LB with antibiotic when required (eg. 10mL of culture in 1L of LB).
Incubate in a shaker at 37 °C, 180rpm to OD600nm ~0.4-0.6 (measure OD600nm every 30 minutes).
Harvests the cells by centrifugation at 4000 x g for 5 minutes in centrifuge tubes, decant supernatant.
Resuspend cells by gently pipetting 1/5 (of the volume of LB from step 5) of ice-cold 100 mM CaCl₂ and incubate on ice for 20 minutes.
Pellet the cells by centrifugation at 4000 x g for 5 minutes in centrifuge tubes, decant supernatant.
Resuspend cells by gently pipetting 1/10 (of the volume of LB from step 5) of ice-cold 100 mM CaCl₂ and incubate on ice for 60 minutes.
Pellet the cells by centrifugation at 4000 x g for 5 minutes in centrifuge tubes, decant supernatant.
Resuspend cells by gently pipetting 1/100 (of the volume of LB from step 5) of ice-cold 100 mM CaCl₂ + 15% glycerol and keep on ice.
Chemical competent cells can either immediately be used for heat shock transformation or stored in aliquots of 50µL in microcentrifuge tubes at -80 °C.

Get as many aliquots of competent cells (50µL) from the -80 °C freezer as transformations to be done and put them on ice for 10-15 min.
NOTE: Do not forget positive and negative controls (no DNA). If commercial competent cells (highly efficient) are used, an aliquot of 50µL can be split in two equal volumes of 25 µL and used for two transformations.
Add DNA of interest to the 50µL of competent cells.
1. Gibson Assembly mixture: 5µL
2. Ligation mixture: 5µL
3. Plasmids: 10 ng, volume depends on the plasmid concentration
Incubate on ice for 10-20 minutes.
Heat shock at 42 °C for exactly 45 seconds.
Add 200µL of hand-warm LB-medium.
Incubate at 37 °C with shaking (250 rpm) for 1 hour.
Plate the cells on LB-agar plates with the correct antibiotic to select for the introduced plasmid . 50-75µL can be plated on one plate. The remaining cell culture can be pelleted and resuspended in some residual supernatant prior to plating.
NOTE: When adding more than 200µL LB medium during step 5, plate out 100µL on selective medium. Then, briefly centrifuge the remaining cell culture and plate out the cell pellet on selective medium.
Incubate plates at 37 °C overnight.
NOTE: Alternatively, you can incubate over the weekend, leaving the plate on the bench.

Under aseptic conditions, pick a colony, resuspend it in 10µL of MilliQ water.
NOTE: A picked colony cannot be used again; it is recommended to restreak on a 'back-up'-plate with the same pipet tips and incubate it overnight at 37 °C.
Incubate the resuspended colony at 90 °C for 10 min. Spin the suspension down and use the supernatant as template DNA for the PCR.
NOTE: Instead of separate boiling prior to PCR, this step can be incorporated in the PCR program. The initial denaturation step at 98 °C should then be prolonged to 5 minutes.

Make sure every PCR reaction is composed as follows:

Component	Volume (µL)	Final concentration
Gotaq 5X buffer*	10	1X
10mM dNTPs	1	200µM
Primer forward (10µM)	1	200nM
Primer reverse (10µM)	1	200nM
Boiled colony supernatant	5
Gotaq polymerase (5U/µL)	0.2	20U/mL
MilliQ	31.8

* NOTE: Use Gotaq Buffer Green when it is required to run a verification gel afterwards.

Add 5µL of supernatant of colony mixture to each PCR tube.

Close all tubes thoroughly and place them in a thermocycler with the following protocol:

Step	Time (s)	Temperature (°C)
Initial denaturation	150	98
Denaturation	60	94
Annealing	60	T_ann*
Extension	60 sec per kb DNA	72
Final extension	600	72
Hold	∞	4

*NOTE: The annealing temperature (T_ann) is dependent on the melting temperature (T_m) of the primers used. It is recommended to have T_ann = T_m - 5 °C.

The PCR product(s) can be checked on a agarose gel. In order to do so, cast a gel and prepare the samples according to the DNA electrophoresis protocol.

The generation of dextrin-capped gold nanoparticles generation was performed according to the protocol described by Anderson et al. 2011.

Prepare the following solutions:
1. 20mM gold chloride salt (HAuCl₄) in MilliQ. Store at 4 ºC.
2. 25g/L dextrin in MilliQ.
3. 10% (w/v) sodium carbonate (Na₂CO₃) in MilliQ.
4. dH2O pH=9, adjusted with sodium hydroxide (NaOH).
Add 25mL of the dextrin solution (25g/L) to a sterile 250mL flask.
Add 5mL of the Gold Chloride salt solution (20mM).
Adjust pH of the solution to pH=9 with 10% (w/v) Na₂CO₃ by checking the pH with pH indicator strips.
Complete the reaction mixture by adding dH2O pH=9 up to a total reaction volume of 50mL.
Incubate the flask at 50 ºC in the dark with continuous shaking (250rpm) for 3 hours.
Measure the absorbance spectrum of the sample every 20 minutes.
NOTE: Change in color to red is the final indication of the ion Au⁺³ reduction to Au⁰.
When the reaction mixture shows a clear shift in color to red, stop the reaction and store the dextrin-capped gold nanoparticle batch at room temperature in a closed glass container in the dark.

References:

Anderson, M.J. et al., 2011. One step alkaline synthesis of biocompatible gold nanoparticles using dextrin as capping agent. Journal of Nanoparticles Research, 13, pp2843–2851

Evaluating of the functionality of dextrin-capped gold nanoparticles is performed in a transparent 96 well plate with flat bottom. There are several analyses being conducted, which are:

Salt stability
ssDNA induced stability.
ssDNA and target DNA stability.

The following table indicates different solutions needed for each type of analysis:

Analysis	d-AuNPs (µL)	ssDNAp (µL)	NaCl solution (X mM) (µL)	dsDNA target (µL)	MilliQ / Hybridization buffer (µL)
Salt stability	20	0	20	0	20
ssDNA induced stability	20	4	20	0	16
ssDNA and target dsDNA induced stability	20	4	20	100	6

For each specific functionality testing reaction, perform the following steps directly in the wells of the 96 wells plate, unless indicated otherwise.

Salt Stability

Add 20µL of MilliQ.
Add 20µL of NaCl solutions (varying concentrations).
Use one well as salt blank by adding 20µL MilliQ instead of NaCl solution.
Add 20µL of d-AuNPs.
Mix gently by pipetting and incubate at 21 ºC during 10 minutes.
Quantify the visible absorption spectrum of the solutions or measure absorbance at 520nm and 620nm.

ssDNAp Induced Stability

Add 4µL of ssDNAp (1µM).
Use one wells as ssDNAp blank by adding 4 µL MilliQ instead of ssDNAp.
Add 16µL of MilliQ.
Add 20µL of NaCl solutions (varying concentrations).
Use one well as salt blank by adding 20µL MilliQ instead of NaCl solution.
Add 20µL of d-AuNPs.
Mix gently by pipetting and incubate at 21 ºC during 10 minutes.
Quantify the visible absorption spectrum of the solutions or measure absorbance at 520nm and 620nm.

ssDNAp and dsDNA Target Induced Stability

Prepare the following reaction in a PCR tube:

Add 4µL of ssDNAp (1µM).
Use one well as ssDNAp blank by adding 4µL MilliQ instead of ssDNAp.
Add 10µL of dsDNA target (~1nM).
Add 6µL of Hybridization buffer.

Mix gently by pipetting and add tubes on thermal cycler with the following program:

Step	Time (s)	Temperature (°C)
Denaturation	300	95
Annealing	60	57
Relaxation	600	20

Add 20µL of the reaction mixture into the wells of 96 well plate
Add 20µL of NaCl solutions (varying concentrations or defined concentration based on previous results).
Use one well as salt blank by adding 20µL MilliQ instead of NaCl solution.
Add 20µL of d-AuNPs.
Mix gently by pipetting and incubate at 21 ºC during 10 minutes.
Quantify the visible absorption spectrum of the solutions or measure absorbance at 520nm and 620nm.

Gel Electrophoresis and DNA staining makes use of mutagenic chemicals like EtBr, SYBR Safe or any other DNA staining. Wear protection (gloves) when carrying out this protocol and work in an assigned area for this work to prevent contamination of the rest of the lab.

For a 0.8% (w/v) gel in TAE, weigh agarose powder for a 0.8% (w/v) gel.
E.g. weigh 1.6g and add to 200mL TAE buffer for a 0.8% gel.
Add weighed agarose in TAE buffer (1X) and warm the solution (in a microwave) until it is completely dissolved. Let the solution cool down to hand warm temperature.
NOTE: Make sure the lid is not completely closed to avoid possible exploding of the glass bottle.
Pour gel in gel tray and mix well with SYBR Safe. For a small gel (~ 40mL solution) add 1µL of SYBR Safe; for a large gel (~80mL) add 2µL of SYBR Safe. Add a comb to create wells for the samples. Allow the agarose to solidify (approximately 20 minutes).
NOTE: For better mixing, add SYBR Safe to bottle instead of tray.
Transfer the gel to the electrophoresis cell, remove the combs and cover the gel in TAE buffer (1X).
NOTE: Mind the direction of DNA migration when placing the gel in the cell.
Prepare the electrophoresis samples by adding Nucleic Acid Loading Buffer conform the manufacturer’s instructions.
Load the molecular weight marker (DNA ladder) in the first well according to manufacturer’s instructions (generally 3-5µL) and load 5-10µL of the dyed samples in the other wells.
NOTE: Do not contaminate the loading buffer and ladder with SYBR Safe! Do not touch it while wearing a glove.
Connect the cables of the gel tray following the colour code and run at 80-110V for 40-60 min.
NOTE: Mind the direction of DNA migration when placing the lid on the cell.
NOTE: Time and voltage depend on the density of the gel and the length of the lane in the gel.

This protocol is based on the Wizard® SV Gel and PCR Clean-Up System of Promega Corporation.

Excise a proper band containing the DNA from gel and place the excised gel slice in a 1.5 mL Eppendorf tube.
Weigh the excised gel slice.
Add 10µL Membrane Binding Solution per 10 mg of gel slice. Vortex and incubate at 50-65 °C until gel slice is completely dissolved.
Insert the SV Minicolumn into the Collection Tube and label both of them according to the labelling of your samples.
Transfer the dissolved gel mixture to the Minicolumn assembly. Incubate the Minicolumn at room temperature for 1 minute.
Centrifuge the SV Minicolumn at maximum speed for 1 minute.
Discard the flow through and reinsert the SV Minicolumn into the Collection Tube.
Add 700µL of Membrane Wash Solution.
NOTE: Upon prior use, dilute the solution with 95% ethanol following the manufacturer's’ instructions.
Centrifuge the SV Minicolumn assembly at maximum speed for 1 minute.
Discard the flow through and reinsert the SV Minicolumn into the Collection Tube.
Repeat the washing step with 500µL of Membrane Wash Solution and centrifuge for 5 minutes at maximum speed.
Once the Collection Tube is empty, centrifuge the Minicolumn assembly at maximum speed for 1 minute with the Minicolumn assembly lid open to allow full evaporation of ethanol
NOTE: Leaving the column at room temperature ameliorates evaporation of residual ethanol traces.
Transfer the SV Minicolumn to a clean labelled 1.5mL Eppendorf tube.
Add 50µL of pre-warmed MilliQ directly to the centre of the SV Minicolumn, without touching the membrane with the pipette tip.
NOTE: Use 30µL when higher final concentrations of DNA are required or when small quantities of DNA are suspected.
Incubate the SV Minicolumn at room temperature for 5 minutes.
Centrifuge at maximum speed for 1 minute.
Discard the SV Minicolumn, cap the tube containing the eluted DNA, measure the DNA concentration and keep the DNA at 4 °C (for immediate use) or -20 °C (for storage).

Our DpnI digestions were performed with New England Biolabs DpnI (20.000 units/mL), which is compatible with CutSmart Buffer by the same manufacturer.

Prepare a sample in a 0.5mL microcentrifuge tube as follows:

Component	Volume (µL)
10x CutSmart buffer (NEB)	4
Purified PCR product	30
Restriction Enzyme DpnI	1
MilliQ	5

Incubate for 1.5 hours at 37 °C.
Heat inactivate the enzyme by incubating at 80 °C for 20 minutes.

This protocol describes how the functionality of the gRNA:dxCas9:DNA complex or the gRNA:dxCas9-Tn5:DNA complex is evaluated to bind to the target DNA using a mobility shift assay. The protocol consists of two parts: binding of dxCas9(-Tn5) to the gRNA and binding of the gRNA:dxCas9(-Tn5) to the target DNA

gRNA:dxCas9(-Tn5) complex formation

NOTE: all samples and reagents are kept on ice during preparation.

Load the purified dxCas9 or dxCas9-Tn5 protein with gRNA provided by Arbor Biotechnologies by combining the following components:

1-100nM dxCas9 or dxCas9-Tn5
1.6-160nM gRNA

NOTE: the gRNA and dxCas9 or dxCas9-Tn5 is mixed in a 1:1.6 molar ratio.

10X functionality buffer (20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol, 10mM MgCl₂ pH 7.5)
MilliQ (add up to a final volume of 10µL)

Pipette the reagents in the following order in a 0.5mL tube: MilliQ, 10X functionality buffer, dxCas9 or dxCas9-Tn5 protein and gRNA.
Incubate at 37 °C for 10 minutes.

gRNA:dxCas9(-Tn5):Target DNA complex formation

Add 1nM Target DNA (our case EPO cDNA) to the gRNA:dxCas9 or gRNA:dxCas9-Tn5 complex.
Incubate at 37 °C for 1 hour.
Analyse the samples on a 5% native TBE polyacrylamide gel to observe the mobility shift.

This protocol describes how the trypsin resistance of the gRNA-loaded dxCas9 and dxCas9-Tn5 proteins were evaluated due to a protein conformational change. The protocol consists of two parts: binding of dxCas9(-Tn5) to the gRNA and the trypsin resistance assay

gRNA:dxCas9(-Tn5) complex formation

NOTE: all samples and reagents are kept on ice during preparation.

Load the purified dxCas9 or dxCas9-Tn5 protein with gRNA provided by Arbor Biotechnologies by adding the following components:

1-100nM dxCas9 or dxCas9-Tn5
1.6-160nM gRNA

NOTE: the gRNA and dxCas9 or dxCas9-Tn5 is mixed in a 1:1.6 molar ratio.

10X functionality buffer (20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol, 10mM MgCl₂ pH 7.5)
MilliQ (add up to a final volume of 10µL)

Pipette the reagents in the following order in a 0.5mL tube: MilliQ, 10X functionality buffer, dxCas9 or dxCas9-Tn5 protein and gRNA.
Incubate at 37 °C for 10 minutes.

Trypsin Resistance Assay

Add 0.1-10nM Trypsin to the gRNA:dxCas9 or gRNA:dxCas9-Tn5 complex.
Incubate at 23 °C for 30 minutes.
Analyse the samples on a 8% SDS Tris-Glycine polyacrylamide gel to observe the trypsin resistance.

This protocol spans over 3 days of execution time, starting from a -80 °C mother stock. Throughout the protocol, it is recommended to work under aseptic conditions in order to prevent contamination risks.

Day 1

Sterilize the required 50mL MilliQ and 250µL glycerol in advance.
Keep the -80 °C strain stock of interest on ice.
Streak the strain on solid selective medium and incubate overnight at 37 °C.

Day 2

Prepare a 10mL liquid starter culture with one of the colonies that grew on the selective plate. Let the culture grow overnight at 37 °C, shaking at 180rpm.

Day 3

Use 0.5mL of the starter culture to inoculate 35mL selective liquid medium.
Grow at 37°C while shaking 250 rpm till an OD600 of ~0.5.
Centrifuge for 10 minutes at 4 °C at 3900rpm.
Discard the supernatant and resuspend pellet in 20mL cold MilliQ.
Centrifuge for 10 minutes at 4 °C at 3900rpm.
Discard the supernatant and resuspend pellet in 20mL cold MilliQ.
Centrifuge for 10 minutes at 4 °C at 3900rpm.
Discard supernatant and resuspend in 200µL 50% glycerol.
Prepare aliquots of 50µL.
Either transform the electrocompetent cells straight away or store the electrocompetent cells at -80 °C.

NOTE: This protocol allows for a single transformation.

Thaw a 50µL aliquot of electrocompetent cells on ice.
Add ~200 ng DNA to the cells and keep on ice for 20 minutes.
NOTE: in case of purified plasmid DNA, 1ng DNA is enough.
Transfer all the content to an electro-shock cuvette.
Electro-shock the cells with the Electro Cell Manipulator at 2.5kV.
Immediately add 0.2-1mL of recovery medium (eg. SOC-medium). Resuspend and transfer to a 1.5mL tube.
Incubate at 37 °C at 250rpm for 1 hour.
Plate the cells on solid medium with appropriate antibiotics and incubate overnight at 37 °C.

This protocol is based on the instructions for G-Block resuspension given by Integrated DNA Technologies (IDT).

Centrifuge the tube containing the gBlock for 3−5 seconds (>3,000 x g) to pellet the material to the bottom of the tube.

Add an appropriate volume of sterile MilliQ to the tube for a desired final concentration. The required volume of MilliQ can be read from the table below (and the label on the IDT tube that contains your fragment):

Final concentration (ng/µL)	µL MilliQ to add to 250ng	µL MilliQ to add to 250ng	µL MilliQ to add to 250ng
10	25	50	100
20	not recommended	25	50
50	not recommended	10	20

Incubate at 50 °C for 20 minutes.
Briefly vortex and centrifuge.
Store the resuspended gBlock at -20 °C.

This protocol is based on MO BIO Laboratories Inc. UltraClean® Microbial DNA Isolation Kit. For more information on the composition of the MD solutions, and for safety precautions, we recommend consulting MO BIO Laboratories’ kit manual..

Add 1.8 ml of microbial (bacteria, yeast) culture to a 2mL Collection Tube (provided) and centrifuge at 10,000 x g for 30 seconds at room temperature. Decant the supernatant and spin the tubes at 10,000 x g for 30 seconds at room temperature and completely remove the media supernatant with a pipette tip. NOTE: Based on the type of microbial culture, it may be necessary to centrifuge longer than 30 seconds.
Resuspend the cell pellet in 300µl of MicroBead Solution and gently vortex to mix. Transfer resuspended cells to MicroBead Tube.
Check Solution MD1. If Solution MD1 is precipitated, heat the solution at 60 °C until the precipitate has dissolved. Add 50µl of Solution MD1 to the MicroBead Tube.
Optional: To increase yields, to minimize DNA shearing, or for difficult cells, see Alternative lysis methods in the “Hints & Troubleshooting Guide” section before continuing.
Secure MicroBead Tubes horizontally using the MO BIO Vortex Adapter tube holder for the vortex (MO BIO Catalog# 13000-V1) or secure tubes horizontally on a flat-bed vortex pad with tape. Vortex at maximum speed for 10 minutes. (See “Hints & Troubleshooting Guide” for less DNA shearing).
Make sure the 2mL MicroBead Tubes rotate freely in the centrifuge without rubbing. Centrifuge the tubes at 10,000 x g for 30 seconds at room temperature.
CAUTION: Be sure not to exceed 10,000 x g or tubes may break.
Transfer the supernatant to a clean 2mL Collection Tube (provided). Expect 300-350µl of supernatant.
Add 100 µl of Solution MD2, to the supernatant. Vortex for 5 seconds. Then incubate at 4 °C for 5 minutes.
Centrifuge the tubes at room temperature for 1 minute at 10,000 x g.
Avoiding the pellet, transfer the entire volume of supernatant to a clean 2mL Collection Tube (provided). Expect approximately 450µL in volume.
Shake to mix Solution MD3 before use. Add 900 µl of Solution MD3 to the supernatant and vortex for 5 seconds.
Load about 700µL into the Spin Filter and centrifuge at 10,000 x g for 30 seconds at room temperature. Discard the flow through, add the remaining supernatant to the Spin Filter, and centrifuge at 10,000 x g for 30 seconds at room temperature. NOTE: A total of 2 to 3 loads for each sample processed are required. Discard all flow through liquid.
Add 300µL of Solution MD4 and centrifuge at room temperature for 30 seconds at 10,000 x g.
Discard the flow through.
Centrifuge at room temperature for 1 minute at 10,000 x g.
Being careful not to splash liquid on the spin filter basket, place Spin Filter in a new 2mL Collection Tube (provided)
Add 50µL of Solution MD5 to the center of the white filter membrane.
Centrifuge at room temperature for 30 seconds at 10,000 x g.
Discard Spin Filter. The DNA in the tube is now ready for any downstream application. No further steps are required. Store the DNA at -20 °C until further use.

This Gibson Assembly protocol is based on the protocol provided by New England Biolabs.

Thaw 10µL of 2X Gibson Assembly mastermix (New England Biolabs) on ice.
Add backbone and insert; depending on the assembly, assembly pieces can be added in a predetermined ratio (recommended is ratio 1:3 mol vector over mol insert, so not a 1:3 ratio based on weight). Do not exceed the total volume of 10µL.
NOTE: An online ligation calculator can subsequently be used to calculate the amount of the assembly pieces that is required.

If applicable, fill up the reaction volume to 20µL with MilliQ.

Component	Volume (µL)
Gibson Assembly Master Mix 2X (NEB)	10
Vector	X (? ng)
Insert fragment	Y (? ng)
MilliQ	10-X-Y

NOTE: The vector should have compatible overhangs with the insert(s)

Incubate the assembly reaction at 50 °C for 60 minutes and place on ice for subsequent chemical transformation or electroporation. Otherwise, store at -20 °C.

For each PCR in 50µL reaction volume, make sure the composition is as follows:

Component	Volume (µL)	Final concentration
5X Phusion HF buffer	10	1X
10mM dNTPs	1	200µM
Primer forward (10µM)	2.5	200nM
Primer reverse (10µM)	2.5	200nM
DNA template	~10ng to 250ng*
Phusion polymerase	0.5	20U/mL
MilliQ	up to 50µL

* NOTE: The 10ng - 250ng of template DNA are approximate, choose a volume that works fine for all your samples.
NOTE: High fidelity PCR with Phusion polymerase can be optimized per case by adding 3% of DMSO.

Close all tubes thoroughly and place them in a thermocycler with the following protocol:

Step	Temperature (°C)	Time (s)
Initial denaturation	98	30
Denaturation	98	10
Annealing	T_ann*	15
Extension	72	15-30 sec per kb DNA
Final extension	72	300
Hold	4	∞

* NOTE: The annealing temperature (T_ann) is dependent on the melting temperature (T_m) of the primers used. It is recommended to have T_ann = T_m - 5 °C.

The PCR product(s) can be checked on agarose gel. In order to do so, cast a gel and prepare the samples according to the DNA electrophoresis protocol.

Thaw the ligase buffer on ice, to prevent damaging the ATP.

Prepare a sample as follows:

Component	Volume (µL)
10X Ligase buffer	2
T4 DNA Ligase	1
DNA vector	X (~100ng)
DNA fragment	Y*
MilliQ	17-X-Y

* NOTE: The desired vector:insert ratio will be 1:3. Use a ligation calculator to calculate the amounts of vector DNA and insert DNA to be added.

Incubate for at least one hour at 4 °C. Optimally, incubate overnight at 4 °C.

Dissolve Luria Broth powder in water according to instructions by manufacturer.
Heat sterilize (121 °C) the medium in the autoclave.
After cooling down, add the required antibiotic under aseptic conditions.
NOTE: With our antibiotic stock solutions of 1000x we used 1µL of antibiotic solution per mL of LB-agar.
Store the medium at 4 °C if complemented with antibiotics.

Label as many 15mL Falcon tubes/Erlenmeyer flasks as the number of colonies you want to grow.
Under aseptic conditions, distribute 10mL of liquid medium (LB or SOC) for each starter culture.
NOTE: Supply with relevant antibiotics.
Under aseptic conditions, pick a colony with the inoculation loop and swirl it in the starter culture to inoculate.
NOTE: A picked colony cannot be used again; it is recommended to restreak on a 'back-up'-plate and incubate it overnight at 37 °C.
Grow the liquid cultures at 37 °C overnight, shaking at 250rpm.

This protocol describes the steps to be taken to wash a flow cell after performing a sequencing run.

Thaw components of the Wash kit (WKE_1012) at room temperature.
After the sequencing run has stopped, add 150µL of Buffer A to the priming port (without opening the SpotOn port).
Incubate for 10 minutes at room temperature.

For using immediately:

Add 500 µL of buffer B slowly on the priming port.
Slowly take out the waste solution from the waste chamber.
The flow cell is ready for priming and adding a new DNA library.

For storage:

Add 500 µL of storage buffer slowly on the priming port.
Slowly take out the waste solution from the waste chamber.
Store flow cell at 4 ºC.

This protocol intends to quantify DNA amount, as well as the purity, in DNA purification or extraction samples, through spectroscopy. Make sure the Nanodrop machinery is installed to measure at wavelengths for dsDNA (260nm) and impurities at 230nm and 280nm.

Clean the measurement surface with a piece of tissue and ethanol.
Use 1µL of sterile MilliQ as a blank.
Clean the measurement surface with a piece of tissue.
Use 1µL of a sample to measure its concentration.
NOTE: It is best to measure the same sample in triplo and use the average value. If you have multiple samples, clean the measurement surface in between measurements.
When done measuring, wipe the measurement surface with a tissue and MilliQ.

This protocol intends to quantify protein amount, as well as the purity, in purification or extraction samples, through spectroscopy. Make sure the Nanodrop machinery is installed to measure at wavelengths for 280nm and 260nm.

