Revision as of 04:19, 4 October 2018

1 Description
- 1.1
- 1.2 Date:
- 1.3 Template
- 1.4
- 1.5 Date:
- 1.6 08/29
- 1.7 Date:
- 1.8 08/27
- 1.9 Date:
- 1.10 08/26
- 1.11 Date:
- 1.12 08/25
- 1.13 Date:
- 1.14 08/24
- 1.15 Date:
- 1.16 8/23
- 1.17 Date:
- 1.18 8/22
- 1.19 Date:
- 1.20 8/20
- 1.21 Date:
- 1.22 08/18
- 1.23 Date:
- 1.24 08/17
- 1.25 Date:
- 1.26 08/16
- 1.27 Date:
- 1.28 8/15
- 1.29 Date:
- 1.30 8/14
- 1.31 Date:
- 1.32 08/12
- 1.33 Date:
- 1.34 08/11
- 1.35 Date:
- 1.36 08/10
- 1.37 Date:
- 1.38 08/09
- 1.39 Date:
- 1.40 08/08
- 1.41 Date:
- 1.42 08/07
- 1.43 Date:
- 1.44 08/06
- 1.45 Date:
- 1.46 08/03
- 1.47 Date:
- 1.48 08/02
- 1.49
- 1.50 Date:
- 1.51 08/01
- 1.52
- 1.53 Date:
- 1.54 07/31
- 1.55
- 1.56
- 1.57 Date:
- 1.58 07/30
- 1.59
- 1.60 Date:
- 1.61 07/29
- 1.62
- 1.63 Date:
- 1.64 07/28
- 1.65
- 1.66 Date:
- 1.67 07/27
- 1.68
- 1.69 Date:
- 1.70 07/26
- 1.71
- 1.72
- 1.73 Date:
- 1.74 07/25
- 1.75
- 1.76 Date:
- 1.77 07/24
- 1.78
- 1.79 Date:
- 1.80 07/23
- 1.81
- 1.82 Date:
- 1.83 07/22
- 1.84
- 1.85 Date:
- 1.86 07/21
- 1.87
- 1.88 Date:
- 1.89 07/20
- 1.90
- 1.91 Date:
- 1.92 07/18
- 1.93
- 1.94 Date:
- 1.95 07/17
- 1.96
- 1.97 Date:
- 1.98 07/16
- 1.99
- 1.100 Date:
- 1.101 07/15
- 1.102
- 1.103 Date:
- 1.104 07/11
- 1.105
- 1.106 Date:
- 1.107 07/10
- 1.108
- 1.109 Date:
- 1.110 07/09
- 1.111
- 1.112
- 1.113 Date:
- 1.114 07/06
- 1.115
- 1.116 Date:
- 1.117 07/05
- 1.118
- 1.119 Date:
- 1.120 07/03
- 1.121
- 1.122 Date:
- 1.123 07/02
- 1.124
- 1.125 Date:
- 1.126 06/29
- 1.127
- 1.128 Date:
- 1.129 06/28
- 1.130
- 1.131 Date:
- 1.132 06/27
- 1.133
- 1.134
- 1.135 Date:
- 1.136 06/26
- 1.137
- 1.138 Date:
- 1.139 06/25
- 1.140
- 1.141 Date:
- 1.142 06/22
- 1.143
- 1.144 Date:
- 1.145 06/21
- 1.146
- 1.147 Date:
- 1.148 06/20
- 1.149
- 1.150 Date:
- 1.151 06/19
- 1.152
- 1.153 Date:
- 1.154 06/18
- 1.155
- 1.156 Date:
- 1.157 06/15
- 1.158
- 1.159 Date:
- 1.160 06/14
- 1.161
- 1.162
- 1.163 Date:
- 1.164 06/13
- 1.165
- 1.166
- 1.167 Date:06/12
- 1.168
- 1.169 Date:06/11
- 1.170
- 1.171 Date:06/10
- 1.172
- 1.173
- 1.174 Date:06/08
- 1.175
- 1.176
- 1.177 Date:06/07
- 1.178
- 1.179
- 1.180 Date:06/06
- 1.181
- 1.182
- 1.183 Date:06/05
- 1.184
- 1.185
- 1.186
- 1.187 Date:06/03
- 1.188
- 1.189
- 1.190 Date:06/02
- 1.191
- 1.192
- 1.193 Date:06/01
- 1.194
- 1.195
- 1.196 Date:05/31
- 1.197
- 1.198 Date:05/30
- 1.199
- 1.200 Date:05/29
- 1.201
- 1.202 Date:05/23
- 1.203

