Difference between revisions of "Team:BioIQS-Barcelona/Standardization"
Marc exposit (Talk | contribs) |
Marc exposit (Talk | contribs) |
||
| (10 intermediate revisions by the same user not shown) | |||
| Line 50: | Line 50: | ||
<link rel="stylesheet" href="https://2018.igem.org/Template:BioIQS-Barcelona/css/adaptwiki?action=raw&ctype=text/css"> | <link rel="stylesheet" href="https://2018.igem.org/Template:BioIQS-Barcelona/css/adaptwiki?action=raw&ctype=text/css"> | ||
| + | <style> | ||
| + | #eliminateOverflowcommas:after{ | ||
| + | right:-15px; | ||
| + | } | ||
| + | |||
| + | /*Cut words in the downloaded sequences table*/ | ||
| + | .cutthis { | ||
| + | /* To cut the long names of the images */ | ||
| + | /* These are technically the same, but use both */ | ||
| + | overflow-wrap: break-word; | ||
| + | word-wrap: break-word; | ||
| + | |||
| + | -ms-word-break: break-all; | ||
| + | /* Instead use this non-standard one: */ | ||
| + | word-break: break-word; | ||
| + | |||
| + | /* Adds a hyphen where the word breaks, if supported (No Blink) */ | ||
| + | -ms-hyphens: auto; | ||
| + | -moz-hyphens: auto; | ||
| + | -webkit-hyphens: auto; | ||
| + | hyphens: auto; | ||
| + | |||
| + | } | ||
| + | |||
| + | |||
| + | /*For the tables*/ | ||
| + | |||
| + | table { | ||
| + | /*border: 1px solid #ccc !important;*/ | ||
| + | width: 100% !important; | ||
| + | margin:0 !important; | ||
| + | padding:0 !important; | ||
| + | border-collapse: collapse !important; | ||
| + | border-spacing: 0 !important; | ||
| + | } | ||
| + | |||
| + | table tr { | ||
| + | /*border: 1px solid #ddd !important;*/ | ||
| + | padding: 5px !important; | ||
| + | /*background: #fff;*/ | ||
| + | } | ||
| + | |||
| + | table th, table td { | ||
| + | padding: 10px !important; | ||
| + | text-align: center !important; | ||
| + | } | ||
| + | table th { | ||
| + | text-transform: uppercase !important; | ||
| + | letter-spacing: 1px !important; | ||
| + | } | ||
| + | |||
| + | |||
| + | @media screen and (max-width: 600px){ | ||
| + | |||
| + | .taulacarta table { | ||
| + | border: 0 !important; | ||
| + | } | ||
| + | |||
| + | .taulacarta table thead { | ||
| + | display: none !important; | ||
| + | } | ||
| + | |||
| + | .taulacarta table tr { | ||
| + | margin-bottom: 20px !important; | ||
| + | display: block !important; | ||
| + | border-bottom: 2px solid #ddd !important; | ||
| + | box-shadow: 2px 2px 1px #dadada !important; | ||
| + | } | ||
| + | |||
| + | .taulacarta table td { | ||
| + | display: block !important; | ||
| + | text-align: right !important; | ||
| + | font-size: 13px !important; | ||
| + | } | ||
| + | |||
| + | #taulacarta table td:last-child { | ||
| + | border-bottom: 0 !important; | ||
| + | } | ||
| + | |||
| + | .taulacarta table td::before { | ||
| + | content: attr(data-label) !important; | ||
| + | float: left !important; | ||
| + | text-transform: uppercase !important; | ||
| + | font-weight: bold !important; | ||
| + | } | ||
| + | .taulacarta tbody{ | ||
| + | line-height:0!important; | ||
| + | } | ||
| + | |||
| + | } | ||
| + | </style> | ||
<!--Added MathJax hack to make inline equations work--> | <!--Added MathJax hack to make inline equations work--> | ||