Clean the measurement surface with a piece of tissue and ethanol.
Use 2µL of sterile MilliQ as a blank.
Clean the measurement surface with a piece of tissue.
Use 2µL of a sample to measure its concentration.
NOTE: It is best to measure the same sample in triplo and use the average value. If you have multiple samples, clean the measurement surface in between measurements.
When done measuring, wipe the measurement surface with a tissue and MilliQ.

This protocol intends to quantify RNA amount, as well as the purity, in purification or extraction samples, through spectroscopy. Make sure the Nanodrop machinery is installed to measure at wavelengths for ssRNA (260nm) and impurities at 230nm and 280nm.

Clean the measurement surface with a piece of tissue and ethanol.
Use 1µL of sterile MilliQ as a blank.
Clean the measurement surface with a piece of tissue.
Use 1µL of a sample to measure its concentration.
NOTE: It is best to measure the same sample in triplo and use the average value. If you have multiple samples, clean the measurement surface in between measurements.
When done measuring, wipe the measurement surface with a tissue and MilliQ.

A native PAGE electrophoresis is used to separate DNA based on their size by using an electric current. This protocol describes how to prepare a native PAGE gels, how to prepare samples and how to run the electrophoresis.
NOTE: In this protocol we use a 5% separation gel (this is for DNA samples between 50 bp and 1,000 bp).

Preparing the native PAGE gel

Prepare the following solutions for 2 gels (total 12mL):

Component	Volume
40% Acrylamide	1.5mL
10X TBE buffer	1.2mL
10% APS	120µL
TEMED	12µL
MilliQ	9.168mL

NOTE: Polymerization will start when 10% APS and TEMED are added.

Assemble the casting station and pour the separation gel between the glass plates.
Immediately place the gel comb on top of the gel.
Allow the gel to solidify, then remove the plates from the casting station.
The gels are ready for usage, or can be stored at 4 °C for later usage.

Preparing samples

Add 2μL protein 6X Loading Dye to 10μL of sample.

Running PAGE gel

Run the gel at 150V and 25mA.
The gel is finished when the purple line is at the end of the gel.

Processing PAGE gel: Ethidium bromide staining

Turn off the power pack before opening the gel box.
Remove the gel from the cassette and place the gel in a clean staining tray of the appropriate size filled with a layer of MilliQ or TBE buffer.
Gently allow the gel to slide from the glass plate into the water.
Add 1µL of Ethidium bromide into the water.
Allow the gel to shake on a moving platform for 10 minutes.
Take a picture with the Gel doc system/Typhoon.

A native PAGE electrophoresis is used to separate DNA based on their size by using an electric current. This protocol describes how to prepare a native PAGE gels, how to prepare samples and how to run the electrophoresis.
NOTE: In this protocol we use a 5% separation gel (this is for DNA samples between 50 bp and 1,000 bp).

Preparing te native PAGE gel

Prepare the following solutions for 2 gels (total 12mL):

Component	Volume
40% Acrylamide	1.5mL
10X TBE buffer	1.2mL
10% APS	120µL
TEMED	12µL
MilliQ	9.168mL

NOTE: Polymerization will start when 10% APS and TEMED are added.

Assemble the casting station and pour the separation gel between the glass plates.
Immediately place the gel comb on top of the gel.
Allow the gel to solidify, then remove the plates from the casting station.
The gels are ready for usage, or can be stored at 4 °C for later usage.

Preparing samples

Add 2μL protein 6X Loading Dye to 10μL of sample.

Running PAGE gel

Run the gel at 150V and 25mA.
The gel is finished when the purple line is at the end of the gel.

Processing PAGE gel: Silver staining

Turn off the power pack before opening the gel box.
Remove the gel from the cassette and place the gel in a clean staining tray of the appropriate size filled with a layer of MilliQ or TBE buffer.
Gently allow the gel to slide from the glass plate into the water.
Discard the water.

Prepare the following solutions for silver staining with SilverQuest Silver staining kit.

Solution	Components
Fixing solution	10mL Acetic Acid 40mL Ethanol 50mL MilliQ
Sensitizing solution	30mL Ethanol 10mL Sensitizer 60mL MilliQ
Staining solution	1mL Silver Stainer 100mL MilliQ
Developing solution	10mL Developer 1 drop Developer Enhancer 90mL MilliQ

NOTE: All incubations are performed on a rotary shaker rotating at a speed of 1 revolution/second at room temperature.

Cover the gel with 100mL fixing solution for one hour with gentle rotation.
NOTE: The gel can be stored in the fixative overnight if there is not enough time to complete the staining protocol.
Decant the fixative solution and wash the gel in 30% ethanol for 10 minutes.
Decant the ethanol and wash the gel in 100mL of Sensitizing solution for 10 minutes.
Decant the Sensitizing solution and wash the gel in 100mL of 30% ethanol for 10 minutes.
Decant the 30% ethanol and wash the gel in 100mL of ultrapure water for 10 minutes.
Decant the water and indicate the gel in 100mL of Staining solution for 15 minutes.
Decant the Staining solution and wash the gel with 100mL of ultrapure water for 20–60 seconds.
Note: Washing the gel for more than a minute will remove silver ions from the gel resulting in decreased sensitivity.
Incubate the gel in 100mL of Developing solution for 4–8 minutes until bands start to appear and the desired band intensity is reached.
After the appropriate staining intensity is achieved, immediately add 10 mL of Stopper directly to the gel still immersed in Developing solution.
Gently agitate the gel for 10 minutes.
Note: The color changes from pink to colorless indicating that the development has stopped.
Decant the Stopper solution and wash the gel with 100 mL of ultrapure water for 10 minutes.
Take a picture with the Gel doc system.

This protocol is based on the Wizard® SV Gel and PCR Clean-Up System of Promega Corporation.

Add an equal volume of Membrane Binding Solution to the volume of PCR product.
Insert the SV Minicolumn into Collection Tube and label both of them according to the labelling of your samples.
Transfer the dissolved gel mixture to the Minicolumn assembly. Incubate the Minicolumn at room temperature for 1 minute.
Centrifuge the SV Minicolumn at maximum speed for 1 minute.
Discard the flow through and reinsert the SV Minicolumn into the Collection Tube.
Add 700µL of Membrane Wash Solution.
NOTE: Upon prior use, dilute the solution with 95% ethanol following the manufacturer's’ instructions.
Centrifuge the SV Minicolumn assembly at maximum speed for 1 minute.
Discard the flow through and reinsert the SV Minicolumn into the Collection Tube.
Repeat the washing step with 500µL of Membrane Wash Solution and centrifuge for 5 minutes at maximum speed.
Once the Collection Tube is empty, centrifuge the Minicolumn assembly at maximum speed for 1 minute with the microcentrifuge lid open to allow ethanol full evaporation.
NOTE: Leaving the column at room temperature ameliorates evaporation of residual ethanol traces.
Transfer the SV Minicolumn to a clean labelled 1.5mL Eppendorf tube.
Add 50µL of pre-warmed MilliQ directly to the centre of the SV Minicolumn, without touching the membrane with the pipette tip.
NOTE: Use 30µL when higher final concentrations of DNA are required or when small quantities of DNA are suspected.
Incubate the SV Minicolumn at room temperature for 5 minutes.
Centrifuge at maximum speed for 1 minute.
Discard the SV Minicolumn, cap the tube containing the eluted DNA and keep the DNA at 4 °C (for immediate use) or -20 °C (for storage).

The protocol is based on Promega’s pGEM T-Easy Vector System technical manual.
pGEM T-Easy vector system can be used to clone PCR amplification products by Taq polymerase on separate plasmids. The following steps are done to complete the protocol: Briefly centrifuge the pGEM.-T Easy Vector and insert DNA tubes.

Set up ligation reactions in the following order:

5µl 2x Rapid Ligation Buffer, T4 DNA Ligase
1µl pGEM-T Easy vector
Xµl PCR product (to obtain 3:1 insert:vector molar ratio)
1µl T4 DNA Ligase
Xµl MilliQ to 10µl

Incubate overnight at 4C.
Transform ligates into competent cells according to the chemical competent cell transformation protocol.
Blue/white colony screening to chose for colonies with inserts.
To calculate the amount of PCR product needed, the following formula can be used:

This protocol is based on the protocol supplied with the Promega PureYield™ Plasmid Miniprep Kit of Promega Corporation.

Centrifuge 1.5-3mL of a liquid (starter) culture for 1 minute in a 1.5mL microcentrifuge tube at maximum speed.
Discard the supernatant and resuspend in 600µL of MilliQ.
Add 100µL of Cell Lysis Buffer, and mix by inverting the tube.
Add 350µL of cold (4–8 °C) Neutralization Solution, and mix thoroughly by inverting.
Centrifuge at maximum speed in a microcentrifuge for 3 minutes.
Transfer the supernatant (~900µl) to a PureYield™ Minicolumn without disturbing the cell debris pellet.
Place the minicolumn into a Collection Tube and centrifuge at maximum speed in a microcentrifuge for 15 seconds.
Discard the flow through, and place the minicolumn into the same Collection Tube.
Add 200µl of Endotoxin Removal Wash (ERB) to the minicolumn. Centrifuge at maximum speed in a microcentrifuge for 15 seconds.
Add 400µl of Column Wash Solution (CWC) to the minicolumn. Centrifuge at maximum speed in a microcentrifuge for 30 seconds.
Transfer the minicolumn to a clean, labelled 1.5 ml Eppendorf tube, then add 30µl of sterile MilliQ directly to the minicolumn matrix. Incubate for 1 minute at room temperature.
Centrifuge for 15 seconds to elute the plasmid DNA. Discart the column and label the tube. The isolate can be stored at -20 °C or directly used.

This protocol is based on the instructions for primer resuspension given by Integrated DNA Technologies (IDT).

Centrifuge the tube containing the primer for 3−5 seconds (>3,000 x g) to pellet the material to the bottom of the tube.
Dissolve the DNA material in sterile MilliQ according to the supplier IDT. This creates a 100µM stock solution.
Heat the primer stock solution to 65 °C for 20 minutes.
Centrifuge the primer stock solution at maximum speed (~17,000 x g) for 2 minutes.
Prepare a 10X diluted work solution (10µM) by dilution with sterile MilliQ.
Store both Stock and Work solutions at -20 °C.

All work was performed within a sterile field created by a bunsen burner flame.

Cell Culture

Inoculate a single colony from an agar plate containing transformed cells in a 10 mL starter culture with appropriate antibiotic selection marker.
Let the seed culture grow overnight at 37 °C with 180 rpm rotation.
Measure the OD600 to confirm growth (an OD600 of around 2 is to be expected).
Prepare 1L of media with the required antibiotics.
Inoculate the media with 10 mL of the seed culture (1:100 ratio).
Let the culture grow until an OD600 of 0.5.
When the required OD is reached, put the culture on ice for 30 minutes.
After the 30 minutes, induce the expression of the protein by adding 1M IPTG to a final concentration of 1mM and 20% arabinose to a final concentration 0.2% arabinose.
Grow the cells for 16 hours ot 18 °C and 180rpm rotation.

Cell Harvest

Harvest the liquid culture by centrifugation at 5200g and 4 °C for 15 minutes.
Discard the supernatant and weigh the pellet. Resuspend the pellet with 6mL PBS/g cells.
Centrifuge the cells 15 minutes at 5200 g and 4 °C, and again discard supernatant.
The cells are now directly passed off to downstream processing.

This protocol describes the optimized downstream processing of dxCas9.

Cell Lysis

Retrieve a washed cell pellet from upstream processing according to the protein expression protocol.
NOTE: All following steps in this purification protocol are done at 4 °C.
Resuspend the pellet in lysis buffer (20mM Tris-HCL, 250mM NaCl, 10% v/v glycerol, 1mM DTT, 5mM imidazole, pH 8.0) and one protease inhibitor tablet per 50mL lysis buffer. Make sure pellet is fully resuspended.
Lyse the cells using a high-pressure homogenizer (French Press) (2 rounds at 1 kbar).

Clarification

Clarify the lysate via centrifugation for 45 min at 16,000 g.
NOTE: The dxCas9 is now dissolved in the supernatant and the pellet contains cell debris.

Nickel Affinity Chromatography

Perform Nickel affinity chromatography with a gravity column.
NOTE: 1mL of 50% His-Select Ni resin per 15mL clarified lysate for high expression proteins.
Resuspend 1mL of 50% Hisselect Nickel Affinity gel in 10mL (20CV) water, spinning down at 3220g for 1 min and discard the supernatant. Repeat this three times.
Equilibrate the washed resin with 10mL (20CV) of equilibration buffer (20mM Tris-HCl, 250mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8), spinning down at 3220g for 1 min and discard the supernatant.
Add the Hisselect column material to the clarified lysate and incubate for one hour with gentle mixing.
Spin down the mixture, for 1 min at 2000 g.
NOTE: This mixture contains dxCas9 bound to Hisselect Nickel resin.
Discard the supernatant by pipetting and load the resin onto a gravity column.
Wash the resin five times in 2mL (20CV) of washing buffer (20mM Tris-HCl, 250mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8) and collect the flowthrough.
Elute the dxCas9 from the resin with six fractions of 500μL of elution buffer (20mM Tris-HCl, 250mM NaCl, 1mM DTT and 250mM imidazole, pH 8.0), and collect in differently labeled tubes.
Measure the A280 of all six elution fractions at the Nanodrop, to roughly estimate the protein concentrations.
Load the all the samples including the elution fractions onto an SDS 8% Tris-Glycine PAGE gel to confirm presence of the protein.
Pool the fraction that contains the dxCas9.

Heparin Chromatography

Perform heparin chromatography on the AKTA pure with a 1 mL HiTrap Heparin HP column.
Set the following settings:
- Flow rate: 0.5mL/min
- Maximum column pressure: 0.5MPa

Perform the following method on the AKTA.

Chromatography step	Buffer	Column Volume (CV)	Volume (mL)	Fractionation
Column washing	Water	20	20	0 Fractions
Column equilibrating	20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM DTT, pH 7.5	20	20	0 Fractions
Sample loading	Pooled dxCas9 fractions	1-20	1-20	1 Fraction in the appropriate tube
Washing	20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM DTT, pH 7.5	20	20	1 Fraction in a 50mL Falcon tube
Eluting	20mM Tris-HCl, 1.5M NaCl, 10% v/v glycerol, 1mM DTT, pH 7.5	30	30	60 Fractions in a 1mL tube
Column Washing	Water	20	20	0 Fractions
Column Storage	20% ethanol	20	20	0 Fractions

Based on the A₂₈₀ seen on the chromatogram select desired elution fractions that contains protein.
Load the all the samples including the desired elution fractions onto an SDS 8% Tris-Glycine PAGE gel to confirm presence of the protein.

Dialysis

Pool the fraction that contain the dxCas9.
Prepare 2L of dialysis buffer (20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol and pH 7.5).
Inject the pooled fractions (0.5-3mL) into a pierce 10,000 Molecular weight cut off cassette.
Buffer exchange by dialysis of the pooled fractions for 1 hour in 1L dialysis buffer.
Replace the dialysis buffer with fresh buffer and repeat dialysis for 1 hour.
Remove the dxCas9 solution out of the dialysis cassette and measure the concentration with the Pierce BCA protein assay kit by Thermo Scientific.
Aliquote the dxCas9 solution in 25µL aliquots and freeze at -20℃ for functionality testing assays.

This protocol describes the optimized downstream processing of Tn5.

Cell Lysis

Retrieve a washed cell pellet from upstream processing according to the protein expression protocol.
NOTE: All following steps in this purification protocol are done at 4 °C.
Resuspend the pellet in lysis buffer (20mM Tris-HCL, 250mM NaCl, 10% v/v glycerol, 1mM DTT, 5mM imidazole, pH 8.0) and one protease inhibitor tablet per 50mL lysis buffer. Make sure pellet is fully resuspended.
Lyse the cells using a high-pressure homogenizer (French Press) (2 rounds at 1 kbar).

Clarification

Clarify the lysate via centrifugation for 45 min at 16,000 g.
NOTE: The Tn5 is now dissolved in the supernatant and the pellet contains cell debris.

Nickel Affinity Chromatography

Perform Nickel affinity chromatography with a gravity column.
NOTE: 1mL of 50% His-Select Ni resin per 15mL clarified lysate for high expression proteins.
Resuspend 1mL of 50% Hisselect Nickel Affinity gel in 10mL (20CV) water, spinning down at 3220 g for 1 min and discard the supernatant. Repeat this three times.
Equilibrate the washed resin with 10mL (20CV) of equilibration buffer (20mM Tris-HCl, 250mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8), spinning down at 3220 g for 1 min and discard the supernatant.
Add the Hisselect column material to the clarified lysate and incubate for one hour with gentle mixing.
Spin down the mixture, for 1 min at 2000 g.
NOTE: This mixture contains Tn5 bound to Hisselect Nickel resin.
Discard the supernatant by pipetting and load the resin onto a gravity column.
Wash the resin five times in 2 mL (20CV) of washing buffer (20mM Tris-HCl, 250mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8) and collect the flowthrough.
Elute the Tn5 from the resin with six fractions of 500μL of elution buffer (20mM Tris-HCl, 250mM NaCl, 1mM DTT and 250mM imidazole, pH 8.0), and collect in differently labeled tubes.
Measure the A280 of all six elution fractions at the Nanodrop, to roughly estimate the protein concentrations.
Load the all the samples including the elution fractions onto an SDS 12% Tris-Glycine PAGE gel to confirm presence of the protein.
Pool the fractions that contain the Tn5.

Heparin Chromatography

Perform heparin chromatography on the AKTA pure with a 1 mL HiTrap Heparin HP column.
Set the following settings:
- Flow rate: 0.5mL/min
- Maximum column pressure: 0.5 MPa

Perform the following method on the AKTA.

Chromatography step	Buffer	Column Volume (CV)	Volume (mL)	Fractionation
Column washing	Water	20	20	0 Fractions
Column equilibrating	20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM DTT, pH 7.5	20	20	0 Fractions
Sample loading	Pooled Tn5 fractions	1-20	1-20	1 Fraction in the appropriate tube
Washing	20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM DTT, pH 7.5	20	20	1 Fraction in a 50mL Falcon tube
Eluting	20mM Tris-HCl, 1.5M NaCl, 10% v/v glycerol, 1mM DTT, pH 7.5	30	30	60 Fractions in a 1 mL tube
Column Washing	Water	20	20	0 Fractions
Column Storage	20% ethanol	20	20	0 Fractions

Based on the A₂₈₀ seen on the chromatogram select desired elution fractions that contains protein.
Load the all the samples including the desired elution fractions onto an SDS 12% Tris-Glycine PAGE gel to confirm presence of the protein.

Dialysis

Pool the fraction that contain the Tn5.
Prepare 2L of dialysis buffer (20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol and pH 7.5).
Inject the pooled fractions (0.5-3mL) into a pierce 10,000 Molecular weight cut off cassette.
Buffer exchange by dialysis of the pooled fractions for 1 hour in 1L dialysis buffer.
Replace the dialysis buffer with fresh buffer and repeat dialysis for 1 hour.
Remove the Tn5 solution out of the dialysis cassette.

Protein Concentration

Wash a Amicon ultra-15mL centrifugal filter units with an 10,000 molecular weight cutoff with MilliQ water by centrifuging at 4,000 × g for approximately 10–20 minutes.
Add the Tn5 sample to the filter and centrifuged at 4,000 × g for approximately 10–20 minutes.
Measure the Tn5 protein concentration with the Pierce BCA protein assay kit by Thermo Scientific.
Aliquote the Tn5 solution in 25µL aliquots and freeze at -20℃ for functionality testing assays.

This protocol describes how the downstream processing of dxCas9-Tn5 was performed.

Cell Lysis

Retrieve a washed cell pellet from upstream processing according to the protein expression protocol.
NOTE: All following steps in this purification protocol are done at 4 °C.
Resuspend the pellet in lysis buffer (20mM Tris-HCL, 250mM NaCl, 1mM DTT, 10% v/v glycerol, 1mM PMSF, pH 7.5) and one protease inhibitor tablet per 50mL lysis buffer. Make sure pellet is fully resuspended.
Lyse the cells using a high-pressure homogenizer (French Press) (2 rounds at 1 kbar).

Clarification

Clarify the lysate via centrifugation for 45 min at 16,000 g.
NOTE: The dxCas9-Tn5 is now dissolved in the supernatant and the pellet contains cell debris.
Filter the clarified lysate with a 0.45µm filter.

Heparin Chromatography
Perform heparin chromatography on the AKTA pure with a 1mL HiTrap Heparin HP column.
Set the following settings:
- Flow rate: 0.5mL/min
- Maximum column pressure: 0.5 MPa

Perform the following method on the AKTA.

Chromatography step	Buffer	Column Volume (CV)	Volume (mL)	Fractionation
Column washing	Water	20	20	0 Fractions
Column equilibrating	20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM PMSF, pH 7.5	20	20	0 Fractions
Sample loading	Crude dxCas9-Tn5 extract	1-50	1-50	1 Fraction in the appropriate tube
Washing	20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM PMSF, 1mM DTT, pH 7.5	20	20	1 Fraction in a 50 mL Falcon tube
Eluting	20mM Tris-HCl, 1.5M NaCl, 10% v/v glycerol, 1mM PMSF, 1mM DTT, pH 7.5	30	30	60 Fractions in a 1mL tube
Column Washing	Water	20	20	0 Fractions
Column Storage	20% ethanol	20	20	0 Fractions

Based on the A₂₈₀ seen on the chromatogram select desired elution fractions that contains protein.
Load the all the samples including the desired elution fractions onto an SDS 8% Tris-Glycine PAGE gel to confirm presence of the protein.

MonoQ Chromatography

Perform anionic exchange chromatography on the AKTA pure with a 1mL MonoQ 5/50 GL column on the crude extract.
Set the following settings:
- Flow rate: 0.5mL/min
- Maximum column pressure: 20 MPa

Follow the following method on the AKTA

Chromatography step	Buffer	Column Volume (CV)	Volume (mL)	Fractionation
Column washing	Water	20	20	0 Fractions
Column equilibrating	20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM PMSF, 1mM DTT, pH 8.5	20	20	0 Fractions
Sample loading	Pooled fractions diluted 4 times with 20mM Tris-HCl, 0mM NaCl, 10% v/v glycerol, 1mM PMSF, 1mM DTT, pH 8.5	1-20	1-20	1 Fraction in the appropriate tube
Washing	20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM PMSF, 1mM DTT, pH 8.5	20	20	1 Fraction in a 50 mL Falcon tube
Eluting	20mM Tris-HCl, 1.5M NaCl, 10% v/v glycerol, 1mM PMSF, 1mM DTT, pH 8.5	30	30	60 Fractions in a 1 mL tube
Column Washing	Water	20	20	0 Fractions
Column Storage	20% ethanol	20	20	0 Fractions

Based on the A₂₈₀ seen on the chromatogram select desired elution fractions that contains protein.
Load the all the samples including the desired elution fractions onto an SDS 8% Tris-Glycine PAGE gel to confirm presence of the protein.

Dialysis

Pool the fraction that contain the dxCas9-L-Tn5.
Prepare 2L of dialysis buffer (20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol, 1mM PMSF and pH 7.5).
Inject the pooled fractions (0.5-3mL) into a pierce 10,000 Molecular weight cut off cassette.
Buffer exchange by dialysis of the pooled fractions for 1 hour in 1L dialysis buffer.
Replace the dialysis buffer with fresh buffer and repeat dialysis for 1 hour.
Remove the dxCas9-Tn5 solution out of the dialysis cassette.

Protein Concentration

Wash a Amicon ultra-15mL centrifugal filter units with an 10,000 molecular weight cutoff with MilliQ water by centrifuging at 4,000 × g for approximately 10–20 minutes.
Add the dxCas9-Tn5 sample to the filter and centrifuged at 4,000 × g for approximately 10–20 minutes.
Measure the dxCas9-Tn5 protein concentration with the Pierce BCA protein assay kit by Thermo Scientific.
Aliquote the dxCas9-Tn5 solution in 25µL aliquots and freeze at -20℃ for functionality testing assays.

This protocol is based on the manual for the Qubit dsDNA High Sensitivity Assay Kit provided by Thermofischer Scientific.

Set up the required amount of tubes for your samples and add two for the calibration standards.
Label the lids. Do not label the sides of the tubes, since this will interfere with the measurements.
Prepare the Qubit working solution.
n = amount of sample + two standards
Dilute n µL of dsDNA HS Reagent 1:200 in n * 199µL dsDNA HS Buffer. Use a clean plastic tube each time you prepare a working solution. Do not use glass containers.
Add 190µL of the working solution to the tubes for the two standards.
Add 10µL of the standards to the according tubes.Mix by vortexing 2-3 seconds and be careful not to create bubbles.
Add 180-199µL of working solution to the sample tubes, dependent on the amount of sample to be measured. The amount of sample used for the measurement can range from 1 to 20µL. Dependent on this amount the added volume of working solution should be adapted, so that the final volume is always 200µL.
Add each sample to the according assay tube. Mix by vortexing 2-3 seconds.
Allow all tubes to incubate at room temperature for 2 minutes.
Read the standards and samples following the Qubit instrument instructions.

Decide on which restriction enzyme(s) to cut with. Check online (NEB) what buffer the enzyme(s) work(s) in . For most of the restriction enzymes, the CutSmart buffer 10X can be used.
Prepare a 20µL sample as follows:

Component	Volume (µL)
10X CutSmart buffer (NEB)	2
Fragment (~1-2μg)	X
Restriction Enzyme(s)	1 per enzyme
MilliQ	18 - #RE added - X)

Incubate for 4 hours at 37 °C.
Inactivate the restriction enzyme(s) by heating to 65 °C for 10 minutes.
NOTE: This last step can be skipped if the sample is evaluated on gel electrophoresis immediately.
NOTE: Some enzymes are not inactivated by increasing the temperature to 65 °C.
NOTE: DNA Clean Up is recommended for subsequent cloning strategies.