Description

ASDF

Date:

Template

To Do

Accomplishment

------------Ctrl+F @First_Name tag (ex.@Emily) for attributions-----------

----------------------------MOST RECENT ON TOP!---------------------------

Date:

08/29

To Do

Accomplishment

Transformed colony 6 and 8 of LsrK second plasmid
Double plasmid transformation of colony 6 of LsrK second plasmid and colony of first plasmid inside pACYC. Created a plate by spreading tetracycline and chloramphenicol on a non antibiotic plate.
Ordered primers for LuxS second plasmid and YdgG second plasmid in pGGA for golden gate assembly using NEB GG tool
Vignesh → 3hrs

Date:

08/27

To Do

Accomplishment

Mini Prepped the 9 colonies of O/N cultures of LsrK second plasmid in pGGA
Ran a single restriction enzyme digest using PstI on the plasmid
Ran a gel on the digest. The gel was successful. The bands of colony 6 & 8 were most promising with bands around the 4800-5000 mark and the actual length is ~4850
First plasmid is seemingly made, but gel quality is bad

Date:

08/26

To Do

Accomplishment

Several colonies grew of LsrK second plasmid in pGGA. I picked 9 colonies to create an overnight culture of.

Date:

08/25

To Do

Accomplishment

Transformed 4uL of LsrK second plasmid golden gate reaction

Date:

08/24

To Do

Accomplishment

Gel extracted sfgfp block gg pcr since it is in a cam backbone and pgga is also cam resistant
Ran golden gate reaction on LsrK second plasmid using pGGA plasmid

Date:

8/23

To Do

Accomplishment

There are colony growths in the 1st plasmid pACYC goldengate; will check via gel.
Primers for golden gate asssembly of LsrK second plasmid arrived. Performed golden gate pcr on sfgfp block and LsrK block

Date:

8/22

To Do

Accomplishment

Checked rest of the LsrRpLsr in PSB1C3; none had the part in it
Performed goldengate of the first plasmid in pACYC

Date:

8/20

To Do

Send W&M our BioBricks
Complete W&M Experiments and send results
Miniprep lsrACDB + Terminator

Accomplishment

Order new golden assembly primers for LsrK second plasmid in pGGA but inserted the bsaI sites in the right place. The first creation of LuxS Block_pGGA turns out not to have the insert in the right place since when i created the assembly, the primers were desinged at the beginning and end of the plasmid when in linear form. The plasmid already has bsaI sites at its insert region. This is where I inserted the LsrK Block and sfgfp block this time.
Sent Experiment 1 results to W&M
Ran gel on W&M experiment 2. All four lanes were failures.<img alt="" src="/images/LabJournal/image5.jpg" style="width: 482.00px; height: 361.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
Ran a gel on the 8 lsrACDBTT minipreps. All of them appear to be reannealed backbones.
Continued golden assembly for YdgG and LsrK plasmids

Ran golden gate pcr on YdgG sfgfp and LsrK sfgfp using neb TM Calculator: Annealed 62C for LsrK sfgfp and 66C for YdgG sfgfp

Restriction digest of LsrK_pSB1C3 and YdgG_pSB1C3 on E|P to confirm they are the right parts

The gel showed that the backbone just reanneal so this means that the ligation was unsuccessful

We received sequencing results for LuxS_pSB1C3 and a failure of “No Priming” occurred

What was thought to be LsrRpLsr inside PSB1C3 was found to be an incomplete digest of the backbone. A second gel of the digested plasmid confirmed that there is no part in it.