| Line 74: | Line 165: | ||
<div class="header-content"> | <div class="header-content"> | ||
<h1 class="mb-5">Dry Lab | PCR Standardization</h1> | <h1 class="mb-5">Dry Lab | PCR Standardization</h1> | ||
| − | <a href="https://2018.igem.org/Team:BioIQS-Barcelona#first-steps" class="btn btn-outline btn-xl js-scroll-trigger">Have a look!</a> | + | <a href="https://2018.igem.org/Team:BioIQS-Barcelona/Standardization#first-steps" class="btn btn-outline btn-xl js-scroll-trigger">Have a look!</a> |
</div> | </div> | ||
</div> | </div> | ||
| Line 89: | Line 180: | ||
<h2 class="section-heading orange">First steps</h2> | <h2 class="section-heading orange">First steps</h2> | ||
<div class="col-md-auto"> | <div class="col-md-auto"> | ||
| − | <h4 class="book orange block-sept comas"><i>The first step to develop our sensor is to amplify, express and effectively obtain the HLA-DQ heterodimer (chains α and β) from the patient's DNA, regardless of the CD-haplotype | + | <h4 class="book orange block-sept comas" id="eliminateOverflowcommas"><i>The first step to develop our sensor is to amplify, express and effectively obtain the HLA-DQ heterodimer (chains α and β) from the patient's DNA, regardless of the CD-haplotype of the patient (either DQ2 or DQ8).</i></h4> |
</div> | </div> | ||
</div> | </div> | ||
<div class="col-md-12 mx-auto block-sept"> | <div class="col-md-12 mx-auto block-sept"> | ||
| − | <a class="js-scroll-trigger a-arrow" href="https://2018.igem.org/Team:BioIQS-Barcelona#st-description"><span class="arrow down"></span></a> | + | <a class="js-scroll-trigger a-arrow" href="https://2018.igem.org/Team:BioIQS-Barcelona/Standardization#st-description"><span class="arrow down"></span></a> |
</div> | </div> | ||
</div> | </div> | ||
| Line 108: | Line 199: | ||
<div class="row block-sept"> | <div class="row block-sept"> | ||
<div class="col-md-12"> | <div class="col-md-12"> | ||
| − | <p class="book orange">Based on former studies, only the exons 2 and 3 from each chain codify for the extracellular domain of the HLA-DQ that interacts with the reactive gluten epitopes. With this in mind, we designed a robust model for the extraction of the α and β | + | <p class="book orange">Based on former studies, only the exons 2 and 3 from each chain codify for the extracellular domain of the HLA-DQ that interacts with the reactive gluten epitopes. With this in mind, we designed a robust model for the extraction of the α and β chains of the HLA-DQ from the genomic DNA of a celiac patient. A set of primers were designed to conduct 3 different PCR steps (in a total of 10 reactions) to obtain the α- and β-chains flanked with restriction sites for further cloning.</p> |
</div> | </div> | ||
</div> | </div> | ||
| Line 122: | Line 213: | ||
<div class="row justify-content-center block-sept"> | <div class="row justify-content-center block-sept"> | ||
<div class="col-md-8"> | <div class="col-md-8"> | ||
| − | <p class="book orange">Therefore, we designed 8 specific primers (forward and reverse) to amplify the exons 2 and 3 of each chain | + | <p class="book orange">Therefore, we designed 8 specific primers (forward and reverse) to amplify the exons 2 and 3 of each chain. The nomenclature is as follows: P1 to P4 for the α-chain and P1’ to P4’ for the β-chain.</p> |