This protocol is based on the QIAGEN RNeasy MinElute Cleanup Kit suited for volumes smaller than 100µL.

Adjust the transcripts volume to 100µl with RNase-free water.
Add 350µL Buffer RLT and mix.
Add 250µL of absolute ethanol.
Transfer the sample to an RNeasy MinElute spin column placed in a 2mL collection tube. Close the lid and centrifuge for 15 seconds at minimum speed 8000x g.
Discard the flow-through and place the spin column in a new 2mL collection tube.
Add 500µL Buffer RPE to the spin column. Close the lid and centrifuge for 15 seconds at minimum speed 8000x g.
Discard the flow-through and place the spin column back to the same 2mL collection tube.
Add 500µL 80% ethanol to the spin column. Close the lid and centrifuge for 2 minutes at minimum speed 8000x g.
Discard the flow-through and place the spin column in a new 2mL collection tube.
Open the lid and centrifuge at full speed for 5 minutes. Discard the flow through and the collection tube.
Place the spin column in a new 1.5mL collection tube. Add 14µL RNase-free water to the center of the spin column.
Close the lid and centrifuge for 1 minute at full speed to elute the RNA.
Store the purified RNA at -20 °C

Add 1:1 volume ratio of a purified RNA sample to 2X RNA loading buffer.
Boil at 90 °C for 5 minutes to denature potential secondary structures and temporarily inactivate RNAse.
Directly put on ice for ~2 minutes.
Spin down and electrophorese on a 2% agarose gel (in TBE buffer) for visualization with the gel documentation system using UV light.

An SDS-PAGE electrophoresis is used to separate proteins based on their size by using an electric current. This protocol describes how to prepare SDS-PAGE gels, how to prepare samples and how to run the electrophoresis.

Preparing of SDS-PAGE Gel

NOTE: An SDS-PAGE gel consist of a stacking gel and a separation gel. In this protocol we use a 6% Stack gel and a 12% separation gel (this is for protein samples between 15 kDa and 250 kDa).

Prepare the following solutions for 2 gels:

Component	Volume 6% stacking gel	Volume 12% separation gel
40% acrylamide	750 µL	3 mL
0.25 M Tris-HCl pH 6.8	2.5 mL	-
0.55 M Tris-HCl pH 8.8	-	5 mL
10% SDS	50 µL	100 µL
10% APS	50 µL	100 µL
TEMED	5 µL	10 µL
MilliQ	1.645 mL	1.79 mL
Total volume	5 mL	10 mL

NOTE: Polymerization will start when 10% APS and TEMED are added.

Assemble the casting station and pour the separation gel between the glass plates leaving enough space for the stacking gel.
Add 75% ethanol on top of the solidifying stacking gel.
When the gel is solidified, remove the ethanol and pour the stacking gel on top of the separation gel and immediately place the gel comb on top of it.
Allow the stacking gel to solidify, then remove the plates from the casting station.
The gels are ready for usage, or can be stored at 4 °C in liquid for later usage.

Preparing samples

Add 5μL protein Loading Dye to 20μL of protein sample.
Incubate the samples for 10 minutes at 90 °C.
Running SDS-PAGE gel
Run the gel at 150 V and 25 mA.
The gel is finished when the blue line is at the end of the gel.
Processing SDS-PAGE gel
Turn off the power pack before opening the gel box.
Remove the gel from the cassette and place the gel in a clean staining tray of the appropriate size filled with a layer of MilliQ.
Gently allow the gel to slide from the glass plate into the water.
Microwave the gel for 40 seconds on low heat.
Allow the gel to shake on a moving platform for 2 minutes.
Discard the water.
Add clean MilliQ water and repeat step 15-17 two times.
Cover the gel with a layer of SimplyBlue SafeStain.
Let the gel stain on a moving plate for approximately 20 minutes.
Discard the SimplyBlue SafeStain in the waste container.
Cover the gel with MilliQ water and allow the gel to shake on a moving platform until the gel is destained.
NOTE: the water can be replaced frequently to remove all the stain.
Take a picture with the Gel doc system.

This protocol is based on the protocol supplied with the MinION device from Oxford Nanopore Technologies.

Flow cell QC and check

Connect MinION device to a USB 3.0 port of a computer with recommended 1 Terabyte free space.
Open MinKNOW GUI from desktop and execute quality control (QC) of the flow cell.
NOTE: The number of available active pores to work with Flow cell from ONT is > 800 pores.

Library preparation rapid sequencing (lambda DNA)

Thaw the components of the kit for Rapid Sequencing on ice and keep on ice.
Add 2.5µL of DNA to 7.5µL of FRA (fragmentation mix).
Mix the content well by inversion and spin down.
Incubate tube at 30 ºC for 1 minute and then at 80 ºC for another minute.
After incubation, add 1µL of RAP (Rapid Adapter) to the tube and incubate for 5 minutes at room temperature.

Priming of Flow Cell

Turn the lid of the Flow Cell clockwise in order to make the priming port visible.
Remove bubbles from the priming port (not by directly pipetting but by changing pipette volume).
Pipette 30µL of Flush Tether into a tube of Flush Buffer and mix well by pipetting (priming mix).
Add 800µL of this priming mix to the priming port.

Loading the SpotON Flow Cell

Prepare the following reaction mixture:

Component	Volume (µL)
Sequencing Buffer (SQB)	34
Loading Beads (LB)	25.5
Nuclease-free MilliQ	4.5
Prepared DNA library	11

Open the SpotON port making the sample port available.
Add 200µL of priming mix.
Add 75µL of sample in the sample port in a dropwise fashion, allowing every drop to enter the port before adding another drop.
Close the priming port and replace the MinION lid.

Sequencing run and base calling

Start the sequencing run once the sample is loaded on the Flow cell using the Desktop Agent.
Check the progression of the upload and download of files, together with the network speed.

Close down MinKNOW and Desktop Agent

The run is stopped once the live base calling shows no DNA (or very little DNA) is being sequenced.
Quit Desktop Agent and MinKNOW and disconnect MinION.
To store the flow cell for a next run, follow the Wash Kit MinION protocol.

For sequence verification, the sequencing platform EZ-Seq established by Macrogen was used. This protocol is based on their instructions.

Prepare a sequencing sample in a 1.5 mL microcentrifuge tube, labelled with a Macrogen sequencing sticker (QR-code) as follows:

Component	Volume (µL)
DNA	X (~500 ng is required*)
Primer (10 µM)	2.5 (final concentration 5-10 pmol/µL)
Sterile MilliQ	10-X

* NOTE: The volume depends on the concentration of the sample.

Make sure to keep the QR-code and note down what sample it is affiliated with. Deliver the tubes for sequencing to the manufacturer and await results.
Results are evaluated in silico by aligning expected sequences with obtained sequences and calculating the match percentage.

This protocol is an adaptation of the original QIAGEN QIAamp DNA Blood Mini Kit protocol.
Important points before starting

All centrifugation steps are carried out at room temperature (15–25°C).
Use carrier DNA if the sample contains <10,000 genome equivalents (see page 17).
200 μl of whole blood yields 3–12 μg of DNA. Preparation of buffy coat (see page 18) is recommended if a higher yield is required.

Things to do before starting

Equilibrate samples to room temperature (15–25°C).
Heat a water bath or heating block to 56°C for use in step 4.
Equilibrate Buffer AE or distilled water to room temperature for elution in step 11.
Ensure that Buffer AW1, Buffer AW2, and QIAGEN Protease have been prepared according to the instructions on page 16.
If a precipitate has formed in Buffer AL, dissolve by incubating at 56°C.

Serum DNA Extraction Procedure

Pipet 10 μl QIAGEN Protease (or proteinase K) into the bottom of two 1.5 ml microcentrifuge tubes.
Add 500 μl sample (plasma or serum) to the microcentrifuge tubes.
NOTE: It is possible to add QIAGEN Protease (or proteinase K) to samples that have already been dispensed into microcentrifuge tubes. In this case, it is important to ensure proper mixing after adding the enzyme.
Add 500 μl Buffer AL to the sample (the same amount as the sample). Mix by pulse-vortexing for 15 s. It is a quite syrupy consistency. To ensure efficient lysis, it is essential that the sample and Buffer AL are mixed thoroughly to yield a homogeneous solution.
NOTE: Do not add QIAGEN Protease or proteinase K directly to Buffer AL.
Incubate at 56°C for 10 min. DNA yield reaches a maximum after lysis for 10 min at 56°C. Longer incubation times have no effect on yield or quality of the purified DNA.
Briefly centrifuge the 1.5 ml microcentrifuge tube to remove drops from the inside of the lid.
Add 500 μl ethanol (96–100%) to the sample (the same amount as the sample). Pipet it into the tube via the side of tube. This will let the foam of the centrifugation go away. The ethanol will let the proteins precipitate. Mix again by pulse-vortexing.
Carefully apply 600 μl of the mixture from step 6 to the QIAamp Mini spin column (in a 2 ml collection tube) without wetting the rim (pipet via the side at the top of the tube). Close the cap, and centrifuge at 6000 x g (8000 rpm) for 1 min. Discard the filtrate en place the QIAamp Mini spin column in the same 2 ml collection tube. Repeat this 5 times untill the 3mL of the mixture is used (split over 2 1.5 ml microcentrifugation tubes). After the last time centrifugation place the QIAamp Mini spin column in a clean 2 ml collection tube (provided), and discard the tube containing the filtrate.
Close each spin column to avoid aerosol formation during centrifugation. Centrifugation is performed at 6000 x g (8000 rpm) to reduce noise. Centrifugation at full speed will not affect the yield or purity of the DNA. If the lysate has not completely passed through the column after centrifugation, centrifuge again at higher speed until the QIAamp Mini spin column is empty. Note: When preparing DNA from buffy coat or lymphocytes, centrifugation at full speed is recommended to avoid clogging.
Carefully open the QIAamp Mini spin column and add 500 μl Buffer AW1 without wetting the rim. Close the cap and centrifuge at 6000 x g (8000 rpm) for 1 min. Place the QIAamp Mini spin column in a clean 2 ml collection tube (provided), and discard the collection tube containing the filtrate.*
NOTE: It is not necessary to increase the volume of Buffer AW1 if the original sample volume is larger than 200 μl.
*NOTE: Flow-through contains Buffer AL or Buffer AW1 and is therefore not compatible with bleach. See page 6 for safety information.
Carefully open the QIAamp Mini spin column and add 500 μl Buffer AW2 without wetting the rim. Close the cap and centrifuge at full speed (20,000 x g; 14,000 rpm) for 3 min.
Place the QIAamp Mini spin column in a new 1.5 ml microcentrifuge tube (not provided) and discard the old collection tube with the filtrate. Centrifuge at full speed for 1 min.
This step helps to eliminate the chance of possible Buffer AW2 carryover.
Place the QIAamp Mini spin column in a clean 1.5 ml microcentrifuge tube (not provided), and discard the collection tube containing the filtrate. Carefully open the QIAamp Mini spin column and add 60 μl Buffer AE or distilled (MilliQ) water. Incubate at room temperature (15–25°C) for 5 min, and then centrifuge at 6000 x g (8000 rpm) for 1 min. Take the eluate from the eppendorf tube and put it again on top of the filter. Centrifuge a second time at 14.000 rpm for 1 min.

This protocol is based on the standard RNA synthesis of the New England Biolabs T7 RNA Polymerase.

The following components should be assembled at room temperature in the following order:

Component	Volume (µL)
10x Reaction Buffer	2
NTP (each 25mM)	4
Template DNA	X (0.2 - 1 µg)
RNase Inhibitor	1 U/µL (final)
DTT	5 mM (final)
T7 RNA Polymerase	2
MilliQ	add up to 20 µL

The reaction is incubated at 37^oC for 4-16 hours.
The following sequence is used as the template DNA, in which “n” can be substituted to match the target DNA.

TAATACGACTCACTATAGGnnnnnnnnnnnnnnnnnnnGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT
Clean up sgRNA product(s) according to the RNA Clean Up protocol.

Dissolve the LB-agar powder in sterile MilliQ as directed by the manufacturer’s protocol.
Autoclave the LB-agar solution (121 °C).
Cool the agar down to hand-warm temperature.
Supplement the medium with any relevant antibiotics and/or inducers etc.
NOTE: With our antibiotic stock solutions of 1000x we used 1 µL of antibiotic solution per mL of LB-agar.
Under aseptic conditions, pour the medium in empty Petri dishes.
Close the Petri dishes and let the agar solidify at room temperature.
Store the Petri dishes upside down at 4 °C.
NOTE: When complimenting medium with X-gal, be sure to store the plates protected from light.

This protocol describes how to evaluate the mobility shift of the Tn5:adapter DNA complex or the dxCas9-Tn5:adapter DNA complex.

Adapter DNA Sequence

Add 25µl of each primer (from 100µM stock)
Add 50µl of MilliQ water
Place tube in 90-95 °C heating block and leave for 3-5 minutes to denature any secondary structure
Remove the heating block from the heat source allowing for slow cooling to room temperature (~45 minutes)

Table 1. Sequence of the adapter DNA. Note that 5’ of the upper strand of the adapter has to be phosphorylated for successful integration.

Name	Sequence (5’ - 3’)
Adapter upper strand	P-CTGTCTCTTATACACATCT
Adapter lower strand	GCATGGTAAACAGTTCATCCATTTCGCCAATAGATGTGTATAAGAGACAG

Tn5:adapter DNA or dxCas9-Tn5:adapter DNA complex (transposome) formation

Load the purified Tn5 or dxCas9-Tn5 protein with adapter DNA shown above. Note that all samples and reagents are kept on ice during preparation.
Calculate all the volumes of the reagents required:
- 1-6µM Tn5 or dxCas9-Tn5
- 2.5µM adapter
- Functionality buffer
- Pipette the reagents in the following order: Water, 10x functionality buffer, Tn5 or Tn5-dxCas9 and adapter
- Incubate at 23 °C for 1 hour.
  NOTE: The total reaction volume can be adjusted as long as molar ratios of the reagents are kept constant.
- Analyse the samples on a 8% native TBE polyacrylamide gel to observe the mobility shift

This protocol describes how to evaluate the integration of adapter DNA by Tn5 or the dxCas9-Tn5 fusion protein.

Adapter DNA Sequence

Add 25µl of each primer (from 100µM stock)
Add 50µl of MilliQ water
Place tube in 90-95 °C heating block and leave for 3-5 minutes to denature any secondary structure
Remove the heating block from the heat source allowing for slow cooling to room temperature (~45 minutes)

This protocol describes how to evaluate the integration of the Tn5 or the Tn5-dxCas9.

Table 1. Sequence of the adapter DNA. Note that 5’ of the upper strand of the adapter has to be phosphorylated for successful integration.

Name	Sequence (5’ - 3’)
Adapter upper strand	P-CTGTCTCTTATACACATCT
Adapter lower strand	GCATGGTAAACAGTTCATCCATTTCGCCAATAGATGTGTATAAGAGACAG

Tn5:adapter DNA or dxCas9-Tn5:adapter DNA complex (transposome) formation

Load the purified Tn5 or dxCas9-Tn5 protein with adapter DNA shown above. Note that all samples and reagents are kept on ice during preparation.
Calculate all the volumes of the reagents required:
- 2.5µM Tn5 or Tn5-dxCas9
- 2.5µM adapter
- Functionality buffer (20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol, 0.1mM EDTA pH 7.5)
- Water to bring the final volume to 10µl
Pipette the reagents in the following order: Water, 10X functionality buffer, Tn5 or dxCas9-Tn5 and adapter.
Incubate at 23 °C for 1 hour.
NOTE: The total reaction volume can be adjusted as long as molar ratios of the reagents are kept constant.

gRNA:Transposome complex formation (only for fusion protein)

Load dxCas9-Tn5:adapter complex with gRNA provided by Arbor Biotechnologies.
NOTE: all samples and reagents are kept on ice during preparation.
Add the following reagents to 10µl transposome

2µl sgRNA (100ng/µl stock solution) to make 1:1 sgRNA:transposome molar ratio
0.5µl buffer (add concentration)

Incubate at 37 °C for 10 minutes.

Target DNA integration

Add 50ng target DNA, in our case EPO cDNA to 12.5µl of gRNA:Transposome complex.
Incubate at 37 °C for 1 hour.

Amplification of integration products by PCR

Targeted integration of adapter DNA to EPO cDNA (632bp) will result in two fragments of ~250bp and ~450bp. To visualize these fragments, PCR was done to amplify the two products separately. The sequence of the primers are found on table 2. Primer set 1 will amplify the first fragment, while primer set 2 will amplify the second fragment (figure 1).

Table 2. Primer lists used for the functionality assay

Primer set	Fw primer	Information	Rv primer	Information
1	Fw EPO GATCGAATTCGCGGCCGCTTC	This will bind to the start of the EPO gene (target gene)	Rv adapter GCATGGTAAACAGTTCATCCATTTCGCCAATAGATGTGTATAAGAGACAG	This will bind to the end of the adapter
2	Rv adapter GCATGGTAAACAGTTCATCCATTTCGCCAATAGATGTGTATAAGAGACAG	This will bind to the end of the adapter (start of the product)	Rv EPO CGATTCTGCAGCGGCCGCTAC	This will bind to the end of EPO gene (target gene)

The PCR reaction composition is shown in Table 3.

Table 3. Pipetting scheme for PCR of integration products.

Component	Volume (µL)
5X GoTaq buffer	4
MgCl₂ (25µM)	2
10 mM dNTPs	0.4
Primer forward (10µM)	0.4
Primer reverse (10µM)	0.4
GoTaq polymerase	0.1
DNA template	2.5
MilliQ	up to 20µL

Close all tubes thoroughly and place them in a thermocycler with the following protocol:

Step	Time (s)	Temperature (°C)
Initial denaturation	150	98
Denaturation	60	94
Annealing	60	60
Extension	60	72
Final extension	480	72
Hold	∞	20

The PCR product are analysed on 5% native TBE polyacrylamide gel. The resulting gel is either stained with ethidium bromide and imaged with GelDoc system, or directly imaged with Typhoon Imaging System. In order to see the position of the protein in the gel the gel can be stained with silver quest staining.

