Difference between revisions of "Team:Kyoto/Safety"

 
(42 intermediate revisions by 4 users not shown)
Line 4: Line 4:
  
 
<style type="text/css">
 
<style type="text/css">
 +
 +
a:hover { text-decoration:underline;
 +
}
 +
        a:link {color:#007081;
 +
        }
 +
        a:visited {color:#ffbe4b;
 +
        }
 +
        a:hover {color:#25B6CA;
 +
        }
 +
        a:active {color:#FFFC7A;
 +
        }
 +
 +
 +
 +
  ul.index1 {
 +
    list-style:none;
 +
    text-align:left;
 +
    font-family: 'Segoe UI';
 +
    font-size:140%;
 +
    margin-top: 15px;
 +
    margin-left:10%;
 +
    margin-right:10%;
 +
    margin-bottom: 10px;
 +
    color: #f0f8ff;
 +
  }
 +
  ul.index1 ul{
 +
    list-style:none;
 +
   
 +
  }
 +
  li{
 +
    list-style:none;
 +
  }
 +
  .box27 {
 +
    margin-top: 0;margin-left: 0;
 +
    margin-right: 0;margin-bottom: 0;;
 +
    background: #25B6CA;
 +
    padding: 0px 5px 5px 5px;
 +
 
 +
}
 +
  .box27 .box-title {
 +
    position: relative;
 +
    display: inline-block;
 +
    top: 7px;
 +
    margin-left:10%;
 +
    padding: 0 15px ;
 +
    height: 25px;
 +
    line-height: 25px;
 +
    vertical-align: middle;
 +
    font-size: 240%;
 +
    background:  #25B6CA;
 +
    color: #ffffff;
 +
    font-weight: bold;
 +
    border-radius: 5px 5px 0 0;
 +
}
 +
  .box27 p {
 +
    margin: 0;
 +
    padding: 0;
 +
}
 +
  p.description{
 +
    text-align:center;
 +
    margin-left:0 auto;
 +
    margin-right:0 auto;}
 +
  p.description2{
 +
    text-align:center;
 +
    margin-left:47%;
 +
    margin-right:10%;
 +
  }
 +
 +
p {font-family: 'Segoe UI';
 +
  }
 +
 +
 +
h1{ margin: 15px;
 +
  }
 +
 +
h2 {
 +
background: linear-gradient(transparent 90%, #25B6CA 80%);
 +
margin-left: 10%;
 +
}
 +
 +
h5 {
 +
background: linear-gradient(transparent 90%, #25B6CA 80%);
 +
margin-left: 10%;
 +
}
 +
 +
 +
#jump{
 +
    position:fixed;
 +
    bottom:5%;
 +
    right:0;
 +
    width:9%;
 +
}
 +
#jump img{
 +
    width:70%;
 +
}
 
   ul.material {
 
   ul.material {
 
     margin-left:10%;
 
     margin-left:10%;
Line 44: Line 139:
 
     border-top:0;
 
     border-top:0;
 
     background-color:#e8f0d2;}
 
     background-color:#e8f0d2;}
#jump{
 
    position:fixed;
 
    bottom:10%;
 
    right:7%;
 
    width:9%;
 
}
 
#jump img{
 
    width:100%;
 
}
 
  
 
</style>  
 
</style>  
 
          
 
          
 
<body>
 
<body>
  <div id="jump"><a href="#wrapper"><img src="https://static.igem.org/mediawiki/2017/c/c5/Kyoto_notebook_jump.png"></a></div>
+
<div class="clear"></div>
  <div id="BACKGROUND">
+
<div id="jump">
  <div id="wrapper">
+
 
  <h1>Safety</h1>
+
<a href="#wrapper">
  <ul class="material">
+
<img src="https://static.igem.org/mediawiki/2018/1/11/T--Kyoto--upbotton.jpg"></a></div>
      <li><a href="#Safe project design">1) Safe project design</a></li>
+
<div id="BACKGROUND">
      <li><a href="#">2) Safe lab work
+
 
      <li><a href="#Safe shipment">3) Safe shipment</a></li>
+
 
      <li><a href="#Link">4) Link</a></li>
+
<div style='padding-top: 100px;'><h1 id="wrapper"><img src="https://static.igem.org/mediawiki/2018/6/6b/T--Kyoto--safty.png" width="30%"></div></h1>
        </ul>
+
 
  </ul>
+
 
 +
<div class="box27">
 +
    <span class="box-title"><font face="Segoe UI">Table of contents</font></span>
 +
    <ul class="index1">
 +
            <li><a href="#Safe project design"><font face="Segoe UI">1) Safe project design</font></a></li>
 +
            <li><a href="#Safe lab work"><font face="Segoe UI">2) Safe lab work</font></a></li>
 +
            <li><a href="#Safe shipment"><font face="Segoe UI">3) Safe shipment</font></a></li>
 +
            <li><a href="#Link"><font face="Segoe UI">4) Link</font></a></li>
 +
           
 
</ul>
 
</ul>
 +
</div>
 +
 +
 +
 
<!-- ######################################################  BLOCK Contents END #################################################-->
 