</div> | </div> | ||
</div> | </div> | ||
| − | + | <div class="taulacarta"> | |
<table class="table book text-b"> | <table class="table book text-b"> | ||
<thead class="orange-intense"> | <thead class="orange-intense"> | ||
| Line 138: | Line 229: | ||
<tbody class="orange-medium"> | <tbody class="orange-medium"> | ||
<tr> | <tr> | ||
| − | <td>P1</td> | + | <td data-label="Primer">P1</td> |
| − | <td>A</td> | + | <td data-label="Chain">A</td> |
| − | <td>2 (5’->3’)</td> | + | <td data-label="Exon">2 (5’->3’)</td> |
| − | <td>4643-4664 bp</td> | + | <td data-label="Genomic Location*">4643-4664 bp</td> |
| − | <td>22</td> | + | <td data-label="Length (bp)**">22</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P2</td> | + | <td data-label="Primer">P2</td> |
| − | <td>A</td> | + | <td data-label="Chain">A</td> |
| − | <td>2 (3’->5’)</td> | + | <td data-label="Exon">2 (3’->5’)</td> |
| − | <td>4867-4889 bp</td> | + | <td data-label="Genomic Location*">4867-4889 bp</td> |
| − | <td>23</td> | + | <td data-label="Length (bp)**">23</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P3</td> | + | <td data-label="Primer">P3</td> |
| − | <td>A</td> | + | <td data-label="Chain">A</td> |
| − | <td>3 (5’->3’)</td> | + | <td data-label="Exon">3 (5’->3’)</td> |
| − | <td>5302-5326 bp</td> | + | <td data-label="Genomic Location*">5302-5326 bp</td> |
| − | <td>25</td> | + | <td data-label="Length (bp)**">25</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P4</td> | + | <td data-label="Primer">P4</td> |
| − | <td>A</td> | + | <td data-label="Chain">A</td> |
| − | <td>3 (3’->5’)</td> | + | <td data-label="Exon">3 (3’->5’)</td> |
| − | <td>5561-5583 bp</td> | + | <td data-label="Genomic Location*">5561-5583 bp</td> |
| − | <td>23</td> | + | <td data-label="Length (bp)**">23</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P1'</td> | + | <td data-label="Primer">P1'</td> |
| − | <td>B</td> | + | <td data-label="Chain">B</td> |
| − | <td>2 (5’->3’)</td> | + | <td data-label="Exon">2 (5’->3’)</td> |
| − | <td>2072-2097 bp</td> | + | <td data-label="Genomic Location*">2072-2097 bp</td> |
| − | <td>26</td> | + | <td data-label="Length (bp)**">26</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P2'</td> | + | <td data-label="Primer">P2'</td> |
| − | <td>B</td> | + | <td data-label="Chain">B</td> |
| − | <td>2 (3’->5’)</td> | + | <td data-label="Exon">2 (3’->5’)</td> |
| − | <td>2436-2456 bp</td> | + | <td data-label="Genomic Location*">2436-2456 bp</td> |
| − | <td>21</td> | + | <td data-label="Length (bp)**">21</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P3'</td> | + | <td data-label="Primer">P3'</td> |
| − | <td>B</td> | + | <td data-label="Chain">B</td> |
| − | <td>3 (5’->3’)</td> | + | <td data-label="Exon">3 (5’->3’)</td> |
| − | <td>5199-5226 bp</td> | + | <td data-label="Genomic Location*">5199-5226 bp</td> |
| − | <td>28</td> | + | <td data-label="Length (bp)**">28</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P4'</td> | + | <td data-label="Primer">P4'</td> |
| − | <td>B</td> | + | <td data-label="Chain">B</td> |
| − | <td>3 (3’->5’)</td> | + | <td data-label="Exon">3 (3’->5’)</td> |