@@ Line 18: / Line 18: @@
 <div class="col-lg-1 col-md-1 col-sm-1 col-xs-1 nowbg"> </div>
 <div class="col-lg-10 col-md-10 col-sm-10 col-xs-10 nowbg">
+ <!-- -----------------------Antibiotics stock solution--------------------------->
+<button class="collapsible cadpbl" ><a id="BCAproteinquantification-scroll" class="repositioner"></a>Antibiotic Stock Solution</button>
+<div class="content">
+<p>
+Preparation of a 1000X antibiotic stock solution:
+<ol>
+<li> Weigh X grams of the specific antibiotic of interest.  </li>
+<li> Resolve in 95% ethanol (Chloramphenicol) or MilliQ (other antibiotics).
+</ol>
+</p>
+</div>
   <!-- -----------------------BCA PROTEIN QUANTIFICATION --------------------------->
@@ Line 100: / Line 115: @@
 </table>
-<li>Determine the amount of total volume of working reagent (WR) required by using the the following formula: <br>
+<li>Determine the amount of total volume of working reagent (WR) required by using the following formula: <br>
-Total volume WR = (# standards + # unknowns) × (# replicates) × (200 µl) </li>
+Total volume WR = (# standards + # unknowns) × (# replicates) × (200 µL) <br>
+<em>NOTE: With pipetting you always take a bit extra (e.g. 10%), so not exactly the amount needed for x samples</em></li>
 <li>Prepare the BCA working reagent by mixing 50 parts of BCA Reagent A with 1 part of BCA Reagent B (50:1, Reagent A:B). <br>
 <em>NOTE: The WR is stable for several days when stored in a closed container at room temperature. </em></li>
 <li>Pipette 25µL of each standard or unknown sample replicate into a microplate well. </li>
 <li>Add 200µL of the WR to each well and mix plate thoroughly. </li>
-<li>Cover plate and incubate at 37°C for 30 minutes. </li>
+<li>Cover plate and incubate at 37 °C for 30 minutes. </li>
 <li>Cool plate to room temperature. </li>
 <li>Measure the absorbance at or near 562nm on a plate reader. </li>
@@ Line 112: / Line 128: @@
 </p>
 </div>
+<!-- -----------------------BLUNT END LIGATION --------------------------->
+<button class="collapsible cadpbl" ><a id="bluntendligation-scroll" class="repositioner"></a>Blunt End Ligation</button>
+<div class="content">
+<p>
+<ol>
+<li>Thaw the ligase buffer on ice, to prevent damaging the ATP</li>
+<li>For phosphorylation, prepare a sample a sample as follows:<br>
+<table>
+ <tr>
+      <th class="tableheaderadpbl">Component</th>
+      <th class="tableheaderadpbl">Volume (µL)</th>
+   </tr>
+   <tr class="tableunevenadpbl">
+       <td>10x Ligase buffer</td>
+       <td>2.5</td>
+   </tr>
+   <tr class="tableevenadpbl">
+       <td>T4 DNA Ligase</td>
+       <td>1</td>
+   </tr>
+   <tr class="tableunevenadpbl">
+       <td>ATP</td>
+       <td>2.5</td>
+   </tr>
+  <tr class="tableevenadpbl">
+       <td>T4 PNK enzyme</td>
+       <td>1</td>
+   </tr>
+   <tr class="tableunevenadpbl">
+        <td>DNA vector</td>
+        <td>X (~250 ng)</td>
+   </tr>
+   <tr class="tableevenadpbl">
+        <td>DNA fragment</td>
+        <td>Y*</td>
+   </tr>
+   <tr class="tableunevenadpbl">
+        <td>MilliQ</td>
+        <td>Up to 25 µL</td>
+   </tr>
+</table>
+ <em>* NOTE: The desired vector:insert ratio will be 1:3. Use a ligation calculator to calculate the amounts of vector DNA and insert DNA to be added.</em></li>
+<li>Incubate for at one hour at 37 °C.</li>
+<li>Cancel phosphorylation process by incubating for 30 minutes at 65 °C.</li>
+<li>Add 1 µL of Ligase T4 and incubate for at least four hours at 4 °C.</li>
+</ol>
+</p>
+</div>
+<!-- -----------------------BLOOD SAMPLE PREP --------------------------->
+<button class="collapsible cadpbl" ><a id="bluntendligation-scroll" class="repositioner"></a>Blood Sample Preparation</button>
+<div class="content">
+<p>
+<ol>
+<li>Centrifuge the whole blood (9mL EDTA anticoagulated tube) at 1200 x g for 10 minutes.</li>
+<li>Pipet of the plasma carefully (approximately 4 to 4.5mL) and put in a separate tube. When you only want the cfDNA and not the white blood cells be sure to not disturb the buffycoat with the pipet.</li>
+<li>Centrifuge the plasma at 24000 x g for 20 minutes.</li>
+<li>Take of the plasma without disturbing the pallet and aliquot into 1.5mL tubes, 1mL per tube.</li>
+<li>Store at -20 °C. </li>
+<li>For every follow up steps frozen aliquots can be taken from the freezer and thawed at room temperature. When thawed, the samples should be directly processed. Avoid thawing and freezing cycles, since this will cause degradation of cfDNA. </li>
+</ol>
+F. Thurik (2016). Cell-free placental DNA beyond Down syndrome.
+</p>
+</div>
 <!-- -----------------------CELL BANKING --------------------------->
@@ Line 118: / Line 201: @@
 <p> <em>NOTE: All work is performed under asceptic conditions. </em><br>
 <ol>
-<li>For one cryostock, take a 1.5mL sample from an <a href="#liquidstarterculture-scroll" class="adpbl">overnight liquid cultures</a>. </li>
+<li>For one cryostock, take a 1.5mL sample from an <a href="#liquidstarterculture-scroll" class="adpbl">overnight liquid culture</a>. </li>
 <li>Centrifuge the 2mL tubes at 2000rpm for 10 min. </li>
 <li>Decant the supernatant without disturbing the pellet. </li>
@@ Line 126: / Line 209: @@
 <li>Mix by vortexing.</li>
 <li>Make a 1mL aliquot in cryotubes and label it with the cell type, plasmid type, protein type, operator and date. </li>
-<li>Store the vials at -80ºC and update the inventory. </li>
+<li>Store the vials at -80 ºC and update the inventory. </li>
 </ol>
 </p>
@@ Line 134: / Line 217: @@
 <button class="collapsible cadpbl" ><a id="chemcomptcellsprep-scroll" class="repositioner"></a>Chemically Competent Cells Preparation</button>
 <div class="content">
-<p>This protocol s over 3 days of execution time, starting from a -80°C mother stock. Throughout the protocol, it is recommended to work under aseptic conditions in order to prevent contamination risks.
+<p>This protocol s over 3 days of execution time, starting from a -80 °C mother stock. Throughout the protocol, it is recommended to work under aseptic conditions in order to prevent contamination risks.
 <ol>
 <h4 class="adpbl">Day 1</h4>
-<li>Keep the -80°C strain stock of interest on ice. </li>
+<li>Keep the -80 °C strain stock of interest on ice. </li>
 <li>Streak the strain on <a href="#solidmedium-scroll" class="adpbl">solid selective medium</a> and incubate overnight at 37 °C while shaking. </li>
 <h4 class="adpbl">Day 2 </h4>
-<li>Prepare a 10mL <a href="#liquidstarterculture-scroll" class="adpbl">liquid starter culture </a> with one of the colonies that grew on the selective plate. Let the culture grow overnight at 37°C, shaking at 180rpm. </li>
+<li>Prepare a 10mL <a href="#liquidstarterculture-scroll" class="adpbl">liquid starter culture</a> with one of the colonies that grew on the selective plate. Let the culture grow overnight at 37 °C, shaking at 180rpm. </li>
-<li>Sterilise solutions of CaCl<sub>2</sub> 100 mM and of CaCl<sub>2</sub> 100 mM + 15 % Glycerol in advance. <br>
+<li>Sterilise solutions of 100 mM CaCl<sub>2</sub> and of 100 mM CaCl<sub>2</sub> + 15 % Glycerol in advance. <br>
-NOTE: Volumes depend on the total culture volume to be prepared in step 5. For example, if 1 L is used in step 7, 300 mL of CaCl<sub>2</sub> 100 mM and 10 mL of CaCl<sub>2</sub> 100 mM + 15 % glycerol will be used.</li>
+NOTE: Volumes depend on the total culture volume to be prepared in step 5. For example, if 1L is used in step 7, 300mL of 100mM CaCl<sub>2</sub> and 10mL of 100mM CaCl<sub>2</sub> + 15% glycerol will be used.</li>
 <h4 class="adpbl">Day 3</h4>
-<li>Inoculate 1:100 of overnight culture in the desired volume of LB with antibiotic (eg. 10 mL of culture in 1 L of LB). </li>
+<li>Inoculate 1:100 of overnight culture in the desired volume of LB with antibiotic when required (eg. 10mL of culture in 1L of LB). </li>
-<li>Incubate in a shaker at 37 °C, 180 rpm to OD600nm ~0.4-0.6 (measure OD600nm every 30 minutes). </li>
+<li>Incubate in a shaker at 37 °C, 180rpm to OD600nm ~0.4-0.6 (measure OD600nm every 30 minutes). </li>
 <li>Harvests the cells by centrifugation at 4000 x g for 5 minutes in centrifuge tubes, decant supernatant. </li>
 <li>Resuspend cells by gently pipetting 1/5 (of the volume of LB from step 5) of ice-cold 100 mM CaCl<sub>2</sub> and incubate on ice for 20 minutes.</li>
@@ Line 152: / Line 235: @@
 <li>Pellet the cells by centrifugation at 4000 x g for 5 minutes in centrifuge tubes, decant supernatant.</li>
 <li>Resuspend cells by gently pipetting 1/100 (of the volume of LB from step 5) of ice-cold 100 mM CaCl<sub>2</sub> + 15% glycerol and keep on ice.</li>
-<li>Chemical competent cells can either immediately be used for <a href="#chemcomptcellstrans-scroll" class="adpbl">heat shock transformation</a>, or stored in aliquots of 50 µL in microcentrifuge tubes at -80 °C. </li>
+<li>Chemical competent cells can either immediately be used for <a href="#chemcomptcellstrans-scroll" class="adpbl">heat shock transformation</a> or stored in aliquots of 50µL in microcentrifuge tubes at -80 °C. </li>
 </ol>
 </p>
@@ Line 162: / Line 245: @@
 <p>
 <ol>
-<li>Get as many aliquots of <a href="#chemcomptcellsprep-scroll" class="adpbl">competent cells </a>(50 µL) from the -80 °C freezer as transformations to be done and put them on ice for 10-15 min.<br>
+<li>Get as many aliquots of <a href="#chemcomptcellsprep-scroll" class="adpbl">competent cells </a>(50µL) from the -80 °C freezer as transformations to be done and put them on ice for 10-15 min.<br>
-<em>NOTE: Don’t forget positive and negative controls (no DNA). If commercial competent cells (highly efficient) are used, an aliquot of 50 µL can be split in two equal volumes of 25 µL and used for two transformations.</em></li>
+<em>NOTE: Do not forget positive and negative controls (no DNA). If commercial competent cells (highly efficient) are used, an aliquot of 50µL can be split in two equal volumes of 25 µL and used for two transformations.</em></li>
-<li>Add DNA of interest to the 50 µL of competent cells.<br>
+<li>Add DNA of interest to the 50µL of competent cells.<br>
 <ol type="I">
-<li>Gibson Assembly products: 5µL</li>
+<li>Gibson Assembly mixture: 5µL</li>
-<li>Ligation products: 5 µL</li>
+<li>Ligation mixture: 5µL</li>
-<li>Plasmid isolates: 2 µL</li>
+<li>Plasmids: 10 ng, volume depends on the plasmid concentration</li>
 </ol>
 <li>Incubate on ice for 10-20 minutes.</li>
 <li>Heat shock at 42 °C for exactly 45 seconds.</li>
-<li>Add 200 µL - 1L of hand-warm LB-medium.</li>
+<li>Add 200µL of hand-warm LB-medium.</li>
-<li>Incubate at 37°C with shaking (250 rpm) for 1 hour.</li>
+<li>Incubate at 37 °C with shaking (250 rpm) for 1 hour.</li>
-<li>Plate the cells on <a href="#solidmedium-scroll" class="adpbl">LB-agar plates</a> with the correct antibiotic to select. You can plate out 50-75 µL on one plate and the remaining liquid on another.<br>
+<li>Plate the cells on <a href="#solidmedium-scroll" class="adpbl">LB-agar plates</a> with the correct antibiotic to select for the introduced plasmid .  50-75µL can be plated on one plate. The remaining cell culture can be pelleted and resuspended in some residual supernatant prior to plating.<br>
-<em>NOTE: When adding more than 200 µL LB medium during step 5, plate out 100 µL on selective medium. Then, briefly centrifuge the remaining cell culture and plate out the cell pellet on selective medium.</em></li>
+<em>NOTE: When adding more than 200µL LB medium during step 5, plate out 100µL on selective medium. Then, briefly centrifuge the remaining cell culture and plate out the cell pellet on selective medium.</em></li>
 <li>Incubate plates at 37 °C overnight. <br>
 <em>NOTE: Alternatively, you can incubate over the weekend, leaving the plate on the bench.</em></li>
@@ Line 187: / Line 270: @@
 <p>
 <ol>
-<li>Under aseptic conditions, pick a colony, resuspend it in 10 µL of milli-Q water.<br>
+<li>Under aseptic conditions, pick a colony, resuspend it in 10µL of MilliQ water.<br>
-<em>NOTE: A picked colony cannot be used again; it is recommended to restreak on a 'back-up'-plate and incubate it overnight at 37 °C.</em></li>
+<em>NOTE: A picked colony cannot be used again; it is recommended to restreak on a 'back-up'-plate with the same pipet tips and incubate it overnight at 37 °C.</em></li>
 <li>Incubate the resuspended colony at 90 °C for 10 min. Spin the suspension down and use the supernatant as template DNA for the PCR. <br>
 <em>NOTE: Instead of separate boiling prior to PCR, this step can be incorporated in the PCR program. The initial denaturation step at 98 °C should then be prolonged to 5 minutes. </em></li>
@@ Line 199: / Line 282: @@
     </tr>
     <tr class="tableunevenadpbl">
-        <td>GoTaq 5x buffer*</td>
+        <td>Gotaq 5X buffer*</td>
         <td>10</td>
-        <td>1 X</td>
+        <td>1X</td>
     </tr>
     <tr class="tableevenadpbl">
-        <td>10 mM dNTPs</td>
+        <td>10mM dNTPs</td>
         <td>1</td>
-        <td>200 µM</td>
+        <td>200µM</td>
     </tr>
     <tr class="tableunevenadpbl">
          <td>Primer forward (10µM)</td>
          <td>1</td>
-        <td>200 nM</td>
+        <td>200nM</td>
     </tr>
     <tr class="tableevenadpbl">
          <td>Primer reverse (10µM)</td>
          <td>1</td>
-        <td>200 nM</td>
+        <td>200nM</td>
     </tr>
     <tr class="tableunevenadpbl">
@@ Line 224: / Line 307: @@
     </tr>
     <tr class="tableevenadpbl">
-         <td>Gotaq polymerase (5u/µL)</td>
+         <td>Gotaq polymerase (5U/µL)</td>
          <td>0.2</td>
-         <td>20 U/mL</td>
+         <td>20U/mL</td>
     </tr>
     <tr class="tableunevenadpbl">
@@ Line 234: / Line 317: @@
     </tr>
 </table>
-<em>* NOTE: Use GoTaq Buffer Green when it is required to run a verification gel afterwards.</em>
+<em>* NOTE: Use Gotaq Buffer Green when it is required to run a verification gel afterwards.</em>
-<li>Add 5 µL of supernatant of colony mixture to each PCR tube.</li>
+<li>Add 5µL of supernatant of colony mixture to each PCR tube.</li>
 <li>Close all tubes thoroughly and place them in a thermocycler with the following protocol:
 <br>
@@ Line 275: / Line 358: @@
     </tr>
 </table>
-  <em>*NOTE: The annealing temperature (T<sub>ann</sub>) is dependent on the melting temperature (T<sub>m</sub>) of the primers used. It is recommended to have T<sub>ann</sub> = T<sub>m</sub> - 5°C.</em></li>
+  <em>*NOTE: The annealing temperature (T<sub>ann</sub>) is dependent on the melting temperature (T<sub>m</sub>) of the primers used. It is recommended to have T<sub>ann</sub> = T<sub>m</sub> - 5 °C.</em></li>
-<li>The PCR product(s) can be checked on gel. In order to do so, cast a gel and prepare the samples according to the <a href="#DNAgelelectrophoresis-scroll" class="adpbl">DNA electrophoresis</a> protocol.</li>
+<li>The PCR product(s) can be checked on a agarose gel. In order to do so, cast a gel and prepare the samples according to the <a href="#DNAgelelectrophoresis-scroll" class="adpbl">DNA electrophoresis</a> protocol.</li>
 </ol>
 </p>
@@ Line 289: / Line 372: @@
 <li>Prepare the following solutions:<br>
 <ol type="I">
-<li>20 mM Gold Chloride salt (HAuCl<sub>4</sub>) in MiliQ. Store under refrigeration.</li>
+<li>20mM gold chloride salt (HAuCl<sub>4</sub>) in MilliQ. Store at 4 ºC.</li>
-<li>25 g/L Dextrin in MiliQ.</li>
+<li>25g/L dextrin in MilliQ.</li>
-<li>Sodium Carbonate (Na<sub>2</sub>CO<sub>3</sub>) 10 % (w/v) in MiliQ.</li>
+<li>10% (w/v) sodium carbonate (Na<sub>2</sub>CO<sub>3</sub>) in MilliQ.</li>
 <li>dH2O pH=9, adjusted with sodium hydroxide (NaOH).</li>
 </ol>
-<li>Add 25 mL of the dextrin solution (25 g/L) to a sterile 250 mL flask.</li>
+<li>Add 25mL of the dextrin solution (25g/L) to a sterile 250mL flask.</li>
-<li>Add 5 mL of the Gold Chloride salt solution (20 mM) . </li>
+<li>Add 5mL of the Gold Chloride salt solution (20mM). </li>
-<li>Adjust pH of the solution to pH=9 with sodium carbonate (Na<sub>2</sub>CO<sub>3</sub>) 10 % (w/v) by checking the pH with pH indicator strips. </li>
+<li>Adjust pH of the solution to pH=9 with 10% (w/v) Na<sub>2</sub>CO<sub>3</sub> by checking the pH with pH indicator strips. </li>
-<li>Complete the reaction mixture by adding dH2O pH=9 up to a total reaction volume of 50 mL. </li>
+<li>Complete the reaction mixture by adding dH2O pH=9 up to a total reaction volume of 50mL. </li>
-<li>Incubate the flask at 50 ºC in the dark with continuous shaking (250 rpm)  for 3 hours.</li>
+<li>Incubate the flask at 50 ºC in the dark with continuous shaking (250rpm)  for 3 hours.</li>
 <li>Measure the absorbance spectrum of the sample every 20 minutes. <br>
 <em>NOTE: Change in color to red is the final indication of the ion Au<sup>+3</sup> reduction to Au<sup>0</sup>. </em></li>
-<li>When the reaction mixture shows aa clear shift in color to red, stop the reaction and store the dextrin-capped gold nanoparticle batch at room temperature in a closed glass container in the dark.</li>
+<li>When the reaction mixture shows a clear shift in color to red, stop the reaction and store the dextrin-capped gold nanoparticle batch at room temperature in a closed glass container in the dark.</li>
 </ol>
 <div class="container" id="references-scroll">
-<div class="card-content" id="">
+<div class="card-content" id="references">
 <h6 class="adpbl">References:</h6>
 <ol>
@@ Line 320: / Line 403: @@
 <button class="collapsible cadpbl" ><a id="dAuNPstesting-scroll" class="repositioner"></a>Dextrin-Capped Gold Nanoparticles (d-AuNPs) Testing</button>
 <div class="content">
-<p>Evaluating of the functionality of dextrin-capped gold nanoparticles is performed in a 96 well plate. There are several analysis being conducted, which are:
+<p>Evaluating of the functionality of dextrin-capped gold nanoparticles is performed in a transparent 96 well plate with flat bottom. There are several analyses being conducted, which are:
-<ul class="ourlist">
+<ul class="uladpbl">
 <li>Salt stability</li>
 <li>ssDNA induced stability.</li>
 <li>ssDNA and target DNA stability.</li>
 </ul>
-<p>The following table indicates different solutions needed for each evaluation:<br></p>
+<p>The following table indicates different solutions needed for each type of analysis:<br></p>
   <table>
     <tr>
@@ Line 364: / Line 447: @@
 <h4 class="adpbl">Salt Stability</h4>
 <ol>
-<li>Add 20 µL of MilliQ.</li>
+<li>Add 20µL of MilliQ.</li>
-<li>Add 20 µL of NaCl solutions (varying concentrations).</li>
+<li>Add 20µL of NaCl solutions (varying concentrations).</li>
-<li>Use one well as salt blank by adding 20 µL MilliQ instead of NaCl solution.</li>
+<li>Use one well as salt blank by adding 20µL MilliQ instead of NaCl solution.</li>
-<li>Add 20 µL of d-AuNPs.</li>
+<li>Add 20µL of d-AuNPs.</li>
 <li>Mix gently by pipetting and incubate at 21 ºC during 10 minutes.</li>
-<li>Quantify the visible absorption spectrum of the solutions or measure absorbance at 520 nm and 620 nm.</li>
+<li>Quantify the visible absorption spectrum of the solutions or measure absorbance at 520nm and 620nm.</li>
 </ol>
 <h4 class="adpbl">ssDNAp Induced Stability</h4>
 <ol>
-<li>Add 4 µL of ssDNAp (1 µM).</li>
+<li>Add 4µL of ssDNAp (1µM).</li>
 <li>Use one wells as ssDNAp blank by adding 4 µL MilliQ instead of ssDNAp.</li>
-<li>Add 16 µL of MilliQ.</li>
+<li>Add 16µL of MilliQ.</li>
-<li>Add 20 µL of NaCl solutions (varying concentrations).</li>
+<li>Add 20µL of NaCl solutions (varying concentrations).</li>
-<li>Use one well as salt blank by adding 20 µL MilliQ instead of NaCl solution.</li>
+<li>Use one well as salt blank by adding 20µL MilliQ instead of NaCl solution.</li>
-<li>Add 20 µL of d-AuNPs.</li>
+<li>Add 20µL of d-AuNPs.</li>
 <li>Mix gently by pipetting and incubate at 21 ºC during 10 minutes.</li>
-<li>Quantify the visible absorption spectrum of the solutions or measure absorbance at 520 nm and 620 nm.</li>
+<li>Quantify the visible absorption spectrum of the solutions or measure absorbance at 520nm and 620nm.</li>
 </ol>
 <h4 class="adpbl">ssDNAp and dsDNA Target Induced Stability</h4>
 <p>Prepare the following reaction in a PCR tube:</p>
 <ol>
-<li>Add 4 µL of ssDNAp (1 µM).</li>
+<li>Add 4µL of ssDNAp (1µM).</li>
-<li>Use one well as ssDNAp blank by adding 4 µL MilliQ instead of ssDNAp.</li>
+<li>Use one well as ssDNAp blank by adding 4µL MilliQ instead of ssDNAp.</li>
-<li>Add 10 µL of dsDNA target (~1 nM).</li>
+<li>Add 10µL of dsDNA target (~1nM).</li>
-<li>Add 6 µL of Hybridization buffer.</li>
+<li>Add 6µL of Hybridization buffer.</li>
 <li>Mix gently by pipetting and add tubes on thermal cycler with the following program:<br>
   <table>
@@ Line 412: / Line 495: @@
     </tr>
 </table>
-<li>Add 20 µL of the reaction mixture into the wells of 96 well plate </li>
+<li>Add 20µL of the reaction mixture into the wells of 96 well plate </li>
-<li>Add 20 µL of NaCl solutions (varying concentrations or defined concentration based on previous results).</li>
+<li>Add 20µL of NaCl solutions (varying concentrations or defined concentration based on previous results).</li>
-<li>Use one well as salt blank by adding 20 µL MilliQ instead of NaCl solution.</li>
+<li>Use one well as salt blank by adding 20µL MilliQ instead of NaCl solution.</li>
-<li>Add 20 µL of d-AuNPs.</li>
+<li>Add 20µL of d-AuNPs.</li>
 <li>Mix gently by pipetting and incubate at 21 ºC during 10 minutes.</li>
-<li>Quantify the visible absorption spectrum of the solutions or measure absorbance at 520 nm and 620 nm.</li>
+<li>Quantify the visible absorption spectrum of the solutions or measure absorbance at 520nm and 620nm.</li>
 </ol>
 </p>
@@ Line 428: / Line 511: @@
 Gel Electrophoresis and DNA staining makes use of mutagenic chemicals like EtBr, SYBR Safe or any other DNA staining. Wear protection (gloves) when carrying out this protocol and work in an assigned area for this work to prevent contamination of the rest of the lab.
 <ol>
-<li>Weigh agarose powder for a 0.8% (w/v) gel in TAE. <br>
+<li>For a 0.8% (w/v) gel in TAE, weigh agarose powder for a 0.8% (w/v) gel.<br>
 <em>E.g. weigh 1.6g and add to 200mL TAE buffer for a 0.8% gel.</em></li>
 <li>Add weighed agarose in TAE buffer (1X) and warm the solution (in a microwave) until it is completely dissolved. Let the solution cool down to hand warm temperature.<br>
 <em>NOTE: Make sure the lid is not completely closed to avoid possible exploding of the glass bottle.</em></li>
-<li>Pour gel in gel tray and mix well with <a href="https://www.thermofisher.com/nl/en/home/life-science/dna-rna-purification-analysis/nucleic-acid-gel-electrophoresis/dna-stains/sybr-safe.html" target="_blank" class="adpbl">SYBR Safe.</a> For a small gel (~ 40 mL solution) add 1 µL of SYBR Safe; for a large gel (~80 mL) add 2 µL of SYBR Safe. Add a comb to create wells for the samples. Allow the agarose to solidify (approximately 20 minutes).</li>
+<li>Pour gel in gel tray and mix well with <a href="https://www.thermofisher.com/nl/en/home/life-science/dna-rna-purification-analysis/nucleic-acid-gel-electrophoresis/dna-stains/sybr-safe.html" target="_blank" class="adpbl">SYBR Safe.</a> For a small gel (~ 40mL solution) add 1µL of SYBR Safe; for a large gel (~80mL) add 2µL of SYBR Safe. Add a comb to create wells for the samples. Allow the agarose to solidify (approximately 20 minutes).<br>
+<em>NOTE: For better mixing, add SYBR Safe to bottle instead of tray.</em></li>
 <li>Transfer the gel to the electrophoresis cell, remove the combs and cover the gel  in TAE buffer (1X).<br>
 <em>NOTE: Mind the direction of DNA migration when placing the gel in the cell.</em></li>
 <li>Prepare the electrophoresis samples by adding Nucleic Acid Loading Buffer conform the manufacturer’s instructions.</li>
-<li>Load the molecular weight marker (DNA ladder) in the first well according to manufacturer’s instructions (generally 3-5 µL) and load 5-10 µL of the dyed samples in the other wells.<br>
+<li>Load the molecular weight marker (DNA ladder) in the first well according to manufacturer’s instructions (generally 3-5µL) and load 5-10µL of the dyed samples in the other wells.<br>
 <em>NOTE: Do not contaminate the loading buffer and ladder with SYBR Safe! Do not touch it while wearing a glove.</em></li>
 <li>Connect the cables of the gel tray following the colour code and run at 80-110V for 40-60 min.<br>
@@ Line 451: / Line 535: @@
 This protocol is based on the <a href="https://nld.promega.com/products/dna-purification-quantitation/dna-fragment-purification/wizard-sv-gel-and-pcr-clean-up-system/?catNum=A9281" target="_blank" class="adpbl">Wizard® SV Gel and PCR Clean-Up System</a> of Promega Corporation.<br></p>
 <ol>
-<li>Place the excised gel slice in a 1.5 mL Eppendorf tube.</li>
+<li>Excise a proper band containing the DNA from gel and place the excised gel slice in a 1.5 mL Eppendorf tube.</li>
-<li>Add 10 µL Membrane Binding Solution per 10 mg of gel slice. Vortex and incubate at 50-65 °C until gel slice is completely dissolved.</li>
+<li>Weigh the excised gel slice.</li>
-<li>Insert the SV Minicolumn into Collection Tube and label both of them according to the labelling of your samples.</li>
+<li>Add 10µL Membrane Binding Solution per 10 mg of gel slice. Vortex and incubate at 50-65 °C until gel slice is completely dissolved.</li>
+<li>Insert the SV Minicolumn into the Collection Tube and label both of them according to the labelling of your samples.</li>
 <li>Transfer the dissolved gel mixture to the Minicolumn assembly. Incubate the Minicolumn at room temperature for 1 minute. </li>
 <li>Centrifuge the SV Minicolumn at maximum speed for 1 minute.</li>
@@ Line 462: / Line 547: @@
 <li>Discard the flow through and reinsert the SV Minicolumn into the Collection Tube.</li>
 <li>Repeat the washing step with 500µL of Membrane Wash Solution and centrifuge for 5 minutes at maximum speed. </li>
-<li>Once the Collection Tube is empty, centrifuge the Minicolumn assembly at maximum speed for 1 minute with the microcentrifuge lid open to allow ethanol full evaporation.<br>
+<li>Once the Collection Tube is empty, centrifuge the Minicolumn assembly at maximum speed for 1 minute with the Minicolumn assembly lid open to allow full evaporation of ethanol<br>
 <em>NOTE: Leaving the column at room temperature ameliorates evaporation of residual ethanol traces.</em></li>
-<li>Transfer the SV Minicolumn to a clean labelled 1.5 mL Eppendorf tube.</li>
+<li>Transfer the SV Minicolumn to a clean labelled 1.5mL Eppendorf tube.</li>
-<li>Add 50 µL of pre-warmed MilliQ directly to the centre of the SV Minicolumn, without touching the membrane with the pipette tip.<br>
+<li>Add 50µL of pre-warmed MilliQ directly to the centre of the SV Minicolumn, without touching the membrane with the pipette tip.<br>
-<em>NOTE: Use 30 µL when higher final concentrations of DNA are required or when small quantities of DNA are suspected. </em></li>
+<em>NOTE: Use 30µL when higher final concentrations of DNA are required or when small quantities of DNA are suspected. </em></li>
 <li>Incubate the SV Minicolumn at room temperature for 5 minutes.</li>
 <li>Centrifuge at maximum speed for 1 minute.</li>
-<li>Discard the SV Minicolumn, cap the tube containing the eluted DNA and keep the DNA at 4 °C (for immediate use) or -20 °C (for storage).</li>
+<li>Discard the SV Minicolumn, cap the tube containing the eluted DNA, measure the DNA concentration and keep the DNA at 4 °C (for immediate use) or -20 °C (for storage).</li>
 </ol>
 </p>
@@ Line 480: / Line 565: @@
 Our DpnI digestions were performed with <a href="https://www.neb.com/products/r0176-dpni#Product%20Information" target="_blank" class="adpbl">New England Biolabs DpnI (20.000 units/mL)</a>, which is compatible with CutSmart Buffer by the same manufacturer.<br>
 <ol>
-<li>Prepare a sample in a 0.5 mL microcentrifuge tube as follows:<br>
+<li>Prepare a sample in a 0.5mL microcentrifuge tube as follows:<br>
 <table>
   <tr>
@@ Line 503: / Line 588: @@
     </tr>
 </table>
-<li>Incubate for 1.5 hours at 37°C.</li>
+<li>Incubate for 1.5 hours at 37 °C.</li>
-<li>Heat inactivate the enzyme by incubating at 80oC for 20 minutes.</li>
+<li>Heat inactivate the enzyme by incubating at 80 °C for 20 minutes.</li>
 </ol>
 </p>
@@ Line 512: / Line 597: @@
 <button class="collapsible cadpbl" ><a id="dxCas9mobilityshift-scroll" class="repositioner"></a>dxCas9 Protein Functionality Testing: Mobility Shift</button>
 <div class="content">
-<p>This protocol describes how we evaluated the functionality of the gRNA:dxCas9:DNA complex or the gRNA:dxCas9-Tn5:DNA complex to bindt to the target DNA using a mobility assay. The protocol consists of two parts: binding of dxCas9(-Tn5) to the gRNA and binding of the gRNA:dxCas9(-Tn5) to the target DNA<br>
+<p>This protocol describes how the functionality of the gRNA:dxCas9:DNA complex or the gRNA:dxCas9-Tn5:DNA complex is evaluated to bind to the target DNA using a mobility shift assay. The protocol consists of two parts: binding of dxCas9(-Tn5) to the gRNA and binding of the gRNA:dxCas9(-Tn5) to the target DNA<br>
 <h4 class="adpbl">gRNA:dxCas9(-Tn5) complex formation </h4>
 <em>NOTE: all samples and reagents are kept on ice during preparation. </em>
 <ol>
-<li>Load the purified dxCas9 or dxCas9-Tn5 protein with gRNA provided by <a href="https://arbor.bio/" target="_blank" class="adpbl">Arbor Biotechnologies</a> by adding the following components:</li>
+<li>Load the purified dxCas9 or dxCas9-Tn5 protein with gRNA provided by <a href="https://arbor.bio/" target="_blank" class="adpbl">Arbor Biotechnologies</a> by combining the following components:</li>
 <ol type="I">
 <li>1-100nM dxCas9 or dxCas9-Tn5</li>
 <li>1.6-160nM gRNA</li>
 <em>NOTE: the gRNA and dxCas9 or dxCas9-Tn5 is mixed in a 1:1.6 molar ratio. </em></li>