This explains why our recent LsrRpLsr gibson PCR have not been working; there was no template in there to start with

Date:

08/18

To Do

Miniprep colonies of YdgG_pSB1C3 & LsrK_pSB1C3
PCR amplify pSB1A3 backbone

Accomplishment

Miniprepped 8 colonies of C and 8 colonies of LsrK_pSB1C3

Date:

08/17

To Do

Accomplishment

Golden gate reaction using NEB TM Calculator for pSB1A3 YdgG & LsrK

Annealed at 71C for both (only half of the primer is annealing this time)

Grew out colonies of LsrK_pSB1C3 & YdgG_pSB1C3 for miniprep tomorrow
Ordered plasmid miniprep kit, pcr extraction kit, and gel extraction kit from Genscript
W&M Exp 1 final steps completed
Ligation of lsrACDB, B0015, and pSB1K3 begun.

Date:

08/16

To Do

Accomplishment

Gel extraction ydgg pcr
E|P digest of pSB1C3, Lsrk pcr amplify, ydgg pcr amplify

Ligated and transformed Biobrick piece (Lsrk_pSB1C3 & YdgG_pSB1C3)

Date:

8/15

To Do

Transform the successful LsrRpLsr

Accomplishment

Ran pcr amplification of LsrK and Gel confirmed pcr amplification of LsrK

Ran a gel extraction to isolate the piece

PCR amplified YdgG using new NEB temperatures after the phone call with them

Date:

8/14

To Do

Gibson PCR of LsrRplsr and T7TT were failures, so retrying with higher annealing temperature of 59 degree celsius

Accomplishment

Gel of LsrRpLsr shows correct part in tube 1: very likely it is a success. Must re-transform (because there is no restreak done) and confirm by sequencing
T7TT re-PCRed with 59 and 60C.

Date:

08/12

To Do

Accomplishment

Transformations of golden reactions were unsuccessful
Transformed ligation of LsrRplsr in PSB1C3; harvest on 8/14
Ordered primers for sequencing 1st plasmid & sfGFP_LuxS. Also ordered primers for PCRing those parts with prefix/suffixes.
Reran W&M experiment 1 for reaction C. Left in thermocycler O/N after PCR step.
PCR of pT7-sfGFP-TT with sfgfp Y forward/reverse primers
Trying the same method again:

Ran PCR of pSB1A3 (ydgg) but increased the annealing temperature to 67.5C
Ran PCR on YdgG block

Date:

08/11

To Do

Accomplishment

Ran golden gate reaction on LuxS, LsrK, YdgG Plasmids(in pSB1A3) (2:1 insert to vector ration used)
Transformed using NEB high efficiency competent cells
PCR amplified LsrR_pLsr using Part Prefix and Part Suffix primers (ordered 8/2). There were multiple wrong bands along with the correct band, so gel extracted the part, then ligated into PSB1C3. Did overnight ligation.

Date:

08/10

To Do

Gel (extraction) of W&M parts
Miniprep and glycerol stocks of pE-FLP plasmid

Accomplishment

Golden gate continued…

Ran pcr on LuxS, Lsrk, and YdgG plasmid blocks to add golden gate primers
Gel extraction from sfgfp block from pcr to isolate from dna template plasmid

Date:

08/09

To Do

Accomplishment

Gel extraction of pOSIP-KO plasmid
pE-FLP started in overnight culture @ 30˚C
W&M experiment 1 completed up to PCR step. Left overnight.
Started golden assembly on LuxS, Lsrk, and YdgG plasmid in pSB1A3

Ran pcr on pSB1A3 and sfgfp blocks to add on golden gate primers

Date:

08/08

To Do

Confirm pACYC cut and uncut, then remake the pACYC PCR for Gibson

Accomplishment

PCR amplified pSB1K3 using Prefix and Suffix Primer Pool(50uL rxn with annealing at 57C and elongation for 1:20)

Gel confirmed!