| − | <td>5504-5527 bp</td> | + | <td data-label="Genomic Location*">5504-5527 bp</td> |
| − | <td>24</td> | + | <td data-label="Length (bp)**">24</td> |
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
| + | </div> | ||
<p class="book orange-medium n-p"><small>* All genomic locations are referred to the HLA DQA1*05:01:01:01 and DQB1*02:01:01, chain A and B respectively.</small></p> | <p class="book orange-medium n-p"><small>* All genomic locations are referred to the HLA DQA1*05:01:01:01 and DQB1*02:01:01, chain A and B respectively.</small></p> | ||
<p class="book orange-medium n-p"><small>** Complementary primer overhangs are not taken into account for the analysis.</small></p> | <p class="book orange-medium n-p"><small>** Complementary primer overhangs are not taken into account for the analysis.</small></p> | ||
| Line 230: | Line 322: | ||
<div class="row"> | <div class="row"> | ||
<div class="col-md-12 mx-auto"> | <div class="col-md-12 mx-auto"> | ||
| − | <p class="book orange">In order to elucidate if the designed primers are capable of amplifying every CD-associated genotype, a multiple sequence alignment (MSA) | + | <p class="book orange">In order to elucidate if the designed primers are capable of amplifying every CD-associated genotype, a multiple sequence alignment (MSA) was performed to evaluate genetic variability at primer regions.</p> |
<p class="book orange">Genomic HLA-DQ sequences <a class="link" href="https://github.com/Bioiqs-iGem/HLA-DQ" target="_blank">(DQA1_gen.fasta and DQB1_gen.fasta)</a> were downloaded from IPD-IMGT/HLA (Directory hosted at the European Bioinformatics Institute) version 3.33.0. Then, the genomic sequences were curated for DQ2 and DQ8 haplotypes.</p> | <p class="book orange">Genomic HLA-DQ sequences <a class="link" href="https://github.com/Bioiqs-iGem/HLA-DQ" target="_blank">(DQA1_gen.fasta and DQB1_gen.fasta)</a> were downloaded from IPD-IMGT/HLA (Directory hosted at the European Bioinformatics Institute) version 3.33.0. Then, the genomic sequences were curated for DQ2 and DQ8 haplotypes.</p> | ||
</div> | </div> | ||
</div> | </div> | ||
| − | + | <div class="taulacarta"> | |
<table class="table book text-b"> | <table class="table book text-b"> | ||
<tbody class="orange-medium"> | <tbody class="orange-medium"> | ||
<tr> | <tr> | ||
| − | <th class="orange-intense"></th> | + | <th class="orange-intense cutthis">Haplotype</th> |
| − | <th class="orange-intense"> | + | <th class="orange-intense cutthis">Downloaded sequences</th> |
| − | <th class="orange-intense">DQ2</th> | + | <th class="orange-intense cutthis">DQ2</th> |
| − | <th class="orange-intense">DQ8</th> | + | <th class="orange-intense cutthis">DQ8</th> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | < | + | <td data-label="Haplotype" class="orange-intense">DQA1</th> |
| − | <td>73</td> | + | <td data-label="Downloaded Sequences">73</td> |
| − | <td>14</td> | + | <td data-label="DQ2">14</td> |
| − | <td>7</td> | + | <td data-label="DQ8">7</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | < | + | <td data-label="Haplotype" class="orange-intense">DQB1</th> |
| − | <td>198</td> | + | <td data-label="Downloaded Sequences">198</td> |
| − | <td>6</td> | + | <td data-label="DQ2">6</td> |