-<li>10x functionality buffer (20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol, 10mM MgCl2 pH 7.5)</li>
+<li>10X functionality buffer (20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol, 10mM MgCl<sub>2</sub> pH 7.5)</li>
 <li>MilliQ (add up to a final volume of 10µL)</li>
 </ol>
-<li>Pipette the reagents in the following order in a 0.5 mL tube: MilliQ, 10x functionality buffer, dxCas9 or dxCas9-Tn5 protein and gRNA.</li>
+<li>Pipette the reagents in the following order in a 0.5mL tube: MilliQ, 10X functionality buffer, dxCas9 or dxCas9-Tn5 protein and gRNA.</li>
-<li>Incubate at 37°C for 10 minutes. </li>
+<li>Incubate at 37 °C for 10 minutes. </li>
 </ol>
 <h4 class="adpbl">gRNA:dxCas9(-Tn5):Target DNA complex formation </h4>
 <ol>
 <li>Add 1nM Target DNA (our case EPO cDNA) to the gRNA:dxCas9 or gRNA:dxCas9-Tn5 complex.</li>
-<li>Incubate at 37°C for 1 hour. </li>
+<li>Incubate at 37 °C for 1 hour. </li>
 <li>Analyse the samples on a <a href="#nativeTBEpolyacrylamidegel-scroll" class="adpbl">5% native TBE polyacrylamide gel</a> to observe the mobility shift. </li>
 </ol>
@@ Line 539: / Line 624: @@
 <button class="collapsible cadpbl" ><a id="dxCas9trypsinresistance-scroll" class="repositioner"></a>dxCas9 Protein Functionality Testing: Trypsin Resistance</button>
 <div class="content">
-<p>This protocol describes how we evaluated the trypsin resistance of the gRNA-loaded dxCas9 and dxCas9-Tn5 proteins due to a protein conformational change. The protocol consists of two parts: binding of dxCas9(-Tn5) to the gRNA and the trypsin resistance assay<br>
+<p>This protocol describes how the trypsin resistance of the gRNA-loaded dxCas9 and dxCas9-Tn5 proteins were evaluated due to a protein conformational change. The protocol consists of two parts: binding of dxCas9(-Tn5) to the gRNA and the trypsin resistance assay<br>
 <h4 class="adpbl">gRNA:dxCas9(-Tn5) complex formation </h4>
 <em>NOTE: all samples and reagents are kept on ice during preparation. </em>
@@ Line 548: / Line 633: @@
 <li>1.6-160nM gRNA</li>
 <em>NOTE: the gRNA and dxCas9 or dxCas9-Tn5 is mixed in a 1:1.6 molar ratio. </em></li>
-<li>10x functionality buffer (20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol, 10mM MgCl2 pH 7.5)</li>
+<li>10X functionality buffer (20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol, 10mM MgCl<sub>2</sub> pH 7.5)</li>
 <li>MilliQ (add up to a final volume of 10µL)</li>
 </ol>
-<li>Pipette the reagents in the following order in a 0.5 mL tube: MilliQ, 10x functionality buffer, dxCas9 or dxCas9-Tn5 protein and gRNA.</li>
+<li>Pipette the reagents in the following order in a 0.5mL tube: MilliQ, 10X functionality buffer, dxCas9 or dxCas9-Tn5 protein and gRNA.</li>
-<li>Incubate at 37°C for 10 minutes. </li>
+<li>Incubate at 37 °C for 10 minutes. </li>
 </ol>
 <h4 class="adpbl">Trypsin Resistance Assay</h4>
 <ol>
 <li>Add 0.1-10nM Trypsin to the gRNA:dxCas9 or gRNA:dxCas9-Tn5 complex.</li>
-<li>Incubate at 23°C for 30 minutes. </li>
+<li>Incubate at 23 °C for 30 minutes. </li>
 <li>Analyse the samples on a <a href="#SDSPAGEelectrophoresis-scroll" class="adpbl">8% SDS Tris-Glycine polyacrylamide gel</a> to observe the trypsin resistance. </li>
 </ol>
@@ Line 570: / Line 655: @@
 <ol>
 <h4 class="adpbl">Day 1</h4>
-<li>Sterilize the required 50 mL MilliQ and 250 µL glycerol in advance.</li>
+<li>Sterilize the required 50mL MilliQ and 250µL glycerol in advance.</li>
 <li>Keep the -80 °C strain stock of interest on ice.</li>
 <li>Streak the strain on  <a href="#solidmedium-scroll" class="adpbl">solid selective medium</a> and incubate overnight at 37 °C.</li>
@@ Line 576: / Line 661: @@
 <li>Prepare a 10mL<a href="#liquidstarterculture-scroll" class="adpbl"> liquid starter culture</a> with one of the colonies that grew on the selective plate. Let the culture grow overnight at 37 °C, shaking at 180rpm.</li>
 <h4 class="adpbl">Day 3</h4>
-<li>Use 0.5mL of the starter culture to inoculate 35mL selective liquid medium and keep track of the OD600.</li>
+<li>Use 0.5mL of the starter culture to inoculate 35mL selective liquid medium.</li>
 <li>Grow at 37°C while shaking 250 rpm till an OD600 of ~0.5. </li>
-<li>Centrifuge for 10 minutes at 4 °C at 3900 rpm.</li>
+<li>Centrifuge for 10 minutes at 4 °C at 3900rpm.</li>
-<li>Discard the supernatant and resuspend pellet in 20 mL cold Milli-Q.</li>
+<li>Discard the supernatant and resuspend pellet in 20mL cold MilliQ.</li>
-<li>Centrifuge for 10 minutes at 4 °C at 3900 rpm.</li>
+<li>Centrifuge for 10 minutes at 4 °C at 3900rpm.</li>
-<li>Discard the supernatant and resuspend pellet in 20 mL cold Milli-Q.</li>
+<li>Discard the supernatant and resuspend pellet in 20mL cold MilliQ.</li>
-<li>Centrifuge for 10 minutes at 4 °C at 3900 rpm. </li>
+<li>Centrifuge for 10 minutes at 4 °C at 3900rpm. </li>
-<li>Discard supernatant and resuspend in 200 µL 50% glycerol. </li>
+<li>Discard supernatant and resuspend in 200µL 50% glycerol. </li>
-<li>Prepare aliquots of 50 µL. </li>
+<li>Prepare aliquots of 50µL. </li>
 <li>Either transform the <a href="#electrocomptcellstrans-scroll" class="adpbl">electrocompetent cells</a> straight away or store the electrocompetent cells at -80 °C. </li>
 </ol>
@@ Line 596: / Line 681: @@
 <em>NOTE: This protocol allows for a single transformation.</em><br>
 <ol>
-<li>Thaw a 50 µL aliquot of <a href="#electrocomptcellsprep-scroll" class="adpbl">electrocompetent cells</a> on ice.</li>
+<li>Thaw a 50µL aliquot of <a href="#electrocomptcellsprep-scroll" class="adpbl">electrocompetent cells</a> on ice.</li>
 <li>Add ~200 ng DNA to the cells and keep on ice for 20 minutes.<br>
-<em>NOTE: in case of purified plasmid DNA, 50 ng DNA is enough.</em></li>
+<em>NOTE: in case of purified plasmid DNA, 1ng DNA is enough.</em></li>
 <li>Transfer all the content to an electro-shock cuvette.</li>
-<li>Electro-shock the cells with the Electro Cell Manipulator at 2.5 kV.</li>
+<li>Electro-shock the cells with the Electro Cell Manipulator at 2.5kV.</li>
-<li>Immediately add 0.2-1 mL of recovery medium (eg. SOC-medium). Resuspend and transfer to a 1.5 mL tube. </li>
+<li>Immediately add 0.2-1mL of recovery medium (eg. SOC-medium). Resuspend and transfer to a 1.5mL tube. </li>
-<li>Incubate at 37 °C at 250 rpm for 1 hour. </li>
+<li>Incubate at 37 °C at 250rpm for 1 hour. </li>
 <li>Plate the cells on <a href="#solidmedium-scroll" class="adpbl">solid medium</a> with appropriate antibiotics and incubate overnight at 37 °C.</li>
 </ol>
 </p>
 </div>
 <!-- -----------------------G-Block Resuspension --------------------------->
@@ Line 615: / Line 702: @@
 <ol>
 <li>Centrifuge the tube containing the gBlock for 3−5 seconds (>3,000 x g) to pellet the material to the bottom of the tube.</li>
-<li>Add an appropriate volume of sterile Milli-Q to the tube for a desired final concentration. The required volume of Milli-Q can be read from the table below (and the label on the IDT tube that contains your fragment):<br>
+<li>Add an appropriate volume of sterile MilliQ to the tube for a desired final concentration. The required volume of MilliQ can be read from the table below (and the label on the IDT tube that contains your fragment):<br>
 <table>
   <tr>
        <th class="tableheaderadpbl">Final concentration (ng/µL)</th>
-       <th class="tableheaderadpbl">µL MilliQ to add to 250 ng</th>
+       <th class="tableheaderadpbl">µL MilliQ to add to 250ng</th>
-       <th class="tableheaderadpbl">µL MilliQ to add to 250 ng</th>
+       <th class="tableheaderadpbl">µL MilliQ to add to 250ng</th>
-       <th class="tableheaderadpbl">µL MilliQ to add to 250 ng</th>
+       <th class="tableheaderadpbl">µL MilliQ to add to 250ng</th>
     </tr>
     <tr class="tableunevenadpbl">
@@ Line 642: / Line 729: @@
     </tr>
 </table></li>
-<li>Incubate at 50°C for 20 minutes.</li>
+<li>Incubate at 50 °C for 20 minutes.</li>
 <li>Briefly vortex and centrifuge.</li>
 <li>Store the resuspended gBlock at -20 °C.</li>
@@ Line 649: / Line 736: @@
 </div>
+<!-- -----------------------Genomic DNA isolation --------------------------->
+<button class="collapsible cadpbl" ><a id="gdnaisolation-scroll" class="repositioner"></a>Genomic DNA Isolation</button>
+<div class="content">
+<p>
+<i>This protocol is based on MO BIO Laboratories Inc. UltraClean® Microbial DNA Isolation Kit. For more information on the composition of the MD solutions, and for safety precautions, we recommend consulting MO BIO Laboratories’ <a href="https://www.google.com/url?q=https://mobio.com/media/wysiwyg/pdfs/protocols/12224.pdf&sa=D&ust=1539523909568000&usg=AFQjCNH3FVpt7FGSE7QuzdhzmSrmp_oB1A" target="_blank" class="adpbl"> kit manual.</a>.<br> </i>
+<ol>
+<li>Add 1.8 ml of microbial (bacteria, yeast) culture to a 2mL Collection Tube (provided) and centrifuge at 10,000 x g for 30 seconds at room temperature. Decant the supernatant and spin the tubes at 10,000 x g for 30 seconds at room temperature and completely remove the media supernatant with a pipette tip. NOTE: Based on the type of microbial culture, it may be necessary to centrifuge longer than 30 seconds.</li>
+<li>Resuspend the cell pellet in 300µl of MicroBead Solution and gently vortex to mix. Transfer resuspended cells to MicroBead Tube. </li>
+<li>Check Solution MD1. If Solution MD1 is precipitated, heat the solution at 60 °C until the precipitate has dissolved. Add 50µl of Solution MD1 to the MicroBead Tube. </li>
+<li>Optional: To increase yields, to minimize DNA shearing, or for difficult cells, see Alternative lysis methods in the “Hints & Troubleshooting Guide” section before continuing. </li>
+<li>Secure MicroBead Tubes horizontally using the MO BIO Vortex Adapter tube holder for the vortex (MO BIO Catalog# 13000-V1) or secure tubes horizontally on a flat-bed vortex pad with tape. Vortex at maximum speed for 10 minutes. (See “Hints & Troubleshooting Guide” for less DNA shearing). </li>
+<li>Make sure the 2mL MicroBead Tubes rotate freely in the centrifuge without rubbing. Centrifuge the tubes at 10,000 x g for 30 seconds at room temperature. <br><em>CAUTION: Be sure not to exceed 10,000 x g or tubes may break. </em></li>
+<li>Transfer the supernatant to a clean 2mL Collection Tube (provided). Expect 300-350µl of supernatant. </li>
+<li>Add 100 µl of Solution MD2, to the supernatant. Vortex for 5 seconds. Then incubate at 4 °C for 5 minutes. </li>
+<li>Centrifuge the tubes at room temperature for 1 minute at 10,000 x g. </li>
+<li>Avoiding the pellet, transfer the entire volume of supernatant to a clean 2mL Collection Tube (provided). Expect approximately 450µL in volume. </li>
+<li>Shake to mix Solution MD3 before use. Add 900 µl of Solution MD3 to the supernatant and vortex for 5 seconds. </li>
+<li>Load about 700µL into the Spin Filter and centrifuge at 10,000 x g for 30 seconds at room temperature. Discard the flow through, add the remaining supernatant to the Spin Filter, and centrifuge at 10,000 x g for 30 seconds at room temperature. NOTE: A total of 2 to 3 loads for each sample processed are required. Discard all flow through liquid. </li>
+<li>Add 300µL of Solution MD4 and centrifuge at room temperature for 30 seconds at 10,000 x g. </li>
+<li>Discard the flow through. </li>
+<li>Centrifuge at room temperature for 1 minute at 10,000 x g. </li>
+<li>Being careful not to splash liquid on the spin filter basket, place Spin Filter in a new 2mL Collection Tube (provided)</li>
+<li>Add 50µL of Solution MD5 to the center of the white filter membrane. </li>
+<li>Centrifuge at room temperature for 30 seconds at 10,000 x g.</li>
+<li>Discard Spin Filter. The DNA in the tube is now ready for any downstream application. No further steps are required. Store the DNA at -20 °C until further use.</li>
+</ol>
+</p>
+</div>
 <!-- -----------------------GIBSON ASSEMBLY --------------------------->
@@ Line 656: / Line 771: @@
 This Gibson Assembly protocol is based on the <a href="https://international.neb.com/products/e2611-gibson-assembly-master-mix#Product%20Information" target="_blank" class="adpbl">protocol provided by New England Biolabs</a>.
 <ol>
-<li>Thaw 10 µL of 2x Gibson Assembly mastermix (New England Biolabs) on ice.</li>
+<li>Thaw 10µL of 2X Gibson Assembly mastermix (New England Biolabs) on ice.</li>
 <li>Add backbone and insert; depending on the assembly, assembly pieces can be added in a predetermined ratio (recommended is ratio 1:3 mol vector over mol insert, so not a 1:3 ratio based on weight). Do not exceed the total volume of 10µL.<br>
 <em>NOTE: An online ligation calculator can subsequently be used to calculate the amount of the assembly pieces that is required.</em></li>
-<li>If applicable, fill up the reaction volume to 20µL with Milli-Q.<br>
+<li>If applicable, fill up the reaction volume to 20µL with MilliQ.<br>
 <table>
     <tr>
@@ Line 682: / Line 797: @@
     </tr>
 </table>
+<em>NOTE: The vector should have compatible overhangs with the insert(s)</em>
 </li>
-<li>Incubate the assembly reaction at 50 °C for 60 minutes and place on ice for subsequent <a href="#chemcomptcellstrans-scroll" class="adpbl">chemical transformation</a> or <a href="#electrocomptcellstrans-scroll" class="adpbl">electroporation</a>. Otherwise, store at -20°C.</li>
+<li>Incubate the assembly reaction at 50 °C for 60 minutes and place on ice for subsequent <a href="#chemcomptcellstrans-scroll" class="adpbl">chemical transformation</a> or <a href="#electrocomptcellstrans-scroll" class="adpbl">electroporation</a>. Otherwise, store at -20 °C.</li>
 </ol>
 </p>
 </div>
-<!-- -----------------------sgRNA TRANSCRIPTION --------------------------->
-<button class="collapsible cadpbl" ><a id="gRNAtranscription-scroll" class="repositioner"></a>sgRNA Transcription</button>
-<div class="content">
-<p>This protocol is based on the <a href="https://international.neb.com/products/m0251-t7-rna-polymerase#Product%20Information" target="_blank" class="adpbl">standard RNA synthesis of the New England Biolabs T7 RNA Polymerase.</a><br>
-<ol>
-<li>The following components should be assembled at room temperature in the following order:<br>
-<table>
-   <tr>
-      <th class="tableheaderadpbl">Component</th>
-      <th class="tableheaderadpbl">Volume (µL)</th>
-   </tr>
-   <tr class="tableunevenadpbl">
-       <td>10x Reaction Buffer</td>
-       <td>2</td>
-   </tr>
-   <tr class="tableevenadpbl">
-       <td>NTP (each 25mM)</td>
-       <td>4</td>
-   </tr>
-   <tr class="tableunevenadpbl">
-        <td>Template DNA</td>
-        <td>X (0.2 - 1 µg)</td>
-   </tr>
-   <tr class="tableevenadpbl">
-        <td>RNase Inhibitor</td>
-        <td>1 U/µL (final)</td>
-   </tr>
-   <tr class="tableunevenadpbl">
-        <td>DTT</td>
-        <td>5 mM (final)</td>
-   </tr>
-   <tr class="tableevenadpbl">
-        <td>T7 RNA Polymerase</td>
-        <td>2</td>
-   </tr>
-   <tr class="tableunevenadpbl">
-        <td>MilliQ</td>
-        <td>add up to 20 µL</td>
-   </tr>
-</table>
-</li>
-<li>The reaction is incubated at 37<sup>o</sup>C for 4-16 hours.</li>
-<li>The following sequence is used as the template DNA, in which “n” can be substituted to match the target DNA.<br>
-<p class="DNAstyle">
-TAATACGACTCACTATAGGnnnnnnnnnnnnnnnnnnnGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT</p>
-<li>Clean up sgRNA product(s) according to the <a href="#RNAcleanup-scroll" class="adpbl">RNA Clean Up </a>protocol.</li>
-</ol>
-</p>
-</div>
 <!-- -----------------------High Fidelity PCR --------------------------->
@@ Line 751: / Line 818: @@
     </tr>
     <tr class="tableunevenadpbl">
-        <td>5x Phusion HF buffer</td>
+        <td>5X Phusion HF buffer</td>
         <td>10</td>
-        <td>1 X</td>
+        <td>1X</td>
     </tr>
     <tr class="tableevenadpbl">
-        <td>10 mM dNTPs</td>
+        <td>10mM dNTPs</td>
         <td>1</td>
-        <td>200 µM</td>
+        <td>200µM</td>
     </tr>
     <tr class="tableunevenadpbl">
          <td>Primer forward (10µM)</td>
          <td>2.5</td>
-        <td>200 nM</td>
+        <td>200nM</td>
     </tr>
     <tr class="tableevenadpbl">
          <td>Primer reverse (10µM)</td>
          <td>2.5</td>
-        <td>200 nM</td>
+        <td>200nM</td>
     </tr>
     <tr class="tableunevenadpbl">
          <td>DNA template</td>
-         <td>~10 ng to 250 ng*</td>
+         <td>~10ng to 250ng*</td>
          <td></td>
     </tr>
@@ Line 778: / Line 845: @@
          <td>Phusion polymerase</td>
          <td>0.5</td>
-         <td>20 U/mL</td>
+         <td>20U/mL</td>
     </tr>
     <tr class="tableunevenadpbl">
           <td>MilliQ</td>
-          <td>up to 50 µL</td>
+          <td>up to 50µL</td>
           <td></td>
     </tr>
 </table>
-<em>* NOTE: The 10 ng - 250 ng of template DNA are approximate, choose a volume that works fine for all your samples. <br>
+<em>* NOTE: The 10ng - 250ng of template DNA are approximate, choose a volume that works fine for all your samples. <br>
 NOTE: High fidelity PCR with Phusion polymerase can be optimized per case by adding 3% of DMSO.</em></li>
 <li>Close all tubes thoroughly and place them in a thermocycler with the following protocol:
@@ Line 793: / Line 860: @@
     <tr>
        <th class="tableheaderadpbl">Step</th>
-      <th class="tableheaderadpbl">Time (s)</th>
        <th class="tableheaderadpbl">Temperature (°C)</th>
+      <th class="tableheaderadpbl">Time (s)</th>
     </tr>
     <tr class="tableunevenadpbl">
         <td>Initial denaturation</td>
-       <td>30</td>
         <td>98</td>
+       <td>30</td>
     </tr>
     <tr class="tableevenadpbl">
         <td>Denaturation</td>
-       <td>10</td>
         <td>98</td>
+       <td>10</td>
     </tr>
     <tr class="tableunevenadpbl">
          <td>Annealing</td>
-        <td>15</td>
         <td>T<sub>ann</sub>*</td>
+        <td>15</td>
     </tr>
     <tr class="tableevenadpbl">
          <td>Extension</td>
-        <td>15-30 sec per kb DNA</td>
         <td>72</td>
+        <td>15-30 sec per kb DNA</td>
     </tr>
     <tr class="tableunevenadpbl">
          <td>Final extension</td>
-        <td>300</td>
         <td>72</td>
+        <td>300</td>
     </tr>
     <tr class="tableevenadpbl">
          <td>Hold</td>
-        <td>∞</td>
         <td>4</td>
+        <td>∞</td>
     </tr>
 </table>
-  <em>* NOTE: The annealing temperature (T<sub>ann</sub>) is dependent on the melting temperature (T<sub>m</sub>) of the primers used. It is recommended to have T<sub>ann</sub> = T<sub>m</sub> - 5°C.</em></li>
+  <em>* NOTE: The annealing temperature (T<sub>ann</sub>) is dependent on the melting temperature (T<sub>m</sub>) of the primers used. It is recommended to have T<sub>ann</sub> = T<sub>m</sub> - 5 °C.</em></li>
-<li>The PCR product(s) can be checked on gel. In order to do so, cast a gel and prepare the samples according to the <a href="#DNAgelelectrophoresis-scroll" class="adpbl">DNA electrophoresis </a>protocol.</li>
+<li>The PCR product(s) can be checked on agarose gel. In order to do so, cast a gel and prepare the samples according to the <a href="#DNAgelelectrophoresis-scroll" class="adpbl">DNA electrophoresis </a>protocol.</li>
 </ol>
 </p>
@@ Line 846: / Line 913: @@
     </tr>
     <tr class="tableunevenadpbl">
-        <td>10x Ligase buffer</td>
+        <td>10X Ligase buffer</td>
         <td>2</td>
     </tr>
@@ Line 855: / Line 922: @@
     <tr class="tableunevenadpbl">
          <td>DNA vector</td>
-         <td>X (~100 ng)</td>
+         <td>X (~100ng)</td>
     </tr>
     <tr class="tableevenadpbl">
@@ Line 863: / Line 930: @@
     <tr class="tableunevenadpbl">
          <td>MilliQ</td>
-         <td>20-X-Y</td>
+         <td>17-X-Y</td>
     </tr>
 </table>
@@ Line 878: / Line 945: @@
 <ol>
 <li>Dissolve Luria Broth powder in water according to instructions by manufacturer.</li>
-<li>Heat sterilize (121°C) the medium in the autoclave.</li>
+<li>Heat sterilize (121 °C) the medium in the autoclave.</li>
 <li>After cooling down, add the required antibiotic under aseptic conditions.<br>
-<em>NOTE: With our antibiotic stock solutions of 1000x we used 1 µL of antibiotic solution per mL of LB-agar. </em></li>
+<em>NOTE: With our antibiotic stock solutions of 1000x we used 1µL of antibiotic solution per mL of LB-agar. </em></li>
 <li>Store the medium at 4 °C if complemented with antibiotics.</li>
 </ol>
@@ Line 891: / Line 958: @@
 <p>
 <ol>
-<li>Label as many 15 mL Falcon tubes/Erlenmeyer flasks as the number of colonies you want to grow. </li>
+<li>Label as many 15mL Falcon tubes/Erlenmeyer flasks as the number of colonies you want to grow. </li>
-<li>Under aseptic conditions, distribute 10 mL of liquid medium (LB or SOC) for each starter culture. <br>
+<li>Under aseptic conditions, distribute 10mL of liquid medium (LB or SOC) for each starter culture. <br>
 <em>NOTE: Supply with relevant antibiotics.</em></li>
 <li>Under aseptic conditions, pick a colony with the inoculation loop and swirl it in the starter culture to inoculate. <br>
 <em>NOTE: A picked colony cannot be used again; it is recommended to restreak on a 'back-up'-plate and incubate it overnight at 37 °C.</em></li>
-<li>Grow the liquid cultures at 37 °C overnight, shaking at 250 rpm.</li>
+<li>Grow the liquid cultures at 37 °C overnight, shaking at 250rpm.</li>
 </ol>
 </p>
 </div>
+<!-- -----------------------FLOW CELL WASHING KIT --------------------------->
+<button class="collapsible cadpbl" ><a id="flowcellwashing-scroll" class="repositioner"></a>MinION Flow Cell Washing</button>
+<div class="content">
+<p>This protocol describes the steps to be taken to wash a flow cell after performing a sequencing run.</p>
+<ol>
+<li>Thaw components of the Wash kit (WKE_1012) at room temperature.</li>
+<li>After the sequencing run has stopped, add 150µL of Buffer A to the priming port (without opening the SpotOn port).</li>
+<li>Incubate for 10 minutes at room temperature.</li>
+<p>For using immediately:</p>
+<li>Add 500 µL of buffer B slowly on the priming port.</li>
+<li>Slowly take out the waste solution from the waste chamber.</li>
+<li>The flow cell is ready for priming and adding a new DNA library.</li>
+<p>For storage:</p>
+<li>Add 500 µL of storage buffer slowly on the priming port.</li>
+<li>Slowly take out the waste solution from the waste chamber.</li>
+<li>Store flow cell at 4 ºC.</li>
+</ol>
+</div>
 <!-- -----------------------NANODROP DNA QUANTIFICATION--------------------------->
@@ Line 905: / Line 994: @@
 <div class="content">
 <p>
-This protocol intends to quantify DNA, as well as the purity, in isolates, through spectroscopy. Make sure the Nanodrop machinery is installed to measure at wavelengths for dsDNA (260nm) and impurities at 230nm and 280nm. <br>
+This protocol intends to quantify DNA amount, as well as the purity, in DNA purification or extraction samples, through spectroscopy. Make sure the Nanodrop machinery is installed to measure at wavelengths for dsDNA (260nm) and impurities at 230nm and 280nm. <br>
 <ol>
 <li>Clean the measurement surface with a piece of tissue and ethanol.</li>
-<li>Use 1 µL of sterile milli-Q as a blank.</li>
+<li>Use 1µL of sterile MilliQ as a blank.</li>
 <li>Clean the measurement surface with a piece of tissue.</li>
-<li>Use 1 µL of a sample to measure its concentration.<br>
+<li>Use 1µL of a sample to measure its concentration.<br>
 <em>NOTE: It is best to measure the same sample in triplo and use the average value. If you have multiple samples, clean the measurement surface in between measurements.</em></li>
-<li>When done measuring, wipe the measurement surface with a tissue and ethanol.</li>
+<li>When done measuring, wipe the measurement surface with a tissue and MilliQ.</li>
 </ol>
 </p>
@@ Line 920: / Line 1,009: @@
   <button class="collapsible cadpbl" ><a id="Nanodroprotein-scroll" class="repositioner"></a>Nanodrop Protein quantification</button>
 <div class="content">
-<p>This protocol intends to quantify protein, as well as the purity, in isolates, through spectroscopy. Make sure the Nanodrop machinery is installed to measure at wavelengths for 280nm and 260nm.<br>
+<p>This protocol intends to quantify protein amount, as well as the purity, in purification or extraction samples, through spectroscopy. Make sure the Nanodrop machinery is installed to measure at wavelengths for 280nm and 260nm.<br>
 <ol>
 <li>Clean the measurement surface with a piece of tissue and ethanol.</li>
-<li>Use 2 µL of sterile milli-Q as a blank.</li>
+<li>Use 2µL of sterile MilliQ as a blank.</li>
 <li>Clean the measurement surface with a piece of tissue.</li>
-<li>Use 2 µL of a sample to measure its concentration.<br>
+<li>Use 2µL of a sample to measure its concentration.<br>
 <em>NOTE: It is best to measure the same sample in triplo and use the average value. If you have multiple samples, clean the measurement surface in between measurements.</em></li>
-<li>When done measuring, wipe the measurement surface with a tissue and ethanol.</li>
+<li>When done measuring, wipe the measurement surface with a tissue and MilliQ.</li>
 </ol>
 </p>
@@ Line 936: / Line 1,025: @@
 <div class="content">
 <p>
-This protocol intends to quantify RNA, as well as the purity, in isolates, through spectroscopy. Make sure the Nanodrop machinery is installed to measure at wavelengths for ssRNA (260nm) and impurities at 230nm and 280nm. <br>
+This protocol intends to quantify RNA amount, as well as the purity, in purification or extraction samples, through spectroscopy. Make sure the Nanodrop machinery is installed to measure at wavelengths for ssRNA (260nm) and impurities at 230nm and 280nm. <br>
 <ol>
 <li>Clean the measurement surface with a piece of tissue and ethanol.</li>
-<li>Use 1 µL of sterile milli-Q as a blank.</li>
+<li>Use 1µL of sterile MilliQ as a blank.</li>
 <li>Clean the measurement surface with a piece of tissue.</li>
-<li>Use 1 µL of a sample to measure its concentration.<br>
+<li>Use 1µL of a sample to measure its concentration.<br>
 <em>NOTE: It is best to measure the same sample in triplo and use the average value. If you have multiple samples, clean the measurement surface in between measurements.</em></li>
-<li>When done measuring, wipe the measurement surface with a tissue and ethanol.</li>
+<li>When done measuring, wipe the measurement surface with a tissue and MilliQ.</li>
 </ol>
 </p>
@@ Line 956: / Line 1,045: @@
 <h4 class="adpbl">Preparing the native PAGE gel</h4>
 <ol>
-<li>Prepare the following solutions for 2 gels (total 12 mL):<br>
+<li>Prepare the following solutions for 2 gels (total 12mL):<br>
 <table>
   <tr>
@@ Line 964: / Line 1,053: @@
     <tr class="tableunevenadpbl">
         <td>40% Acrylamide</td>
-        <td>1.5 mL</td>
+        <td>1.5mL</td>
     </tr>
     <tr class="tableevenadpbl">
-        <td>10x TBE buffer</td>
+        <td>10X TBE buffer</td>
-        <td>1.2 mL</td>
+        <td>1.2mL</td>
     </tr>
     <tr class="tableunevenadpbl">
@@ Line 976: / Line 1,065: @@
     <tr class="tableevenadpbl">
          <td>TEMED</td>
-         <td>12 µL</td>
+         <td>12µL</td>
     </tr>
     <tr class="tableunevenadpbl">
@@ Line 983: / Line 1,072: @@
     </tr>
 </table>
-<em>NOTE: Polymerization will start when 10% APS and TEMED is added. </em></li>
+<em>NOTE: Polymerization will start when 10% APS and TEMED are added. </em></li>
 <li>Assemble the casting station and pour the separation gel between the glass plates. </li>
 <li>Immediately place the gel comb on top of the gel.</li>
@@ Line 990: / Line 1,079: @@
 <h4 class="adpbl">Preparing samples</h4>
-<li>Add 2μL protein 6x Loading Dye to 10μL of sample.</li>
+<li>Add 2μL protein 6X Loading Dye to 10μL of sample.</li>
 <h4 class="adpbl">Running PAGE gel</h4>
-<li>Run the gel at 150 V and 25 mA.</li>
+<li>Run the gel at 150V and 25mA.</li>
 <li>The gel is finished when the purple line is at the end of the gel.</li>
@@ Line 1,000: / Line 1,089: @@
 <li>Remove the gel from the cassette and place the gel in a clean staining tray of the appropriate size filled with a layer of MilliQ or TBE buffer.</li>
 <li>Gently allow the gel to slide from the glass plate into the water.</li>
-<li>Add 1 µL of Ethidium bromide into the water.</li>
+<li>Add 1µL of Ethidium bromide into the water.</li>
 <li>Allow the gel to shake on a moving platform for 10 minutes.</li>
 <li>Take a picture with the Gel doc system/Typhoon. </li>
@@ Line 1,014: / Line 1,103: @@
 <h4 class="adpbl">Preparing te native PAGE gel</h4>
 <ol>
-<li>Prepare the following solutions for 2 gels (total 12 mL):<br>
+<li>Prepare the following solutions for 2 gels (total 12mL):<br>
 <table>
   <tr>
@@ Line 1,022: / Line 1,111: @@
     <tr class="tableunevenadpbl">
         <td>40% Acrylamide</td>
-        <td>1.5 mL</td>
+        <td>1.5mL</td>
     </tr>
     <tr class="tableevenadpbl">
-        <td>10x TBE buffer</td>
+        <td>10X TBE buffer</td>
-        <td>1.2 mL</td>
+        <td>1.2mL</td>
     </tr>
     <tr class="tableunevenadpbl">
@@ Line 1,034: / Line 1,123: @@
     <tr class="tableevenadpbl">
          <td>TEMED</td>
-         <td>12 µL</td>
+         <td>12µL</td>
     </tr>
     <tr class="tableunevenadpbl">
@@ Line 1,041: / Line 1,130: @@
     </tr>
 </table>
-<em>NOTE: Polymerization will start when 10% APS and TEMED is added. </em></li>
+<em>NOTE: Polymerization will start when 10% APS and TEMED are added. </em></li>
 <li>Assemble the casting station and pour the separation gel between the glass plates. </li>
 <li>Immediately place the gel comb on top of the gel.</li>
@@ Line 1,048: / Line 1,137: @@
 <h4 class="adpbl">Preparing samples</h4>
-<li>Add 2μL protein 6x Loading Dye to 10μL of sample.</li>