<!-- ######################################################  BLOCK Contents END #################################################-->
  
<br><br><br><br><br>
+
<br><br><br>
 
<!-----------------------------------------------------BLOCK Safe project design-------------------------------------------------------------->
 
<!-----------------------------------------------------BLOCK Safe project design-------------------------------------------------------------->
<h5 id="Safe project design">1) Safe project design</h5>
+
<h5 id="Safe project design">1)Safe project design</h5>
<h6><a href="https://2017.igem.org/Team:Kyoto/Basic_Part" target="brank">Basic Parts</a></h6>
+
<br>
<h6><a href="https://2017.igem.org/Team:Kyoto/Composite_Part" target="brank">Composite Parts</a></h6>
+
<p><font size="4">All of the species we expect to use are not harmful for human.</font></p>
 
<!-----------------------------------------------------BLOCK Safe project design END---------------------------------------------------------->
 
<!-----------------------------------------------------BLOCK Safe project design END---------------------------------------------------------->
 
+
<br><br><br>
 
<!------------------------------------------------------BLOCK Safe lab work---------------------------------------------------------->
 
<!------------------------------------------------------BLOCK Safe lab work---------------------------------------------------------->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
<h5 id = "Safe lab work">2) Safe lab work</h5>
+
<h5 id="Safe lab work">
<div class="example">
+
2)Safe lab work</h5>
<table width="20px">
+
 
<tr><th>primer name</th><th class="example" width=40%>sequence</th><th width=8%>Length</th><th width=5%>Tm</th><th width=8%>GC%</th><th width=10%>Designer</th><th>Manufacturer</th></tr><tr><td>tropomyosinF</td><td>GATCGAGAAGGACAACGCCC</td><td>20</td><td>65</td><td>60</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>IK107</td><td>cccgccgccaccatggaggcggccgcaaaatcagg</td><td>35</td><td>94</td><td>71</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr></table>
+
<br>
</div>   <!-- Table end -->
+
<p><font size="4">
 +
    Our experiments are normal molecular biology experiment and does not include special dangerous steps. We will properly follow how to use equipment such as autoclave and centrifuge, and will conduct experiments safely. We treat yeasts, bacteria etc. created by observing the safety guidelines and sterilize after the experiment is over. We will collect all laboratory effluent and culture waste liquid, completely sterilize and detoxify them by prescribed method so as not to let any E. coli and yeast that we made to the natural environment after collection out. For organic solvents, after collection, we ask for treatment at university's environmental safety center. The microorganisms we make do not have infectivity to humans, but for safety we wear gloves and safety glasses for all experiments.
 +
<br><br>
 +
    Prof.Kitabatake, Prof.Woltjen, Prof.Sota and Prof.Ohtan are responsible for all experiments and overseeing the whole process of the experiment. Before the experiment, students participate in a safety workshop held in the university and are undergoing training to conduct safe experiments. Experiments using Escherichia coli and yeast are instructed by experts who are experimenting with such a species in a daily scale.
 +
<br><br>
 +
    We will conduct all experiments safely following the safety guideline of Kyoto university. For gene recombination experiments, we observe Kyoto university safety and occupational health reference manual 2018 (<a href="https://drive.google.com/file/d/1JyKun0qIsp6O1ts2nJGPSdt23NKrSfBQ/view?usp=sharing">https://drive.google.com/file/d/1JyKun0qIsp6O1ts2nJGPSdt23NKrSfBQ/view?usp=sharing</a>) and do so.
 +
<br><br>
 +
    We are registered with the Kyoto University Recombinant DNA Committee and the University follows the guidelines of the Cartagena Protocol on Biosafety to the Convention on Biological Diversity.
 +
</font></p>
 +
   <!-- Table end -->
 
      
 
      
 
<!------------------------------------------------------BLOCK Safe lab work END---------------------------------------------------------->
 
<!------------------------------------------------------BLOCK Safe lab work END---------------------------------------------------------->
  
 +
<br><br><br>
  
 
+
<h5 id="Safe shipment">3)Safe shipment</h5>
<h5 id="Safe shipment">3) Safe shipment</h5>
+
 
+
 
<!------------------------------------------------------BLOCK Safe shipment PY------------------------------------------------------>
 
<!------------------------------------------------------BLOCK Safe shipment PY------------------------------------------------------>
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
 
<!-- Table Generated by TableMaker.py Author: OHAD -->
<h6 id = "Kit">3-1 Kit</h6>
+
<br>
<table>
+
<p><font size="4">Before submission, we have read all related pages in the iGEM web page.</font></p>
<tr><th>Name</th><th>Supplier</th></tr><tr><td>Wizard&#174; SV Gel and PCR</td><td>Promega</td></tr><tr><td>FastGene™Plasmid Mini Kit</td><td>NIPPON Genetics Co.,Ltd</td></tr>
+
 
</table>
+
 
<!-- Table end -->
 
<!-- Table end -->
 
<!------------------------------------------------------BLOCK Safe shipment.py END------------------------------------------------------>
 