| − | <td>13</td> | + | <td data-label="DQ8">13</td> |
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
| + | </div> | ||
<div class="row block-desc"> | <div class="row block-desc"> | ||
<div class="col-md-12 mx-auto"> | <div class="col-md-12 mx-auto"> | ||
| Line 267: | Line 360: | ||
</div> | </div> | ||
</div> | </div> | ||
| − | + | <div class="taulacarta"> | |
<table class="table book text-b"> | <table class="table book text-b"> | ||
<thead class="orange-intense"> | <thead class="orange-intense"> | ||
| Line 280: | Line 373: | ||
<tbody class="orange-medium"> | <tbody class="orange-medium"> | ||
<tr> | <tr> | ||
| − | <td>P1</td> | + | <td data-label="Primer">P1</td> |
| − | <td>2 (5’->3’)</td> | + | <td data-label="Exon">2 (5’->3’)</td> |
| − | <td>21</td> | + | <td data-label="Total seq.">21</td> |
| − | <td>GCTGACCACGTCGCCTCTTATG</td> | + | <td data-label="DQ2">GCTGACCACGTCGCCTCTTATG</td> |
| − | <td>GCTGACCATGTTGCCTCTTACG</td> | + | <td data-label="DQ8">GCTGACCATGTTGCCTCTTACG</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P2</td> | + | <td data-label="Primer">P2</td> |
| − | <td>2 (3’->5’)</td> | + | <td data-label="Exon">2 (3’->5’)</td> |
| − | <td>21</td> | + | <td data-label="Total seq.">21</td> |
| − | <td>CATTGGTAGCAGCGGTAGAGTTG</td> | + | <td data-label="DQ2">CATTGGTAGCAGCGGTAGAGTTG</td> |
| − | <td>CATTGGTAGCAGCGGTAGAGTTG</td> | + | <td data-label="DQ8">CATTGGTAGCAGCGGTAGAGTTG</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P3</td> | + | <td data-label="Primer">P3</td> |
| − | <td>3 (5’->3’)</td> | + | <td data-label="Exon">3 (5’->3’)</td> |
| − | <td>21</td> | + | <td data-label="Total seq.">21</td> |
| − | <td>AGGTTCCTGAGGTCACAGTGTTTTC</td> | + | <td data-label="DQ2">AGGTTCCTGAGGTCACAGTGTTTTC</td> |
| − | <td>AGGTTCCTGAGGTCACAGTGTTTTC</td> | + | <td data-label="DQ8">AGGTTCCTGAGGTCACAGTGTTTTC</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P4</td> | + | <td data-label="Primer">P4</td> |
| − | <td>3 (3’->5’)</td> | + | <td data-label="Exon">3 (3’->5’)</td> |
| − | <td>21</td> | + | <td data-label="Total seq.">21</td> |
| − | <td>CCCAGTGTTTCAGAAGAGGCTTG</td> | + | <td data-label="DQ2">CCCAGTGTTTCAGAAGAGGCTTG</td> |
| − | <td>CCCAGTGTTTCAGAAGAGGCTCA</td> | + | <td data-label="DQ8">CCCAGTGTTTCAGAAGAGGCTCA</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P1'</td> | + | <td data-label="Primer">P1'</td> |
| − | <td>2 (5’->3’)</td> | + | <td data-label="Exon">2 (5’->3’)</td> |
| − | <td>19</td> | + | <td data-label="Total seq.">19</td> |
| − | <td>GAGGATTTCGTGTACCAGTTTAAGGG</td> | + | <td data-label="DQ2">GAGGATTTCGTGTACCAGTTTAAGGG</td> |
| − | <td>GAGGATTTCGTGTACCAGTTTAAGGG</td> | + | <td data-label="DQ8">GAGGATTTCGTGTACCAGTTTAAGGG</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P2'</td> | + | <td data-label="Primer">P2'</td> |
| − | <td>2 (3’->5’)</td> | + | <td data-label="Exon">2 (3’->5’)</td> |
| − | <td>19</td> | + | <td data-label="Total seq.">19</td> |
| − | <td>TCCTCTGGGGTGGAACAAACG</td> | + | <td data-label="DQ2">TCCTCTGGGGTGGAACAAACG</td> |
| − | <td>TCAGCCGGGGTGGAACGAACA</td> | + | <td data-label="DQ8">TCAGCCGGGGTGGAACGAACA</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P3'</td> | + | <td data-label="Primer">P3'</td> |