+<li>Add 2μL protein 6X Loading Dye to 10μL of sample.</li>
 <h4 class="adpbl">Running PAGE gel</h4>
-<li>Run the gel at 150 V and 25 mA.</li>
+<li>Run the gel at 150V and 25mA.</li>
 <li>The gel is finished when the purple line is at the end of the gel.</li>
@@ Line 1,093: / Line 1,182: @@
 <em>NOTE: The gel can be stored in the fixative overnight if there is not enough time to complete the staining protocol. </em></li>
 <li>Decant the fixative solution and wash the gel in 30% ethanol for 10 minutes.</li>
-<li>Decant the ethanol and wash the gel in 100 mL of Sensitizing solution for 10 minutes. </li>
+<li>Decant the ethanol and wash the gel in 100mL of Sensitizing solution for 10 minutes. </li>
-<li>Decant the Sensitizing solution and wash the gel in 100 mL of 30% ethanol for 10 minutes. </li>
+<li>Decant the Sensitizing solution and wash the gel in 100mL of 30% ethanol for 10 minutes. </li>
-<li>Decant the 30% ethanol and wash the gel in 100 mL of ultrapure water for 10 minutes. </li>
+<li>Decant the 30% ethanol and wash the gel in 100mL of ultrapure water for 10 minutes. </li>
-<li>Decant the water and indicate the gel in 100 mL of Staining solution for 15 minutes. </li>
+<li>Decant the water and indicate the gel in 100mL of Staining solution for 15 minutes. </li>
-<li>Decant the Staining solution and wash the gel with 100 mL of ultrapure water for 20–60 seconds. <br>
+<li>Decant the Staining solution and wash the gel with 100mL of ultrapure water for 20–60 seconds. <br>
 <em>Note: Washing the gel for more than a minute will remove silver ions from the gel resulting in decreased sensitivity. </em></li>
-<li>Incubate the gel in 100 mL of Developing solution for 4–8 minutes until bands start to appear and the desired band intensity is reached. </li>
+<li>Incubate the gel in 100mL of Developing solution for 4–8 minutes until bands start to appear and the desired band intensity is reached. </li>
 <li>After the appropriate staining intensity is achieved, immediately add 10 mL of Stopper directly to the gel still immersed in Developing solution.</li>
 <li>Gently agitate the gel for 10 minutes. <br>
@@ Line 1,126: / Line 1,215: @@
 <li>Once the Collection Tube is empty, centrifuge the Minicolumn assembly at maximum speed for 1 minute with the microcentrifuge lid open to allow ethanol full evaporation.<br>
 <em>NOTE: Leaving the column at room temperature ameliorates evaporation of residual ethanol traces.</em></li>
-<li>Transfer the SV Minicolumn to a clean labelled 1.5 mL Eppendorf tube.</li>
+<li>Transfer the SV Minicolumn to a clean labelled 1.5mL Eppendorf tube.</li>
-<li>Add 50 µL of pre-warmed MilliQ directly to the centre of the SV Minicolumn, without touching the membrane with the pipette tip.<br>
+<li>Add 50µL of pre-warmed MilliQ directly to the centre of the SV Minicolumn, without touching the membrane with the pipette tip.<br>
-<em>NOTE: Use 30 µL when higher final concentrations of DNA are required or when small quantities of DNA are suspected. </em></li>
+<em>NOTE: Use 30µL when higher final concentrations of DNA are required or when small quantities of DNA are suspected. </em></li>
 <li>Incubate the SV Minicolumn at room temperature for 5 minutes.</li>
 <li>Centrifuge at maximum speed for 1 minute.</li>
@@ Line 1,135: / Line 1,224: @@
 </p>
 </div>
+<!-- -----------------------PGEM T-Easy CLONING--------------------------->
+ <button class="collapsible cadpbl"><a id="pgemeasycloning-scroll" class="repositioner"></a>p-GEM T-Easy Cloning</button>
+<div class="content">
+<p>The protocol is based on Promega’s <a href="https://nld.promega.com/products/pcr/pcr-cloning/pgem-t-easy-vector-systems/?catNum=A1360" class="adpbl" target="_blank">pGEM T-Easy Vector System </a>technical manual.<br>
+pGEM T-Easy vector system can be used to clone PCR amplification products by Taq polymerase on separate plasmids. The following steps are done to complete the protocol:
+Briefly centrifuge the pGEM.-T Easy Vector and insert DNA tubes.<br>
+<ol>
+<li>Set up ligation reactions in the following order:</li>
+<ul class="uladpbl">
+<li>5µl 2x Rapid Ligation Buffer, T4 DNA Ligase</li>
+<li>1µl pGEM-T Easy vector</li>
+<li>Xµl PCR product (to obtain 3:1 insert:vector molar ratio)</li>
+<li>1µl T4 DNA Ligase</li>
+<li>Xµl MilliQ to 10µl</li>
+</ul>
+<li>Incubate overnight at 4C.</li>
+<li>Transform ligates into competent cells according to the <a href="#chemcomptcellstrans-scroll" class="adpbl">chemical competent cell transformation protocol</a>.</li>
+<li>Blue/white colony screening to chose for colonies with inserts.</li>
+<li>To calculate the amount of PCR product needed, the following formula can be used:
+<img src="https://static.igem.org/mediawiki/2018/a/a6/T--TUDelft--equationprotocol.png" width="100%" height="auto" alt="equation">
+<br>
+</li>
+</ol>
+</div>
 <!-- -----------------------PLASMID ISOLATION--------------------------->
@@ Line 1,142: / Line 1,259: @@
 <ol>
 <li>Centrifuge 1.5-3mL of a <a href="#liquidstarterculture-scroll" class="adpbl">liquid (starter) culture</a> for 1 minute in a 1.5mL microcentrifuge tube at maximum speed.</li>
-<li>Discard the supernatant and resuspend in 600µL of Milli-Q. </li>
+<li>Discard the supernatant and resuspend in 600µL of MilliQ. </li>
-<li>Add 100 µL of Cell Lysis Buffer, and mix by inverting the tube.</li>
+<li>Add 100µL of Cell Lysis Buffer, and mix by inverting the tube.</li>
-<li>Add 350 µL of cold (4–8 °C) Neutralization Solution, and mix thoroughly by inverting.</li>
+<li>Add 350µL of cold (4–8 °C) Neutralization Solution, and mix thoroughly by inverting.</li>
 <li>Centrifuge at maximum speed in a microcentrifuge for 3 minutes.</li>
-<li>Transfer the supernatant (~900 µl) to a PureYield™ Minicolumn without disturbing the cell debris pellet.</li>
+<li>Transfer the supernatant (~900µl) to a PureYield™ Minicolumn without disturbing the cell debris pellet.</li>
 <li>Place the minicolumn into a Collection Tube and centrifuge at maximum speed in a microcentrifuge for 15 seconds.</li>
 <li>Discard the flow through, and place the minicolumn into the same Collection Tube.</li>
-<li>Add 200 µl of Endotoxin Removal Wash (ERB) to the minicolumn. Centrifuge at maximum speed in a microcentrifuge for 15 seconds.</li>
+<li>Add 200µl of Endotoxin Removal Wash (ERB) to the minicolumn. Centrifuge at maximum speed in a microcentrifuge for 15 seconds.</li>
-<li>Add 400 µl of Column Wash Solution (CWC) to the minicolumn. Centrifuge at maximum speed in a microcentrifuge for 30 seconds.</li>
+<li>Add 400µl of Column Wash Solution (CWC) to the minicolumn. Centrifuge at maximum speed in a microcentrifuge for 30 seconds.</li>
-<li>Transfer the minicolumn to a clean, labelled 1.5 ml microcentrifuge tube, then add 30 µl of sterile Milli-Q directly to the minicolumn matrix. Incubate for 1 minute at room temperature.</li>
+<li>Transfer the minicolumn to a clean, labelled 1.5 ml Eppendorf tube, then add 30µl of sterile MilliQ directly to the minicolumn matrix. Incubate for 1 minute at room temperature.</li>
-<li>Centrifuge for 15 seconds to elute the plasmid DNA. Discart the column and label the tube. The isolate should be stored at -20°C.</li>
+<li>Centrifuge for 15 seconds to elute the plasmid DNA. Discart the column and label the tube. The isolate can be stored at -20 °C or directly used.</li>
 </ol>
 </p>
@@ Line 1,163: / Line 1,280: @@
 <ol>
 <li>Centrifuge the tube containing the primer for 3−5 seconds (>3,000 x g) to pellet the material to the bottom of the tube.</li>
-<li>Dissolve the DNA material in sterile Milli-Q according to the supplier IDT. This creates a 100 µM stock solution.</li>
+<li>Dissolve the DNA material in sterile MilliQ according to the supplier IDT. This creates a 100µM stock solution.</li>
 <li>Heat the primer stock solution to 65 °C for 20 minutes.</li>
 <li>Centrifuge the primer stock solution at maximum speed (~17,000 x g) for 2 minutes.</li>
-<li>Prepare a 10x diluted work solution (10 µm) by dilution with sterile Milli-Q.</li>
+<li>Prepare a 10X diluted work solution (10µM) by dilution with sterile MilliQ.</li>
 <li>Store both Stock and Work solutions at -20 °C.</li>
 </ol>
@@ Line 1,179: / Line 1,296: @@
 <h4 class="adpbl">Cell Culture</h4>
 <li>Inoculate a single colony from an agar plate containing transformed cells in a <a href="#liquidstarterculture-scroll" class="adpbl">10 mL starter culture</a> with appropriate antibiotic selection marker.</li>
-<li>Let the seed culture grow overnight ot 37 °C with 180 rpm rotation. </li>
+<li>Let the seed culture grow overnight at 37 °C with 180 rpm rotation. </li>
 <li>Measure the OD600 to confirm growth (an OD600 of around 2 is to be expected). </li>
-<li>Prepare 1 L of media with the required antibiotics. </li>
+<li>Prepare 1L of media with the required antibiotics. </li>
 <li>Inoculate the media with 10 mL of the seed culture (1:100 ratio).</li>
 <li>Let the culture grow until an OD600 of 0.5.</li>
 <li>When the required OD is reached, put the culture on ice for 30 minutes. </li>
 <li>After the 30 minutes, induce the expression of the protein by adding 1M IPTG to a final concentration of 1mM and 20% arabinose to a final concentration 0.2% arabinose. </li>
-<li>Grow the cells for 16 hours on 18 °C and 180 rpm rotation.</li>
+<li>Grow the cells for 16 hours ot 18 °C and 180rpm rotation.</li>
 <h4 class="adpbl">Cell Harvest</h4>
-<li>Harvest the liquid culture by centrifugation at 5200 g and 4°C for 15 minutes.</li>
+<li>Harvest the liquid culture by centrifugation at 5200g and 4 °C for 15 minutes.</li>
-<li>Discard the supernatant and weigh the pellet. Resuspend the pellet with 6 mL PBS/g cells.</li>
+<li>Discard the supernatant and weigh the pellet. Resuspend the pellet with 6mL PBS/g cells.</li>
-<li>Centrifuge the cells 15 minutes at 5200 g and 4°C, and again discard supernatant.</li>
+<li>Centrifuge the cells 15 minutes at 5200 g and 4 °C, and again discard supernatant.</li>
 <li>The cells are now directly passed off to downstream processing. </li>
 </ol>
@@ Line 1,200: / Line 1,317: @@
   <button class="collapsible cadpbl"><a id="proteinpurificationdxCas9-scroll" class="repositioner"></a>Protein Purification dxCas9</button>
 <div class="content">
-<p>This protocol describes how we finally performed the downstream processing of dxCas9. <br>
+<p>This protocol describes the optimized downstream processing of dxCas9. <br>
 <ol>
 <h4 class="adpbl">Cell Lysis</h4>
 <li>Retrieve a washed cell pellet from upstream processing according to the <a href="#proteinexpressionandlysis-scroll" class="adpbl">protein expression</a> protocol. <br>
 <em>NOTE: All following steps in this purification protocol are done at 4 °C.</em></li>
-<li>Resuspend the pellet in lysis buffer (20 mM Tris-HCL, 250 mM NaCl, 10% v/v glycerol, 1 mM DTT, 5 mM imidazole, pH 8.0) and one protease inhibitor tablet per 50mL lysis buffer. Make sure pellet is fully resuspended.</li>
+<li>Resuspend the pellet in lysis buffer (20mM Tris-HCL, 250mM NaCl, 10% v/v glycerol, 1mM DTT, 5mM imidazole, pH 8.0) and one protease inhibitor tablet per 50mL lysis buffer. Make sure pellet is fully resuspended.</li>
 <li>Lyse the cells using a high-pressure homogenizer (French Press) (2 rounds at 1 kbar).</li>
@@ Line 1,214: / Line 1,331: @@
 <h4 class="adpbl">Nickel Affinity Chromatography</h4>
 <li>Perform Nickel affinity chromatography with a gravity column.<br>
-<em>NOTE: 1 mL of 50% His-Select Ni resin per 15mL clarified lysate for high expression proteins. </em></li>
+<em>NOTE: 1mL of 50% His-Select Ni resin per 15mL clarified lysate for high expression proteins. </em></li>
-<li>Resuspend 1 mL of 50% Hisselect Nickel Affinity gel in 10mL (20CV) water, spinning down at 3220 g for 1 min and discard the supernatant. Repeat this three times.</li>
+<li>Resuspend 1mL of 50% Hisselect Nickel Affinity gel in 10mL (20CV) water, spinning down at 3220g for 1 min and discard the supernatant. Repeat this three times.</li>
-<li>Equilibrate the washed resin with 10mL (20CV) of equilibration buffer (20 mM Tris-HCl, 250 mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8), spinning down at 3220 g for 1 min and discard the supernatant. </li>
+<li>Equilibrate the washed resin with 10mL (20CV) of equilibration buffer (20mM Tris-HCl, 250mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8), spinning down at 3220g for 1 min and discard the supernatant. </li>
 <li>Add the Hisselect column material to the clarified lysate and incubate for one hour with gentle mixing.</li>
 <li>Spin down the mixture, for 1 min at 2000 g. <br>
 <em>NOTE: This mixture contains dxCas9 bound to Hisselect Nickel resin.</em></li>
 <li>Discard the supernatant by pipetting and load the resin onto a gravity column.</li>
-<li>Wash the resin five times in 2 mL (20CV) of washing buffer (20 mM Tris-HCl, 250 mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8) and collect the flowthrough.</li>
+<li>Wash the resin five times in 2mL (20CV) of washing buffer (20mM Tris-HCl, 250mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8) and collect the flowthrough.</li>
-<li>Elute the dxCas9 from the resin with six fractions of 500 μL of elution buffer (20 mM Tris-HCl, 250 mM NaCl, 1 mM DTT and 250 mM imidazole, pH 8.0), and collect in differently labeled tubes.</li>
+<li>Elute the dxCas9 from the resin with six fractions of 500μL of elution buffer (20mM Tris-HCl, 250mM NaCl, 1mM DTT and 250mM imidazole, pH 8.0), and collect in differently labeled tubes.</li>
 <li>Measure the A280 of all six elution fractions at the Nanodrop, to roughly estimate the protein concentrations.</li>
 <li>Load the all the samples including the elution fractions onto an <a href="#SDSPAGEelectrophoresis-scroll" class="adpbl">SDS 8% Tris-Glycine PAGE gel</a> to confirm presence of the protein.</li>
@@ Line 1,230: / Line 1,347: @@
 <li>Perform heparin chromatography on the AKTA pure with a 1 mL HiTrap Heparin HP column.</li>
 <li>Set the following settings:
-<ul class="ourlist">
+<ul class="uladpbl">
 <li>Flow rate: 0.5mL/min</li>
-<li>Maximum column pressure: 0.5 MPa</li>
+<li>Maximum column pressure: 0.5MPa</li>
 </ul>
 <li>Perform the following method on the AKTA.<br>
@@ Line 1,252: / Line 1,369: @@
     <tr class="tableevenadpbl">
         <td>Column equilibrating</td>
-        <td>20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1 mM DTT, pH 7.5</td>
+        <td>20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM DTT, pH 7.5</td>
         <td>20</td>
         <td>20</td>
@@ Line 1,266: / Line 1,383: @@
     <tr class="tableevenadpbl">
         <td>Washing</td>
-        <td>20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1 mM DTT, pH 7.5</td>
+        <td>20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM DTT, pH 7.5</td>
         <td>20</td>
         <td>20</td>
-        <td>1 Fraction in a 50 mL Falcon tube</td>
+        <td>1 Fraction in a 50mL Falcon tube</td>
     </tr>
     <tr class="tableunevenadpbl">
         <td>Eluting</td>
-        <td>20 mM Tris-HCl, 1.5 M NaCl, 10% v/v glycerol, 1 mM DTT, pH 7.5</td>
+        <td>20mM Tris-HCl, 1.5M NaCl, 10% v/v glycerol, 1mM DTT, pH 7.5</td>
         <td>30</td>
         <td>30</td>
-        <td>60 Fractions in a 1 mL tube</td>
+        <td>60 Fractions in a 1mL tube</td>
     </tr>
    <tr class="tableevenadpbl">
@@ Line 1,299: / Line 1,416: @@
 <h4 class="adpbl">Dialysis</h4>
 <li>Pool the fraction that contain the dxCas9.</li>
-<li>Prepare 2L of dialysis buffer (20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol and pH 7.5).</li>
+<li>Prepare 2L of dialysis buffer (20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol and pH 7.5).</li>
 <li>Inject the pooled fractions (0.5-3mL) into a pierce 10,000 Molecular weight cut off cassette.</li>
-<li>Buffer exchange by dialysis of the pooled fractions for 1 hour in 1 L dialysis buffer.</li>
+<li>Buffer exchange by dialysis of the pooled fractions for 1 hour in 1L dialysis buffer.</li>
 <li>Replace the dialysis buffer with fresh buffer and repeat dialysis for 1 hour.</li>
 <li>Remove the dxCas9 solution out of the dialysis cassette and measure the concentration with the <a href="#BCAproteinquantification-scroll" class="adpbl">Pierce BCA protein assay kit</a> by Thermo Scientific.</li>
@@ Line 1,312: / Line 1,429: @@
 <button class="collapsible cadpbl"><a id="proteinpurificationTn5-scroll" class="repositioner"></a>Protein Purification Tn5</button>
 <div class="content">
-<p>This protocol describes how we finally performed the downstream processing of Tn5. <br>
+<p>This protocol describes the optimized downstream processing of Tn5. <br>
 <ol>
 <h4 class="adpbl">Cell Lysis</h4>
 <li>Retrieve a washed cell pellet from upstream processing according to the <a href="#proteinexpressionandlysis-scroll" class="adpbl">protein expression</a> protocol. <br>
 <em>NOTE: All following steps in this purification protocol are done at 4 °C.</em></li>
-<li>Resuspend the pellet in lysis buffer (20 mM Tris-HCL, 250 mM NaCl, 10% v/v glycerol, 1 mM DTT, 5 mM imidazole, pH 8.0) and one protease inhibitor tablet per 50mL lysis buffer. Make sure pellet is fully resuspended.</li>
+<li>Resuspend the pellet in lysis buffer (20mM Tris-HCL, 250mM NaCl, 10% v/v glycerol, 1mM DTT, 5mM imidazole, pH 8.0) and one protease inhibitor tablet per 50mL lysis buffer. Make sure pellet is fully resuspended.</li>
 <li>Lyse the cells using a high-pressure homogenizer (French Press) (2 rounds at 1 kbar).</li>
@@ Line 1,326: / Line 1,443: @@
 <h4 class="adpbl">Nickel Affinity Chromatography</h4>
 <li>Perform Nickel affinity chromatography with a gravity column.<br>
-<em>NOTE: 1 mL of 50% His-Select Ni resin per 15mL clarified lysate for high expression proteins. </em></li>
+<em>NOTE: 1mL of 50% His-Select Ni resin per 15mL clarified lysate for high expression proteins. </em></li>
-<li>Resuspend 1 mL of 50% Hisselect Nickel Affinity gel in 10mL (20CV) water, spinning down at 3220 g for 1 min and discard the supernatant. Repeat this three times.</li>
+<li>Resuspend 1mL of 50% Hisselect Nickel Affinity gel in 10mL (20CV) water, spinning down at 3220 g for 1 min and discard the supernatant. Repeat this three times.</li>
-<li>Equilibrate the washed resin with 10mL (20CV) of equilibration buffer (20 mM Tris-HCl, 250 mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8), spinning down at 3220 g for 1 min and discard the supernatant. </li>
+<li>Equilibrate the washed resin with 10mL (20CV) of equilibration buffer (20mM Tris-HCl, 250mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8), spinning down at 3220 g for 1 min and discard the supernatant. </li>
 <li>Add the Hisselect column material to the clarified lysate and incubate for one hour with gentle mixing.</li>
 <li>Spin down the mixture, for 1 min at 2000 g. <br>
 <em>NOTE: This mixture contains Tn5 bound to Hisselect Nickel resin.</em></li>
 <li>Discard the supernatant by pipetting and load the resin onto a gravity column.</li>
-<li>Wash the resin five times in 2 mL (20CV) of washing buffer (20 mM Tris-HCl, 250 mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8) and collect the flowthrough.</li>
+<li>Wash the resin five times in 2 mL (20CV) of washing buffer (20mM Tris-HCl, 250mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8) and collect the flowthrough.</li>
-<li>Elute the Tn5 from the resin with six fractions of 500 μL of elution buffer (20 mM Tris-HCl, 250 mM NaCl, 1 mM DTT and 250 mM imidazole, pH 8.0), and collect in differently labeled tubes.</li>
+<li>Elute the Tn5 from the resin with six fractions of 500μL of elution buffer (20mM Tris-HCl, 250mM NaCl, 1mM DTT and 250mM imidazole, pH 8.0), and collect in differently labeled tubes.</li>
 <li>Measure the A280 of all six elution fractions at the Nanodrop, to roughly estimate the protein concentrations.</li>
 <li>Load the all the samples including the elution fractions onto an <a href="#SDSPAGEelectrophoresis-scroll" class="adpbl">SDS 12% Tris-Glycine PAGE gel</a> to confirm presence of the protein.</li>
@@ Line 1,342: / Line 1,459: @@
 <li>Perform heparin chromatography on the AKTA pure with a 1 mL HiTrap Heparin HP column.</li>
 <li>Set the following settings:
-<ul class="ourlist">
+<ul class="uladpbl">
 <li>Flow rate: 0.5mL/min</li>
 <li>Maximum column pressure: 0.5 MPa</li>
@@ Line 1,364: / Line 1,481: @@
     <tr class="tableevenadpbl">
         <td>Column equilibrating</td>
-        <td>20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1 mM DTT, pH 7.5</td>
+        <td>20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM DTT, pH 7.5</td>
         <td>20</td>
         <td>20</td>
@@ Line 1,378: / Line 1,495: @@
     <tr class="tableevenadpbl">
         <td>Washing</td>
-        <td>20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1 mM DTT, pH 7.5</td>
+        <td>20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM DTT, pH 7.5</td>
         <td>20</td>
         <td>20</td>
-        <td>1 Fraction in a 50 mL Falcon tube</td>
+        <td>1 Fraction in a 50mL Falcon tube</td>
     </tr>
     <tr class="tableunevenadpbl">
         <td>Eluting</td>
-        <td>20 mM Tris-HCl, 1.5 M NaCl, 10% v/v glycerol, 1 mM DTT, pH 7.5</td>
+        <td>20mM Tris-HCl, 1.5M NaCl, 10% v/v glycerol, 1mM DTT, pH 7.5</td>
         <td>30</td>
         <td>30</td>
@@ Line 1,411: / Line 1,528: @@
 <h4 class="adpbl">Dialysis</h4>
 <li>Pool the fraction that contain the Tn5.</li>
-<li>Prepare 2L of dialysis buffer (20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol and pH 7.5).</li>
+<li>Prepare 2L of dialysis buffer (20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol and pH 7.5).</li>
 <li>Inject the pooled fractions (0.5-3mL) into a pierce 10,000 Molecular weight cut off cassette.</li>
-<li>Buffer exchange by dialysis of the pooled fractions for 1 hour in 1 L dialysis buffer.</li>
+<li>Buffer exchange by dialysis of the pooled fractions for 1 hour in 1L dialysis buffer.</li>
 <li>Replace the dialysis buffer with fresh buffer and repeat dialysis for 1 hour.</li>
 <li>Remove the Tn5 solution out of the dialysis cassette.</li>
 <h4 class="adpbl">Protein Concentration</h4>
-<li>Wash a Amicon ultra-15mL centrifugal filter units with an 10,000 molecular weight cutoff with Milli-Q water by centrifuging at 4,000 × g for approximately 10–20 minutes.</li>
+<li>Wash a Amicon ultra-15mL centrifugal filter units with an 10,000 molecular weight cutoff with MilliQ water by centrifuging at 4,000 × g for approximately 10–20 minutes.</li>
 <li>Add the Tn5 sample to the filter and centrifuged at 4,000 × g for approximately 10–20 minutes.</li>
 <li>Measure the Tn5 protein concentration with the <a href="#BCAproteinquantification-scroll" class="adpbl">Pierce BCA protein assay kit</a> by Thermo Scientific.</li>
@@ Line 1,430: / Line 1,547: @@
 <button class="collapsible cadpbl"><a id="proteinpurificationdxCas9Tn5-scroll" class="repositioner"></a>Protein Purification dxCas9-Tn5</button>
 <div class="content">
-<p>This protocol describes how we finally performed the downstream processing of dxCas9-Tn5. <br>
+<p>This protocol describes how the downstream processing of dxCas9-Tn5 was performed. <br>
 <ol>
 <h4 class="adpbl">Cell Lysis</h4>
 <li>Retrieve a washed cell pellet from upstream processing according to the <a href="#proteinexpressionandlysis-scroll" class="adpbl">protein expression</a> protocol. <br>
 <em>NOTE: All following steps in this purification protocol are done at 4 °C.</em></li>
-<li>Resuspend the pellet in lysis buffer (20 mM Tris-HCL, 250 mM NaCl, 1 mM DTT, 10% v/v glycerol, 1mM PMSF, pH 7.5) and one protease inhibitor tablet per 50mL lysis buffer. Make sure pellet is fully resuspended.</li>
+<li>Resuspend the pellet in lysis buffer (20mM Tris-HCL, 250mM NaCl, 1mM DTT, 10% v/v glycerol, 1mM PMSF, pH 7.5) and one protease inhibitor tablet per 50mL lysis buffer. Make sure pellet is fully resuspended.</li>
 <li>Lyse the cells using a high-pressure homogenizer (French Press) (2 rounds at 1 kbar).</li>
@@ Line 1,444: / Line 1,561: @@
 <h4 class="adpbl">Heparin Chromatography </h4>
-<li>Perform heparin chromatography on the AKTA pure with a 1 mL HiTrap Heparin HP column.</li>
+<li>Perform heparin chromatography on the AKTA pure with a 1mL HiTrap Heparin HP column.</li>
 <li>Set the following settings:
-<ul class="ourlist">
+<ul class="uladpbl">
 <li>Flow rate: 0.5mL/min</li>
 <li>Maximum column pressure: 0.5 MPa</li>
@@ Line 1,468: / Line 1,585: @@
     <tr class="tableevenadpbl">
         <td>Column equilibrating</td>
-        <td>20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1mM PMSF, pH 7.5</td>
+        <td>20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM PMSF, pH 7.5</td>
         <td>20</td>
         <td>20</td>
@@ Line 1,482: / Line 1,599: @@
     <tr class="tableevenadpbl">
         <td>Washing</td>
-        <td>20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1mM PMSF, 1 mM DTT, pH 7.5</td>
+        <td>20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM PMSF, 1mM DTT, pH 7.5</td>
         <td>20</td>
         <td>20</td>
@@ Line 1,489: / Line 1,606: @@
     <tr class="tableunevenadpbl">
         <td>Eluting</td>
-        <td>20 mM Tris-HCl, 1.5 M NaCl, 10% v/v glycerol, 1mM PMSF, 1 mM DTT, pH 7.5</td>
+        <td>20mM Tris-HCl, 1.5M NaCl, 10% v/v glycerol, 1mM PMSF, 1mM DTT, pH 7.5</td>
         <td>30</td>
         <td>30</td>
-        <td>60 Fractions in a 1 mL tube</td>
+        <td>60 Fractions in a 1mL tube</td>
     </tr>
    <tr class="tableevenadpbl">
@@ Line 1,516: / Line 1,633: @@
 <li>Perform anionic exchange chromatography on the AKTA pure with a 1mL MonoQ 5/50 GL column on the crude extract.
 <li>Set the following settings:
-<ul class="ourlist">
+<ul class="uladpbl">
 <li>Flow rate: 0.5mL/min</li>
 <li>Maximum column pressure: 20 MPa</li>
@@ Line 1,538: / Line 1,655: @@
     <tr class="tableevenadpbl">
         <td>Column equilibrating</td>
-        <td>20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1mM PMSF, 1 mM DTT, pH 8.5</td>
+        <td>20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM PMSF, 1mM DTT, pH 8.5</td>
         <td>20</td>
         <td>20</td>
@@ Line 1,545: / Line 1,662: @@
     <tr class="tableunevenadpbl">
         <td>Sample loading</td>
-        <td>Pooled fractions diluted 4 times with 20 mM Tris-HCl, 0 mM NaCl, 10% v/v glycerol, 1mM PMSF, 1 mM DTT, pH 8.5</td>
+        <td>Pooled fractions diluted 4 times with 20mM Tris-HCl, 0mM NaCl, 10% v/v glycerol, 1mM PMSF, 1mM DTT, pH 8.5</td>
         <td>1-20</td>
         <td>1-20</td>
@@ Line 1,552: / Line 1,669: @@
     <tr class="tableevenadpbl">
         <td>Washing</td>
-        <td>20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1mM PMSF, 1 mM DTT, pH 8.5</td>
+        <td>20mM Tris-HCl, 250mM NaCl, 10% v/v glycerol, 1mM PMSF, 1mM DTT, pH 8.5</td>
         <td>20</td>
         <td>20</td>
@@ Line 1,559: / Line 1,676: @@
     <tr class="tableunevenadpbl">
         <td>Eluting</td>
-        <td>20 mM Tris-HCl, 1.5 M NaCl, 10% v/v glycerol, 1mM PMSF, 1 mM DTT, pH 8.5</td>
+        <td>20mM Tris-HCl, 1.5M NaCl, 10% v/v glycerol, 1mM PMSF, 1mM DTT, pH 8.5</td>
         <td>30</td>
         <td>30</td>
@@ Line 1,585: / Line 1,702: @@
 <h4 class="adpbl">Dialysis</h4>
 <li>Pool the fraction that contain the dxCas9-L-Tn5.</li>
-<li>Prepare 2L of dialysis buffer (20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol 1mM PMSF and pH 7.5).</li>
+<li>Prepare 2L of dialysis buffer (20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol, 1mM PMSF and pH 7.5).</li>
 <li>Inject the pooled fractions (0.5-3mL) into a pierce 10,000 Molecular weight cut off cassette.</li>
-<li>Buffer exchange by dialysis of the pooled fractions for 1 hour in 1 L dialysis buffer.</li>
+<li>Buffer exchange by dialysis of the pooled fractions for 1 hour in 1L dialysis buffer.</li>
 <li>Replace the dialysis buffer with fresh buffer and repeat dialysis for 1 hour.</li>
 <li>Remove the dxCas9-Tn5 solution out of the dialysis cassette.</li>
 <h4 class="adpbl">Protein Concentration</h4>
-<li>Wash a Amicon ultra-15mL centrifugal filter units with an 10,000 molecular weight cutoff with Milli-Q water by centrifuging at 4,000 × g for approximately 10–20 minutes.</li>
+<li>Wash a Amicon ultra-15mL centrifugal filter units with an 10,000 molecular weight cutoff with MilliQ water by centrifuging at 4,000 × g for approximately 10–20 minutes.</li>
 <li>Add the dxCas9-Tn5 sample to the filter and centrifuged at 4,000 × g for approximately 10–20 minutes.</li>
 <li>Measure the dxCas9-Tn5 protein concentration with the <a href="#BCAproteinquantification-scroll" class="adpbl">Pierce BCA protein assay kit</a> by Thermo Scientific.</li>
@@ Line 1,600: / Line 1,717: @@
 </div>
-  <!-- -----------------------RESTRICTION --------------------------->
- <button class="collapsible cadpbl"><a id="restriction-scroll" class="repositioner"></a>Restriction</button>
+<!-- -----------------------QUBIT --------------------------->
+  <button class="collapsible cadpbl"><a id="qubit-scroll" class="repositioner"></a>Qubit High Sensitivity dsDNA quantification</button>
+<div class="content">
+<p>This protocol is based on the manual for the <a href="https://www.thermofisher.com/order/catalog/product/Q32854" class="adpbl" target="_blank"> Qubit dsDNA High Sensitivity Assay Kit</a> provided by Thermofischer Scientific.
+<ol>
+<li>Set up the required amount of tubes for your samples and add two for the calibration standards. </li>
+<li>Label the lids. Do not label the sides of the tubes, since this will interfere with the measurements. </li>
+<li>Prepare the Qubit working solution. <br>
+n = amount of sample + two standards</li>