PCR amplified LsrR_rbs_pLsr_rbs and LuxS using Prefix and Suffix Primer Pool (50uL rxn with annealing at 57.3C and elongation for 45 seconds)

LuxS block is gel confirmed!
LsrR_rbs_pLsr_rbs had three bands. There was one band the right length (~1300 bp). There were two other bands around 500bp. Not exactly sure what these two bands represent.

Date:

08/07

To Do

Transform pE-FLP
Create sequencing primers

Accomplishment

Ordered primers to create LuxS, LsrK, and YdgG Plasmids in pSB1A3 using golden gate assembly method
PCR of pACYC for Gibson was unsuccessful: had 5 bands...

Date:

08/06

To Do

Gibson first plasmid

Purify and run gel

Order primers to sequence the first plasmid
Order primers for Clonetegration assembly and screening by 8/7
Replate pOSIP-KO plasmid
Create Tetracycline LB agar plates

Accomplishment

Created Tetracycline LB agar plates
Transformed the LuxS Plasmid from golden gate using the miniprep result from colony B.
pT7_RBS_sfGFP_pT7_RBS_LsrK/YdgG plasmids checked on gel; they were failures. YdgG had nothing but backbone, LsrK had only a band on 1000 and 2000, so likely only sfGFP got in.
Collected flow cytometry data

Tested all 10 samples of constitutively expressed sfgfp
Tested every other sample of negative control pt7_rbs_sfgfp
Tested one sample of negative control pt7_rbs

Date:

08/03

To Do

Accomplishment

Mini Prepped golden gate LuxS O/N culture. Ran single restriction digest on all three samples using PstI.
Ran gel on golden gate LuxS. Made a single cut so the resulting length should be ~3820 bp. Lane 5, colony B, seems to be closest to the length. Lane 3 and Lane 7 both seem to a partial digest so some of the uncut plasmid would be supercoiled, traveling farther down the gel.
<img alt="" src="/images/LabJournal/image11.jpg" style="width: 1154.94px; height: 578.74px; margin-left: -381.48px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">

Date:

08/02

To Do

Accomplishment

Diluted the overnight cultures of flow parts: 1 ml of cells in 4 ml of LB

Now the cells are in log phase
Collected a sample every 30 minutes for five hours

Took 200 ul of cells and put them in 800 ul of LB. Dipped the cells in liquid nitrogen to freeze them in that point in time for flow cytometry later this week. 10 samples total

Will fix the cells right before flow cytometry

Grew out three colonies from golden gate of LuxS transformation for miniprep tomorrow

Date:

08/01

To Do

Accomplishment

PCR of pSB1K3 backbone left o/n in machine
Digest of CFP to confirm insert and test REs
Digest of IDT part in vector
Gel of the above two digests. Each enzyme cut CFP properly and showed a single band at the proper length (if it is in pSB1C3, if it is in pSB4C5 then there was no insert). The IDT part was actually a religated backbone showing only one bad despite being cut twice.
Transformed the golden gate rxn on the LuxS plasmid using our competent cells
Planned out Flow Cytometry measurement process. Going to run flow cytometry on pt7_rbs (negative control), pt7_rbs_sfgfp_term (negative control), and constitutive promoter_rbs_sfgfp_term (positive control).

Started overnight cultures on each of these parts.