| − | <td>3 (5’->3’)</td> | + | <td data-label="Exon">3 (5’->3’)</td> |
| − | <td>19</td> | + | <td data-label="Total seq.">19</td> |
| − | <td>CCTATATCTTTCCCTGTCTGTTACTGCC</td> | + | <td data-label="DQ2">CCTATATCTTTCCCTGTCTGTTACTGCC</td> |
| − | <td>CC--TATCTTTCCCTGTCTGTTACTGCC</td> | + | <td data-label="DQ8">CC--TATCTTTCCCTGTCTGTTACTGCC</td> |
</tr> | </tr> | ||
<tr> | <tr> | ||
| − | <td>P4'</td> | + | <td data-label="Primer">P4'</td> |
| − | <td>3 (3’->5’)</td> | + | <td data-label="Exon">3 (3’->5’)</td> |
| − | <td>19</td> | + | <td data-label="Total seq.">19</td> |
| − | <td>CAATATCCCCTTACGCCACTCCAC</td> | + | <td data-label="DQ2">CAATATCCCCTTACGCCACTCCAC</td> |
| − | <td>CAATATCCCCTTACGCCACTCCAC</td> | + | <td data-label="DQ8">CAATATCCCCTTACGCCACTCCAC</td> |
</tr> | </tr> | ||
</tbody> | </tbody> | ||
</table> | </table> | ||
| − | <p class="orange book">For P3’ primer, a two-base deletion is reported as <b>refSNP Cluster Report: rs756895762</b> | + | </div> |
| + | <p class="orange book">For P3’ primer, a two-base deletion is reported as <b>refSNP Cluster Report: rs756895762</b>. Therfore, this is the only primer that needs special attention, as it could compromise the capability to amplify the HLA-DQ genes by PCR of all possible celiac disease involved HLA-DQ genotypes.</p> | ||
<div class="image"> | <div class="image"> | ||
<img class="img-m" src="https://static.igem.org/mediawiki/2018/c/c2/T--BioIQS-Barcelona--2018_gtc.jpeg"> | <img class="img-m" src="https://static.igem.org/mediawiki/2018/c/c2/T--BioIQS-Barcelona--2018_gtc.jpeg"> | ||
</div> | </div> | ||
| − | <p class="orange book"> | + | <p class="orange book">This are the Hidden Markov Models that represent the sequence conservation for the region complementary to each primer. For the α chain, the dominant bases correspond to <b>DQ2</b>, while for the β chain, the dominant bases correspond to DQ8. </p> |
</div> | </div> | ||
</div> | </div> | ||
Latest revision as of 00:12, 11 December 2018
Dry Lab | PCR Standardization
Have a look!Based on former studies, only the exons 2 and 3 from each chain codify for the extracellular domain of the HLA-DQ that interacts with the reactive gluten epitopes. With this in mind, we designed a robust model for the extraction of the α and β chains of the HLA-DQ from the genomic DNA of a celiac patient. A set of primers were designed to conduct 3 different PCR steps (in a total of 10 reactions) to obtain the α- and β-chains flanked with restriction sites for further cloning.
Therefore, we designed 8 specific primers (forward and reverse) to amplify the exons 2 and 3 of each chain. The nomenclature is as follows: P1 to P4 for the α-chain and P1’ to P4’ for the β-chain.
| Primer | Chain | Exon | Genomic Location* | Length (bp)** |
|---|---|---|---|---|
| P1 | A | 2 (5’->3’) | 4643-4664 bp | 22 |
| P2 | A | 2 (3’->5’) | 4867-4889 bp | 23 |
| P3 | A | 3 (5’->3’) | 5302-5326 bp | 25 |
| P4 | A | 3 (3’->5’) | 5561-5583 bp | 23 |
| P1' | B | 2 (5’->3’) | 2072-2097 bp | 26 |
| P2' | B | 2 (3’->5’) | 2436-2456 bp | 21 |
| P3' | B | 3 (5’->3’) | 5199-5226 bp | 28 |
| P4' | B | 3 (3’->5’) | 5504-5527 bp | 24 |
* All genomic locations are referred to the HLA DQA1*05:01:01:01 and DQB1*02:01:01, chain A and B respectively.