+<li>Dilute n µL of dsDNA HS Reagent 1:200 in n * 199µL dsDNA HS Buffer. Use a clean plastic tube each time you prepare a working solution. Do not use glass containers. </li>
+<li>Add 190µL of the working solution to the tubes for the two standards.</li>
+<li>Add 10µL of the standards to the according tubes.Mix by vortexing 2-3 seconds and be careful not to create bubbles.</li>
+<li>Add 180-199µL of working solution to the sample tubes, dependent on the amount of sample to be measured. The amount of sample used for the measurement can range from 1 to 20µL. Dependent on this amount the added volume of working solution should be adapted, so that the final volume is always 200µL.</li>
+<li>Add each sample to the according assay tube. Mix by vortexing 2-3 seconds. </li>
+<li>Allow all tubes to incubate at room temperature for 2 minutes. </li>
+<li>Read the standards and samples following the Qubit instrument instructions.</li>
+</ol>
+</p>
+</div>
+<!-- -----------------------RESTRICTION --------------------------->
+<button class="collapsible cadpbl"><a id="restriction-scroll" class="repositioner"></a>Restriction</button>
 <div class="content">
 <p>
 <ol>
-<li>Decide on which enzyme(s) to cut with. Check <a href="https://international.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes" target="_blank" class="adpbl">online</a> what buffer the enzyme(s) work(s) in (NEB). For most of the enzymes, the SmartCut buffer 10X can be used.</li>
+<li>Decide on which restriction enzyme(s) to cut with. Check <a href="https://international.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes" target="_blank" class="adpbl">online (NEB)</a> what buffer the enzyme(s) work(s) in . For most of the restriction enzymes, the CutSmart buffer 10X can be used.</li>
 <li>Prepare a 20µL sample as follows:</li>
 <table>
@@ Line 1,613: / Line 1,751: @@
     </tr>
     <tr class="tableunevenadpbl">
-        <td>10x CutSmart buffer (NEB)</td>
+        <td>10X CutSmart buffer (NEB)</td>
         <td>2</td>
     </tr>
     <tr class="tableevenadpbl">
-        <td>Fragment (~1-2 μg)</td>
+        <td>Fragment (~1-2μg)</td>
         <td>X </td>
     </tr>
@@ Line 1,636: / Line 1,774: @@
 </li><br>
 </ol>
+</p>
 </div>
@@ Line 1,641: / Line 1,780: @@
   <button class="collapsible cadpbl"><a id="RNAcleanup-scroll" class="repositioner"></a>RNA Clean Up</button>
 <div class="content">
-<p>This protocol is based on the <a href="https://www.qiagen.com/us/shop/sample-technologies/rna/rna-clean-up/rneasy-minelute-cleanup-kit/#orderinginformation" target="_blank" class="adpbl">QIAGEN RNeasy MinElute Cleanup Kit</a> suited for volume <100µl.<br>
+<p>This protocol is based on the <a href="https://www.qiagen.com/us/shop/sample-technologies/rna/rna-clean-up/rneasy-minelute-cleanup-kit/#orderinginformation" target="_blank" class="adpbl">QIAGEN RNeasy MinElute Cleanup Kit</a> suited for volumes smaller than 100µL.<br>
 <ol>
-<li>Adjust the the transcripts volume to 100µl with RNase-free water.</li>
+<li>Adjust the transcripts volume to 100µl with RNase-free water.</li>
-<li>Add 350µl Buffer RLT and mix.</li>
+<li>Add 350µL Buffer RLT and mix.</li>
-<li>Add 250µl of absolute ethanol.</li>
+<li>Add 250µL of absolute ethanol.</li>
-<li>Transfer the sample to RNeasy MinElute spin column placed in a 2 ml collection tube. Close the lid and centrifuge for 15 seconds at minimum speed 8000x g.</li>
+<li>Transfer the sample to an RNeasy MinElute spin column placed in a 2mL collection tube. Close the lid and centrifuge for 15 seconds at minimum speed 8000x g.</li>
-<li>Discard the flow-through and place the spin column in a new 2 ml collection tube.</li>
+<li>Discard the flow-through and place the spin column in a new 2mL collection tube.</li>
-<li>Add 500µl Buffer RPE to the spin column. Close the lid and centrifuge for 15 seconds at minimum speed 8000x g.</li>
+<li>Add 500µL Buffer RPE to the spin column. Close the lid and centrifuge for 15 seconds at minimum speed 8000x g.</li>
-<li>Discard the flow-through and place back the spin column to the same 2ml collection tube.</li>
+<li>Discard the flow-through and place the spin column back to the same 2mL collection tube.</li>
-<li>Add 500µl 80% ethanol to the spin column. Close the lid and centrifuge for 2 minutes at minimum speed 8000x g.</li>
+<li>Add 500µL 80% ethanol to the spin column. Close the lid and centrifuge for 2 minutes at minimum speed 8000x g.</li>
-<li>Discard the flow-through and place the spin column in a new 2 ml collection tube. </li>
+<li>Discard the flow-through and place the spin column in a new 2mL collection tube. </li>
 <li>Open the lid and centrifuge at full speed for 5 minutes. Discard the flow through and the collection tube.</li>
-<li>Place spin column in a new 1.5ml collection tube. Add 14µl RNase-free water to the center of the spin column.</li>
+<li>Place the spin column in a new 1.5mL collection tube. Add 14µL RNase-free water to the center of the spin column.</li>
 <li>Close the lid and centrifuge for 1 minute at full speed to elute the RNA.</li>
-<li>Store the purified RNA at -20°C?</li>
+<li>Store the purified RNA at -20 °C</li>
 </ol>
 </p>
@@ Line 1,665: / Line 1,804: @@
 <p>
 <ol>
-<li>Add 1:1 volume ratio of a <a href="#RNAcleanup-scroll" class="adpbl">purified RNA</a> sample to 2x RNA loading buffer.</li>
+<li>Add 1:1 volume ratio of a <a href="#RNAcleanup-scroll" class="adpbl">purified RNA</a> sample to 2X RNA loading buffer.</li>
-<li>Boil at 90°C for 5 minutes to denature potential secondary structures and temporarily inactivate RNAse.</li>
+<li>Boil at 90 °C for 5 minutes to denature potential secondary structures and temporarily inactivate RNAse.</li>
 <li>Directly put on ice for ~2 minutes.</li>
-<li>Spin down and electrophorese on a 2% agarose gel (in TBE buffer) for visualisation through  gel documentation system at UV light.</li>
+<li>Spin down and electrophorese on a 2% agarose gel (in TBE buffer) for visualization with the gel documentation system using UV light.</li>
 </ol>
 </p>
@@ Line 1,728: / Line 1,867: @@
     </tr>
 </table>
-<em>NOTE: Polymerization will start when 10% APS and TEMED is added. </em></li>
+<em>NOTE: Polymerization will start when 10% APS and TEMED are added. </em></li>
 <li>Assemble the casting station and pour the separation gel between the glass plates leaving enough space for the stacking gel. </li>
-<li>Add 75% Ethanol on top of the solidifying stacking gel. </li>
+<li>Add 75% ethanol on top of the solidifying stacking gel. </li>
 <li>When the gel is solidified, remove the ethanol and pour the stacking gel on top of the separation gel and immediately place the gel comb on top of it.</li>
 <li>Allow the stacking gel to solidify, then remove the plates from the casting station. </li>
 <li>The gels are ready for usage, or can be stored at 4 °C in liquid for later usage.</li>
 <h4 class="adpbl">Preparing samples</h4>
-<li>Add 5 μL protein Loading Dye to 20 μL of protein sample.
+<li>Add 5μL protein Loading Dye to 20μL of protein sample.
-<li>Incubate the samples for 10 minutes at 90°C.
+<li>Incubate the samples for 10 minutes at 90 °C.
 <h4 class="adpbl">Running SDS-PAGE gel</h4>
@@ Line 1,749: / Line 1,888: @@
 <li>Allow the gel to shake on a moving platform for 2 minutes.</li>
 <li>Discard the water.</li>
-<li>Add clean Milli-Q water and repeat step 15-17 two times.</li>
+<li>Add clean MilliQ water and repeat step 15-17 two times.</li>
 <li>Cover the gel with a layer of SimplyBlue SafeStain.</li>
 <li>Let the gel stain on a moving plate for approximately 20 minutes.</li>
 <li>Discard the SimplyBlue SafeStain in the waste container.</li>
-<li>Cover the gel with Milli-Q water and allow the gel to shake on a moving platform until the gel is destained.<br>
+<li>Cover the gel with MilliQ water and allow the gel to shake on a moving platform until the gel is destained.<br>
 <em>NOTE: the water can be replaced frequently to remove all the stain. </em></li>
 <li>Take a picture with the Gel doc system. </li>
@@ Line 1,773: / Line 1,912: @@
 <h4 class="adpbl">Library preparation rapid sequencing (lambda DNA)</h4>
 <li>Thaw the components of the kit for Rapid Sequencing on ice and keep on ice. </li>
-<li>Add 2.5 µL of DNA to 7.5 µL of FRA (fragmentation mix).</li>
+<li>Add 2.5µL of DNA to 7.5µL of FRA (fragmentation mix).</li>
 <li>Mix the content well by inversion and spin down.</li>
 <li>Incubate tube at 30 ºC for 1 minute and then at 80 ºC for another minute.</li>
-<li>After incubation, add 1 µL of RAP (Rapid Adapter) to the tube and incubate for 5 minutes at room temperature.</li>
+<li>After incubation, add 1µL of RAP (Rapid Adapter) to the tube and incubate for 5 minutes at room temperature.</li>
 <h4 class="adpbl">Priming of Flow Cell</h4>
-<li>Turn the lid of the Flow Cell clockwise in order to make visible the priming port.</li>
+<li>Turn the lid of the Flow Cell clockwise in order to make the priming port visible.</li>
 <li>Remove bubbles from the priming port (not by directly pipetting but by changing pipette volume).</li>
-<li>Pipette 30 µL of Flush Tether into a tube of Flush Buffer and mix well by pipetting (priming mix).</li>
+<li>Pipette 30µL of Flush Tether into a tube of Flush Buffer and mix well by pipetting (priming mix).</li>
-<li>Add 800 µL of this priming mix to the priming port.</li>
+<li>Add 800µL of this priming mix to the priming port.</li>
 <h4 class="adpbl">Loading the SpotON Flow Cell</h4>
@@ Line 1,810: / Line 1,949: @@
 </li>
 <li>Open the SpotON port making the sample port available.</li>
-<li>Add 200 µL of priming mix.</li>
+<li>Add 200µL of priming mix.</li>
-<li>Add 75 µL of sample in the sample port in a dropwise fashion, allowing every drop to enter the port before adding another drop.</li>
+<li>Add 75µL of sample in the sample port in a dropwise fashion, allowing every drop to enter the port before adding another drop.</li>
-<li>Close the priming port and replace the minION lid.</li>
+<li>Close the priming port and replace the MinION lid.</li>
 <h4 class="adpbl">Sequencing run and base calling</h4>
@@ Line 1,830: / Line 1,969: @@
   <button class="collapsible cadpbl"><a id="sequenceverification-scroll" class="repositioner"></a>Sequence Verification</button>
 <div class="content">
-<p>For sequence verification, we made use of the sequencing platform <a href="https://dna.macrogen.com/eng/support/ces/ezseq_intro.jsp" target="_blank" class="adpbl">EZ-Seq</a> established by Macrogen. This protocol is based on their instructions.
+<p>For sequence verification, the sequencing platform <a href="https://dna.macrogen.com/eng/support/ces/ezseq_intro.jsp" target="_blank" class="adpbl">EZ-Seq</a> established by Macrogen was used. This protocol is based on their instructions.
 <ol>
 <li>Prepare a sequencing sample in a 1.5 mL microcentrifuge tube, labelled with a Macrogen sequencing sticker (QR-code) as follows:<br>
@@ Line 1,852: / Line 1,991: @@
 </table><br>
 <em>* NOTE: The volume depends on the concentration of the sample.</em></li>
-<li>Make sure to keep the code of the QR-code and note down what sample is affiliated with it. Deliver the tubes for sequencing to the manufacturer and await results.</li>
+<li>Make sure to keep the QR-code and note down what sample it is affiliated with. Deliver the tubes for sequencing to the manufacturer and await results.</li>
 <li>Results are evaluated <em>in silico</em> by aligning expected sequences with obtained sequences and calculating the match percentage.</li>
 </ol>
 </p>
 </div>
+<!-- -----------------------SEQUENCING VERIFICATION --------------------------->
+ <button class="collapsible cadpbl"><a id="serumextraction-scroll" class="repositioner"></a>Serum DNA Extraction</button>
+<div class="content">
+<p>This protocol is an adaptation of the original <a href="https://www.qiagen.com/us/shop/sample-technologies/dna/genomic-dna/qiaamp-dna-blood-mini-kit/#orderinginformation" target="_blank" class="adpbl">QIAGEN QIAamp DNA Blood Mini Kit protocol</a>.<br>
+Important points before starting</p>
+<ul class="uladpbl">
+<li>All centrifugation steps are carried out at room temperature (15–25°C).</li>
+<li>Use carrier DNA if the sample contains <10,000 genome equivalents (see page 17).</li>
+<li>200 μl of whole blood yields 3–12 μg of DNA. Preparation of buffy coat (see page 18) is recommended if a higher yield is required.</li>
+</ul>
+<p>Things to do before starting</p>
+<ul class="uladpbl">
+<li>Equilibrate samples to room temperature (15–25°C).</li>
+<li>Heat a water bath or heating block to 56°C for use in step 4.</li>
+<li>Equilibrate Buffer AE or distilled water to room temperature for elution in step 11.</li>
+<li>Ensure that Buffer AW1, Buffer AW2, and QIAGEN Protease have been prepared according to the instructions on page 16.</li>
+<li>If a precipitate has formed in Buffer AL, dissolve by incubating at 56°C.</li>
+</ul>
+<br>
+<p>Serum DNA Extraction Procedure</p>
+<ol>
+<li>Pipet 10 μl QIAGEN Protease (or proteinase K) into the bottom of two 1.5 ml microcentrifuge tubes.</li>
+<li>Add 500 μl sample (plasma or serum) to the microcentrifuge tubes. <br>
+<em>NOTE: It is possible to add QIAGEN Protease (or proteinase K) to samples that have already been dispensed into microcentrifuge tubes. In this case, it is important to ensure proper mixing after adding the enzyme.</em></li>
+<li>Add 500 μl Buffer AL to the sample (the same amount as the sample). Mix by pulse-vortexing for 15 s. It is a quite syrupy consistency. To ensure efficient lysis, it is essential that the sample and Buffer AL are mixed thoroughly to yield a homogeneous solution.<br>
+<em>NOTE: Do not add QIAGEN Protease or proteinase K directly to Buffer AL.</em></li>
+<li>Incubate at 56°C for 10 min. DNA yield reaches a maximum after lysis for 10 min at 56°C. Longer incubation times have no effect on yield or quality of the purified DNA.</li>
+<li>Briefly centrifuge the 1.5 ml microcentrifuge tube to remove drops from the inside of the lid.</li>
+<li>Add 500 μl ethanol (96–100%) to the sample (the same amount as the sample). Pipet it into the tube via the side of tube. This will let the foam of the centrifugation go away. The ethanol will let the proteins precipitate. Mix again by pulse-vortexing.</li>
+<li>Carefully apply 600 μl of the mixture from step 6 to the QIAamp Mini spin column (in a 2 ml collection tube) without wetting the rim (pipet via the side at the top of the tube). Close the cap, and centrifuge at 6000 x g (8000 rpm) for 1 min. Discard the filtrate en place the QIAamp Mini spin column in the same 2 ml collection tube. Repeat this 5 times untill the 3mL of the mixture is used (split over 2 1.5 ml microcentrifugation tubes). After the last time centrifugation place the QIAamp Mini spin column in a clean 2 ml collection tube (provided), and discard the tube containing the filtrate. <br>
+Close each spin column to avoid aerosol formation during centrifugation. Centrifugation is performed at 6000 x g (8000 rpm) to reduce noise. Centrifugation at full speed will not affect the yield or purity of the DNA. If the lysate has not completely passed through the column after centrifugation, centrifuge again at higher speed until the QIAamp Mini spin column is empty. Note: When preparing DNA from buffy coat or lymphocytes, centrifugation at full speed is recommended to avoid clogging.</li>
+<li>Carefully open the QIAamp Mini spin column and add 500 μl Buffer AW1 without wetting the rim. Close the cap and centrifuge at 6000 x g (8000 rpm) for 1 min. Place the QIAamp Mini spin column in a clean 2 ml collection tube (provided), and discard the collection tube containing the filtrate.*<br>
+<em>NOTE: It is not necessary to increase the volume of Buffer AW1 if the original sample volume is larger than 200 μl. <br>
+*NOTE: Flow-through contains Buffer AL or Buffer AW1 and is therefore not compatible with bleach. See page 6 for safety information.</em></li>
+<li>Carefully open the QIAamp Mini spin column and add 500 μl Buffer AW2 without wetting the rim. Close the cap and centrifuge at full speed (20,000 x g; 14,000 rpm) for 3 min.</li>
+<li>Place the QIAamp Mini spin column in a new 1.5 ml microcentrifuge tube (not provided) and discard the old collection tube with the filtrate. Centrifuge at full speed for 1 min.<br>
+This step helps to eliminate the chance of possible Buffer AW2 carryover.</li>
+<li>Place the QIAamp Mini spin column in a clean 1.5 ml microcentrifuge tube (not provided), and discard the collection tube containing the filtrate. Carefully open the QIAamp Mini spin column and add 60 μl Buffer AE or distilled (MilliQ) water. Incubate at room temperature (15–25°C) for 5 min, and then centrifuge at 6000 x g (8000 rpm) for 1 min.
+Take the eluate from the eppendorf tube and put it again on top of the filter. Centrifuge a second time at 14.000 rpm for 1 min. </li>
+</ol>
+</div>
+<!-- -----------------------sgRNA TRANSCRIPTION --------------------------->
+<button class="collapsible cadpbl" ><a id="gRNAtranscription-scroll" class="repositioner"></a>sgRNA Transcription</button>
+<div class="content">
+<p>This protocol is based on the <a href="https://international.neb.com/products/m0251-t7-rna-polymerase#Product%20Information" target="_blank" class="adpbl">standard RNA synthesis of the New England Biolabs T7 RNA Polymerase.</a><br>
+<ol>
+<li>The following components should be assembled at room temperature in the following order:<br>
+<table>
+   <tr>
+      <th class="tableheaderadpbl">Component</th>
+      <th class="tableheaderadpbl">Volume (µL)</th>
+   </tr>
+   <tr class="tableunevenadpbl">
+       <td>10x Reaction Buffer</td>
+       <td>2</td>
+   </tr>
+   <tr class="tableevenadpbl">
+       <td>NTP (each 25mM)</td>
+       <td>4</td>
+   </tr>
+   <tr class="tableunevenadpbl">
+        <td>Template DNA</td>
+        <td>X (0.2 - 1 µg)</td>
+   </tr>
+   <tr class="tableevenadpbl">
+        <td>RNase Inhibitor</td>
+        <td>1 U/µL (final)</td>
+   </tr>
+   <tr class="tableunevenadpbl">
+        <td>DTT</td>
+        <td>5 mM (final)</td>
+   </tr>
+   <tr class="tableevenadpbl">
+        <td>T7 RNA Polymerase</td>
+        <td>2</td>
+   </tr>
+   <tr class="tableunevenadpbl">
+        <td>MilliQ</td>
+        <td>add up to 20 µL</td>
+   </tr>
+</table>
+</li>
+<li>The reaction is incubated at 37<sup>o</sup>C for 4-16 hours.</li>
+<li>The following sequence is used as the template DNA, in which “n” can be substituted to match the target DNA.<br>
+<p class="DNAstyle">
+TAATACGACTCACTATAGGnnnnnnnnnnnnnnnnnnnGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT</p>
+<li>Clean up sgRNA product(s) according to the <a href="#RNAcleanup-scroll" class="adpbl">RNA Clean Up </a>protocol.</li>
+</ol>
+</p>
+</div>
@@ Line 1,864: / Line 2,102: @@
 <p>
 <ol>
-<li>Dissolve the LB-agar powder in sterile Milli-Q as directed by the manufacturer’s protocol.</li>
+<li>Dissolve the LB-agar powder in sterile MilliQ as directed by the manufacturer’s protocol.</li>
-<li>Autoclave the LB-agar solution (121°C).</li>
+<li>Autoclave the LB-agar solution (121 °C).</li>
 <li>Cool the agar down to hand-warm temperature.</li>
-<li>Supplements the medium with any relevant antibiotics and/or inducers etc.<br>
+<li>Supplement the medium with any relevant antibiotics and/or inducers etc.<br>
 <em>NOTE: With our antibiotic stock solutions of 1000x we used 1 µL of antibiotic solution per mL of LB-agar.</em></li>
 <li>Under aseptic conditions, pour the medium in empty Petri dishes.</li>
 <li>Close the Petri dishes and let the agar solidify at room temperature.</li>
-<li>Store the Petri dishes upside down at 4°C.<br>
+<li>Store the Petri dishes upside down at 4 °C.<br>
 <em>NOTE: When complimenting medium with X-gal, be sure to store the plates protected from light.</em></li>
 </ol>
@@ Line 1,879: / Line 2,117: @@
-<!-- -----------------------Tn5 or Tn5-dxCas9 fusion protein Functionality testing: Mobility shift --------------------------->
+<!-- -----------------------Tn5 or dxCas9-Tn5 fusion protein Functionality testing: Mobility shift --------------------------->
-  <button class="collapsible cadpbl"><a id="tn5fusionmobilityassay-scroll" class="repositioner"></a>Tn5 or Tn5-dxCas9 fusion protein Functionality testing: mobility shift</button>
+  <button class="collapsible cadpbl"><a id="tn5fusionmobilityassay-scroll" class="repositioner"></a>Tn5 or dxCas9-Tn5 Fusion Protein Functionality Testing: Mobility Shift</button>
 <div class="content">
 <ol>
 <p>
-This protocol describes how to evaluate the mobility shift of the Tn5:adapter DNA complex or the Tn5-dxCas9:adapter DNA complex.
+This protocol describes how to evaluate the mobility shift of the Tn5:adapter DNA complex or the dxCas9-Tn5:adapter DNA complex.
 </p>
 <h4 class="adpbl">Adapter DNA Sequence</h4>
@@ Line 1,890: / Line 2,128: @@
 <li>Add 25µl of each primer (from 100µM stock)</li>
 <li>Add 50µl of MilliQ water</li>
-<li>Place tube in 90-95°C heating block and leave for 3-5 minutes to denature any secondary structure</li>
+<li>Place tube in 90-95 °C heating block and leave for 3-5 minutes to denature any secondary structure</li>
 <li>Remove the heating block from the heat source allowing for slow cooling to room temperature (~45 minutes)</li>
 <p class="adpbl">
@@ Line 1,911: / Line 2,149: @@
 </table>
-<h4 class="adpbl">Tn5:adapter DNA or Tn5-dxCas9:adapter DNA complex (transposome) formation</h4>
+<h4 class="adpbl">Tn5:adapter DNA or dxCas9-Tn5:adapter DNA complex (transposome) formation</h4>
 <p>
 <ol>
-<li>Load the purified Tn5 or Tn5-dxCas9 protein with adapter DNA shown above. Note that all samples and reagents are kept on ice during preparation. </li>
+<li>Load the purified Tn5 or dxCas9-Tn5 protein with adapter DNA shown above. Note that all samples and reagents are kept on ice during preparation. </li>
 <li>Calculate all the volumes of the reagents required:
-<ul class="ourlist">
+<ul class="uladpbl">
-<li>1-6µM Tn5 or Tn5-dxCas9</li>
+<li>1-6µM Tn5 or dxCas9-Tn5</li>
 <li>2.5µM adapter</li>
 <li>Functionality buffer</li>
-<ul>
+<ul class="uladpbl">
-<li>Tn5-dxCas9 buffer: 20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol, 10mM MgCl2 pH 7.5</li>
+<li>dxCas9-Tn5 buffer: 20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol, 10mM MgCl<sub>2</sub> pH 7.5</li>
-<li>Tn5 buffer: 25 mM Tris-HCl, 500 mM NaCl, 1 mM DTT, 0.1mM EDTA, pH 7.5</li>
+<li>Tn5 buffer: 25mM Tris-HCl, 500mM NaCl, 1mM DTT, 0.1mM EDTA, pH 7.5</li>
-</ul>
+<li>Water to bring the final volume to 10µl</li>
-<li>Water to bring the final volume to 10uL</li>
 </ul>
 <li>Pipette the reagents in the following order: Water, 10x functionality buffer, Tn5 or Tn5-dxCas9 and adapter </li>
-<li>Incubate at 37°C for 1 hour. <br>
+<li>Incubate at 23 °C for 1 hour. <br>
 <em>NOTE: The total reaction volume can be adjusted as long as molar ratios of the reagents are kept constant.</em></li>
 <li>Analyse the samples on a 8% native TBE polyacrylamide gel to observe the mobility shift</li>
@@ Line 1,935: / Line 2,172: @@
-<!-- -----------------------Tn5 or Tn5-dxCas9 Fusion Protein Functionality Testing: Integration--------------------------->
+<!-- -----------------------Tn5 or dxCas9-Tn5 Fusion Protein Functionality Testing: Integration--------------------------->
-  <button class="collapsible cadpbl"><a id="tn5fusionintegrationassay-scroll" class="repositioner"></a>Tn5 or Tn5-dxCas9 Fusion Protein Functionality Testing: Integration</button>
+  <button class="collapsible cadpbl"><a id="tn5fusionintegrationassay-scroll" class="repositioner"></a>Tn5 or dxCas9-Tn5 Fusion Protein Functionality Testing: Integration</button>
 <div class="content">
-<p>
 <ol>
+<p>
+This protocol describes how to evaluate the integration of adapter DNA by Tn5 or the dxCas9-Tn5 fusion protein.
+</p>
 <h4 class="adpbl">Adapter DNA Sequence</h4>
 To create 25µM adapter DNA molecule. Two primers shown on table 1 were annealed to each other as follow:
 <li>Add 25µl of each primer (from 100µM stock)</li>
 <li>Add 50µl of MilliQ water</li>
-<li>Place tube in 90-95°C heating block and leave for 3-5 minutes to denature any secondary structure</li>
+<li>Place tube in 90-95 °C heating block and leave for 3-5 minutes to denature any secondary structure</li>
 <li>Remove the heating block from the heat source allowing for slow cooling to room temperature (~45 minutes)</li>
 <p>
@@ Line 1,967: / Line 2,206: @@
 </table>
-<h4 class="adpbl">Tn5:adapter DNA or Tn5-dxCas9:adapter DNA complex (transposome) formation</h4>
+<h4 class="adpbl">Tn5:adapter DNA or dxCas9-Tn5:adapter DNA complex (transposome) formation</h4>
 <p>
 <ol>
-<li>Load the purified Tn5 or Tn5-dxCas9 protein with adapter DNA shown above. Note that all samples and reagents are kept on ice during preparation. </li>
+<li>Load the purified Tn5 or dxCas9-Tn5 protein with adapter DNA shown above. Note that all samples and reagents are kept on ice during preparation. </li>
 <li>Calculate all the volumes of the reagents required:
-<ul class="ourlist">
+<ul class="uladpbl">
 <li>2.5µM Tn5 or Tn5-dxCas9</li>
 <li>2.5µM adapter</li>
-<li>Functionality buffer (20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol, 0.1mM EDTA pH 7.5)</li>
+<li>Functionality buffer (20mM Tris-HCl, 100mM KCl, 5% v/v glycerol, 1mM beta-mercaptoethanol, 0.1mM EDTA pH 7.5)</li>
-<li>Water to bring the final volume to 10uL</li>
+<li>Water to bring the final volume to 10µl</li>
 </ul>
-<li>Pipette the reagents in the following order: Water, 10x functionality buffer, Tn5 or Tn5-dxCas9 and adapter. </li>
+<li>Pipette the reagents in the following order: Water, 10X functionality buffer, Tn5 or dxCas9-Tn5 and adapter. </li>
-<li>Incubate at 37°C for 1 hour. <br>
+<li>Incubate at 23 °C for 1 hour. <br>
 <em>NOTE: The total reaction volume can be adjusted as long as molar ratios of the reagents are kept constant.</em></li>
 <h4 class="adpbl">gRNA:Transposome complex formation (only for fusion protein)</h4>
-<li>Load Tn5-dxCas9:adapter complex with gRNA provided by Arbor Biotechnologies. <br>
+<li>Load dxCas9-Tn5:adapter complex with gRNA provided by Arbor Biotechnologies. <br>
 <em>NOTE: all samples and reagents are kept on ice during preparation. </em></li>
 <li>Add the following reagents to 10µl transposome</li>
-<ul class="ourlist">
+<ul class="uladpbl">
 <li>2µl sgRNA (100ng/µl stock solution) to make 1:1 sgRNA:transposome molar ratio</li>
 <li>0.5µl buffer (add concentration)</li>
 </ul>
-<li>Incubate at 37°C for 10 minutes. </li>
+<li>Incubate at 37 °C for 10 minutes. </li>
 <h4 class="adpbl">Target DNA integration</h4>
 <li>Add 50ng target DNA, in our case EPO cDNA to 12.5µl of gRNA:Transposome complex.</li>
-<li>Incubate at 37°C for 1 hour. </li>
+<li>Incubate at 37 °C for 1 hour. </li>
 <h4 class="adpbl">Amplification of integration products by PCR</h4>
@@ Line 2,033: / Line 2,272: @@
 <figure>
-<img src="LINK" width="100%" height="auto" alt="functionality assay">
+<img src="https://static.igem.org/mediawiki/2018/6/61/T--TUDelft--2018_Figure10_PrimerDesign_Tn5.png" width="100%" height="auto" alt="functionality assay">
 <figcapture class="adpbl">Figure 1. Depiction of the binding location of the primer sets 1 (left) and 2 (right) for functionality assay PCR.</figcapture>
 </figure>
 <div class="spcmkr nowbg"></div>
+<li>The PCR reaction composition is shown in Table 3.</li>
+<p class="adpbl">
+Table 3. Pipetting scheme for PCR of integration products.
 </p>
+<table>
+   <tr >
+      <th class="tableheaderadpbl">Component</th>
+      <th class="tableheaderadpbl">Volume (µL)</th>
+   </tr>
+   <tr class="tableunevenadpbl">
+       <td>5X GoTaq buffer</td>
+       <td>4</td>
+   </tr>
+   <tr class="tableevenadpbl">
+       <td>MgCl<sub>2</sub> (25µM)</td>
+       <td>2</td>
+   </tr>
+   <tr class="tableunevenadpbl">
+       <td>10 mM dNTPs</td>
+       <td>0.4</td>
+   </tr>
+   <tr class="tableevenadpbl">
+        <td>Primer forward (10µM)</td>
+        <td>0.4</td>
+   </tr>
+   <tr class="tableunevenadpbl">
+        <td>Primer reverse (10µM)</td>
+        <td>0.4</td>
+   </tr>
+   <tr class="tableevenadpbl">
+        <td>GoTaq polymerase</td>
+        <td>0.1</td>
+   </tr>
+   <tr class="tableunevenadpbl">
+         <td>DNA template</td>
+         <td>2.5</td>
+   </tr>
+   <tr class="tableevenadpbl">
+         <td>MilliQ</td>
+         <td>up to 20µL</td>
+   </tr>
+</table>
+<li>Close all tubes thoroughly and place them in a thermocycler with the following protocol:
+<br>
+ <table>
+   <tr>
+      <th class="tableheaderadpbl">Step</th>
+      <th class="tableheaderadpbl">Time (s)</th>
+      <th class="tableheaderadpbl">Temperature (°C)</th>
+   </tr>
+   <tr class="tableunevenadpbl">
+       <td>Initial denaturation</td>
+       <td>150</td>
+       <td>98</td>
+   </tr>
+   <tr class="tableevenadpbl">
+       <td>Denaturation</td>
+       <td>60</td>
+       <td>94</td>
+   </tr>
+   <tr class="tableunevenadpbl">
+        <td>Annealing</td>
+        <td>60</td>
+       <td>60</td>
+   </tr>
+   <tr class="tableevenadpbl">
+        <td>Extension</td>
+        <td>60</td>
+        <td>72</td>
+   </tr>
+   <tr class="tableunevenadpbl">
+        <td>Final extension</td>
+        <td>480</td>
+       <td>72</td>
+   </tr>
+   <tr class="tableevenadpbl">
+        <td>Hold</td>
+        <td>∞</td>
+       <td>20</td>
+   </tr>
+</table>
+<li>The PCR product are  analysed on 5% native TBE polyacrylamide gel. The resulting gel is either stained with ethidium bromide and imaged with GelDoc system, or directly imaged with Typhoon Imaging System. In order to see the position of the protein in the gel the gel can be stained with silver quest staining.</li>
+</ol>
 </div>