<!------------------------------------------------------BLOCK Safe shipment.py END------------------------------------------------------>
 +
<br><br><br>
  
  
<h5 id="link">4) Link</h5>
+
<h5 id="Link">4)Link</h5>
 
<!------------------------------------------------------BLOCK Link PY---------------------------------------------------------------->
 
<!------------------------------------------------------BLOCK Link PY---------------------------------------------------------------->
 +
<br>
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
 
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
<h6 id = "Miniprep">4-1 Miniprep</h6>
+
<p><font size="4" color="#00252A">1.Final safety form</font></p>
<p>
+
<p><font size="4"><a href="https://2018.igem.org/Safety/Final_Safety_Form?team_id=2665"> Safety form</a></font></p>
Minipreps were performed using FastGene&#8482;Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
+
</p>
+
<!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ -->
+
 
+
<!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# -->
+
<h6 id = "Soaking">4-17 Soaking</h6>
+
<p>We followed this paper as for soaking.<br>
+
  <a href="https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf">https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf</a></p>
+
</ol>
+
 
<br>
 
<br>
 +
<p><font size="4" color="#00252A">2.Kyoto university safety and occupational health reference manual 2018</font></p>
 +
<p><a href="https://drive.google.com/file/d/1JyKun0qIsp6O1ts2nJGPSdt23NKrSfBQ/view?usp=sharing">
 +
<font size="4">https://drive.google.com/file/d/1JyKun0qIsp6O1ts2nJGPSdt23NKrSfBQ/view?usp=sharing</font></a></p>
 
<br>
 
<br>
 
<!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ -->
 
<!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ -->
  
<!------------------------------------------------------BLOCK Link.py END ----------------------------------------------------------->
+
<!------------------------------------------------------BLOCK Link.py END -----------------------------------------------------------><br><br><br>
 
       </div>
 
       </div>
 
   </div>
 
   </div>
<div style = 'padding-right: 190px; padding-left: 190px;line-height: 30px; text-indent: 50px;' >Our project is foundational and therefore we do not have a specific real-world application. For that reason, our project poses no risks in the real world. In terms of ethical risks, these are minimal to non-existent given that we do not plan to use animals or introduce anything into the environment. Since we are doing foundational research, all our experiments will be conducted in the lab with the goal of providing additional knowledge about the role of protein degradation and the speed of reactions in genetic circuits.</div>
 
<div style='padding-top: 150px;'></div>
 
</div>
 
<center>
 
<br>
 
</br>
 
<div style = 'text-indent: px; padding-right: 190px; padding-left: 190px;'> For our full safety page please click <a href="https://2017.igem.org/Safety/Final_Safety_Form">here</a>.
 
</div>
 
</center>
 
<center>
 
<div style='padding-top: 50px;'></div>
 
<img src="https://static.igem.org/mediawiki/2017/b/bc/T--William_and_Mary--Safetylab2.jpeg" style= "margin:25px;" height = "25%" width = "25%" />
 
<img src="https://static.igem.org/mediawiki/2017/3/3b/T--William_and_Mary--SafetyLab3.jpeg" height = "25%" width = "25%"/>
 
</center>
 
 
 
 
  
  

Latest revision as of 03:16, 27 November 2018




1)Safe project design

All of the species we expect to use are not harmful for human.




2)Safe lab work

Our experiments are normal molecular biology experiment and does not include special dangerous steps. We will properly follow how to use equipment such as autoclave and centrifuge, and will conduct experiments safely. We treat yeasts, bacteria etc. created by observing the safety guidelines and sterilize after the experiment is over. We will collect all laboratory effluent and culture waste liquid, completely sterilize and detoxify them by prescribed method so as not to let any E. coli and yeast that we made to the natural environment after collection out. For organic solvents, after collection, we ask for treatment at university's environmental safety center. The microorganisms we make do not have infectivity to humans, but for safety we wear gloves and safety glasses for all experiments.

Prof.Kitabatake, Prof.Woltjen, Prof.Sota and Prof.Ohtan are responsible for all experiments and overseeing the whole process of the experiment. Before the experiment, students participate in a safety workshop held in the university and are undergoing training to conduct safe experiments. Experiments using Escherichia coli and yeast are instructed by experts who are experimenting with such a species in a daily scale.

We will conduct all experiments safely following the safety guideline of Kyoto university. For gene recombination experiments, we observe Kyoto university safety and occupational health reference manual 2018 (https://drive.google.com/file/d/1JyKun0qIsp6O1ts2nJGPSdt23NKrSfBQ/view?usp=sharing) and do so.

We are registered with the Kyoto University Recombinant DNA Committee and the University follows the guidelines of the Cartagena Protocol on Biosafety to the Convention on Biological Diversity.




3)Safe shipment

Before submission, we have read all related pages in the iGEM web page.





1.Final safety form

Safety form


2.Kyoto university safety and occupational health reference manual 2018

https://drive.google.com/file/d/1JyKun0qIsp6O1ts2nJGPSdt23NKrSfBQ/view?usp=sharing