** Complementary primer overhangs are not taken into account for the analysis.
Since we started the project focusing on expressing HLA-DQ from Roger’s DNA sample, primers were designed accordingly to his HLA-DQ haplotype, which is DQ2 (HLA DQA1*05:01:01:01 and DQB1*02:01:01). Remember that, for celiac disease, the haplotype nomenclature is as follows:
DQ2-positive
(HLA-DQA1*05:01 or *05:05 and HLA-DQB1*02:01 or *02:02)
Half DQ2-positive
(HLA-DQA1*05:01 or 05:05 or HLA-DQB1*02:01 or 02:02)
DQ8-positive
(HLA-DQA1*03 and HLA-DQB1*03:02)
In order to elucidate if the designed primers are capable of amplifying every CD-associated genotype, a multiple sequence alignment (MSA) was performed to evaluate genetic variability at primer regions.
Genomic HLA-DQ sequences (DQA1_gen.fasta and DQB1_gen.fasta) were downloaded from IPD-IMGT/HLA (Directory hosted at the European Bioinformatics Institute) version 3.33.0. Then, the genomic sequences were curated for DQ2 and DQ8 haplotypes.
| Haplotype | Downloaded sequences | DQ2 | DQ8 |
|---|---|---|---|
| DQA1 | 73 | 14 | 7 |
| DQB1 | 198 | 6 | 13 |
Genomic MSA surprisingly resulted on a perfect alignment for sequences sharing CD-DQ haplotypes. This means that, for primer regions, all DQ2-associated sequences match perfectly and the same happens on DQ8. Moreover, for P2, P3, P1’ and P4’, primer region alignment is perfect and so, there is no need to edit the standard primers.
* Hidden Markov Model of P1 genomic primer region curated for DQ2 and DQ8 genotypes. In this case, there are only 3 differing bases among primer region. Since 14 DQ2 and 6 DQ8 sequences were aligned, dominant residues are those corresponding to DQ2 genotypes. DQ2 sequences presents C-C-T and DQ8 presents T-T-C.
| Primer | Exon | Total seq. | DQ2 | DQ8 |
|---|---|---|---|---|
| P1 | 2 (5’->3’) | 21 | GCTGACCACGTCGCCTCTTATG | GCTGACCATGTTGCCTCTTACG |
| P2 | 2 (3’->5’) | 21 | CATTGGTAGCAGCGGTAGAGTTG | CATTGGTAGCAGCGGTAGAGTTG |
| P3 | 3 (5’->3’) | 21 | AGGTTCCTGAGGTCACAGTGTTTTC | AGGTTCCTGAGGTCACAGTGTTTTC |
| P4 | 3 (3’->5’) | 21 | CCCAGTGTTTCAGAAGAGGCTTG | CCCAGTGTTTCAGAAGAGGCTCA |
| P1' | 2 (5’->3’) | 19 | GAGGATTTCGTGTACCAGTTTAAGGG | GAGGATTTCGTGTACCAGTTTAAGGG |
| P2' | 2 (3’->5’) | 19 | TCCTCTGGGGTGGAACAAACG | TCAGCCGGGGTGGAACGAACA |
| P3' | 3 (5’->3’) | 19 | CCTATATCTTTCCCTGTCTGTTACTGCC | CC--TATCTTTCCCTGTCTGTTACTGCC |
| P4' | 3 (3’->5’) | 19 | CAATATCCCCTTACGCCACTCCAC | CAATATCCCCTTACGCCACTCCAC |
For P3’ primer, a two-base deletion is reported as refSNP Cluster Report: rs756895762. Therfore, this is the only primer that needs special attention, as it could compromise the capability to amplify the HLA-DQ genes by PCR of all possible celiac disease involved HLA-DQ genotypes.
This are the Hidden Markov Models that represent the sequence conservation for the region complementary to each primer. For the α chain, the dominant bases correspond to DQ2, while for the β chain, the dominant bases correspond to DQ8.