Difference between revisions of "Team:TUDelft/Wetlab/Protocols"

Latest revision as of 02:20, 18 October 2018

Day 1

Day 2

Day 3

References:

Salt Stability

ssDNAp Induced Stability

ssDNAp and dsDNA Target Induced Stability

gRNA:dxCas9(-Tn5) complex formation

gRNA:dxCas9(-Tn5):Target DNA complex formation

gRNA:dxCas9(-Tn5) complex formation

Trypsin Resistance Assay

Day 1

Day 2

Day 3

Preparing the native PAGE gel

Preparing samples

Running PAGE gel

Processing PAGE gel: Ethidium bromide staining

Preparing te native PAGE gel

Preparing samples

Running PAGE gel

Processing PAGE gel: Silver staining

Cell Culture

Cell Harvest

Cell Lysis

Clarification

Nickel Affinity Chromatography

Heparin Chromatography

Dialysis

Cell Lysis

Clarification

Nickel Affinity Chromatography

Heparin Chromatography

Dialysis

Protein Concentration

Cell Lysis

Clarification

Heparin Chromatography

MonoQ Chromatography

Dialysis

Protein Concentration

Preparing of SDS-PAGE Gel

Preparing samples

Running SDS-PAGE gel

Processing SDS-PAGE gel

Flow cell QC and check

Library preparation rapid sequencing (lambda DNA)

Priming of Flow Cell

Loading the SpotON Flow Cell

Sequencing run and base calling

Close down MinKNOW and Desktop Agent

Adapter DNA Sequence

Tn5:adapter DNA or dxCas9-Tn5:adapter DNA complex (transposome) formation

Adapter DNA Sequence

Tn5:adapter DNA or dxCas9-Tn5:adapter DNA complex (transposome) formation

gRNA:Transposome complex formation (only for fusion protein)

Target DNA integration

Amplification of integration products by PCR