Date:

07/31

To Do

Order low-copy plasmid
Transform first plasmid
PCR pSB1K3 backbone
Create BioBricks
Begin Flow Measurement

Accomplishment

Completed PCR of pSB1K3, but accidentally left the initial denaturation step on for 7 minutes
Transformed 3 trials of first plasmid ligation and control
Ordered low copy plasmid
Ordered primers for Gibson Assembly
Ran golden gate pcr on pt7_rbs_sfgfp_term then ran a gel to gel extract only that amplified part that way the original backbone would not get in it
Concentration was better this time; therefore, ran golden gate using that part and golden ready luxs and pGGA from the earlier golden gate reaction
Ran a restriction digest (cut on E|P) on LuxS block, YdgG block, and Lsrk block and then gel extracted those pieces to ligate. This is to prepare the biobricks that can be shipped off to iGEm HQ

Gel extractions were fairly low however. Better to use SeaPlaque agarose for gel extraction next time

Date:

07/30

To Do

Order low-copy plasmid
Religate first plasmid
Run a gel on the LuxS ligation
PCR pSB1K3 backbone
Run gel of uncut modified pBELOBac11 (to see if anything is actually in the miniprep)
Run gel of cut modified pBELOBac11
Try Imai method on overnight pBELOBac11 culture
Send out modified pBELOBac11 DNA for sequencing
LsrR_RBS_pLsr_RBS_sfGFP_T7

Accomplishment

Ran gel on LuxS golden gate ligation. Was not successful. Seems like only the pt7_rbs_sfgfp_term was inside its original pSB1C3 plasmid
Digested then ran a gel on pt7_rbs_sfgfp_term to gel extract it and then run golden gate pcr that way none of the original plasmid would be there. However, the gel extraction had very low concentration, 6.9ng/ul.

Date:

07/29

To Do

Grow out the one “successful” LuxS 3A assembly colony for miniprep monday
Grow out LuxS golden gate colony for miniprep monday

Accomplishment

Picked glowing One Plasmid + pT7-RBS-sfGFP-TT colonies to grow over night and restreak.
Grew out constitutive promoter-RBS-T7-TT and LuxS golden gate colonies overnight.

Date:

07/28

To Do

Accomplishment

Ran pcr rxn to add neb golden gate primers for LuxS plasmid construction. LuxS block and sfGFP block are going to be added to the pGGA destination cloning vector. It is chloramphenicol resistant

PCR reaction was fairly successful based on nanodrop results since they weren’t below 30 ng/uL this time. No guarantee still though

Ran golden gate reaction on LuxS plasmid to create pT7_rbs_sfGFP_term_pT7_rbs_LuxS_term-pGGA
Transformed LuxS golden gate plasmid using the NEB competent cells. Plated cells using dilution method that NEB protocol recommends. A pU19 plasmid was also plated to act as a control. It is ampicillin resistant
LuxS 3A assembly plate looked to have only one colony that could be useful. There were a lot of red colonies meaning that the backbone never got digest properly.
Transformed ligation of constitutive promoter-RBS-T7-TT
Transformed ligation of One Plasmid + pT7-RBS-sfGFP-TT
PCR purified and nanodropped the pSB1K3 reaction. Determined that it was a failure.

Date:

07/27

To Do

Accomplishment

Reran gel on pBeloBac with PstI single restriction digest.

Still no successful bands

Diluted new primers for LuxS plasmid for golden gate….primers based off of NEB Golden gate tool
Received YdgG from IDT
Ligated constitutive promoter-RBS-T7-TT and One Plasmid + pT7-RBS-sfGFP-TT, but used the wrong pipette. Remade both ligations and used shrimp alkaline phosphatase.
Attempted to PCR amplify the pSB1k3 plamid
Ligated LuxS plasmid using 3A assembly into pSB4K5

Forgot to add shrimp phosphatase so reran digest using shrimp phosphatase
One plate was plated with shrimp and the other without it

Date:

07/26

To Do

Accomplishment

Single restriction digest on pBeloBac using PstI

No successful bands on gel

Ran restriction digest on LuxS plasmid parts for 3A assembly

Date:

07/25

To Do

Accomplishment

Miniprepped two different versions of modified pBELOBac11 plasmid backbone
Ordered Golden gate primers for LuxS block, but used neb golden gate assembly tool this time
Used 3A assembly to piece together pt7_rbs_sfgfp_term and pt7_rbs_LsrK_term into pSB1K3. Added shrimp alkaline phosphatase (rSAP) to limit the backbone from reannealing

Added the phosphatase after the digestion: 2ul of cutsmart buffer and 1ul of rSAP

Date:

07/24

To Do

Miniprep LsrR_rbs_pLsr_rbs_T7_term_pT7_rbs_sfgfp flourescent colony cultures
Continue golden gate pcr primer rxn for constructing first plasmid

Need to do T7 and B0015(Terminator)

Run golden gate reaction to construct first plasmid

Accomplishment

Transformed T7 from the kit
Ran golden gate primer pcr on T7 and B0015; refer to notebook for exact protocol
Ran golden gate ligation on first plasmid. Gel shows that none of the parts actually ligated during the reaction so the process was unsuccessful.
Noticeable growth observed on pBELOBac11 Hans Method 150 uL on miniprepped pBELOBac11 backbone, Low growth observed on pBELOBac11 Hans Method 150 uL on transformed DH5alpha original backbone

Date:

07/23

To Do

Accomplishment

Received golden gate and gibson master mixes that Pure Solutions ordered
Diluted primer order that came in today (200uM stock solution and 10uM working solution)
Created more Kanamcyn agar plates
Ran pcr rxn on pBeloBAC11 using Koz and Hansen method on “pBeloDircect” miniprep and “pBelo overnight culture” miniprep. A ligation was run on the Koz method reactions to ligate the backbone back together using T4 Ligase

2ul t4 ligase buffer
1ul t4 ligase
2ul Koz method pBelo
15ul water

All four reactions were transformed and plated on chloramphenicol plates (4ul of the ligation reaction was used to the transformation; 2ul of the Hansen PCRs were used for the transformation)
Tried to harvest more fluorescent colonies from the LsrR_rbs_pLsr_rbs_T7_term_pT7_rbs_sfgfp plate
<img alt="" src="/images/LabJournal/image10.jpg" style="width: 482.00px; height: 364.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
<img alt="" src="/images/LabJournal/image15.jpg" style="width: 482.00px; height: 364.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
The first image is constitutively expressed sfGFP. The seond image shows a colony that looks to be flourescing from the LsrR_rbs_pLsr_rbs_T7_term_pT7_rbs_sfgfp plate
Ran Golden Gate PCR primer rxn on pSB4K5 and LsrR_rbs_pLsr_rbs (refer to written lab notebook for exact protocol used)

Date:

07/22

To Do

Accomplishment

Grow overnight cultures for pBeloBAC11, ready the bacteria for miniprep, PCR, transformation on Monday

Date:

07/21

To Do

Accomplishment

Growth was visible on pBeloBAC11 plates, directly miniprepping was successful

Date:

07/20

To Do

Confirm Miniprepped pBeloBAC DNA from original strain, run gel from cultures → If this works, do all transformations, PCR-mediated deletions FROM miniprepped pBeloBAC

Make glycerol stock solution for successful (if successful) culture

Accomplishment

Gel possibly confirmed for miniprepped pBeloBAC11loxp2272? Expected 2 thick ~3000 BP bands and that is clearly shown, but there are other bands…

<img alt="" src="/images/LabJournal/image13.jpg" style="width: 323.46px; height: 431.50px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">

Date:

07/18

To Do

Goals/Deadlines

Accomplishment

Ordered shrimp alkaline phosphatase
One colony of pBeloBAC cultured

Date:

07/17

To Do

Order shrimp alkaline phosphatase, new low copy backbone

Accomplishment

Transformed DH5alpha cells w/ unmodified pBeloBAC11 backbone to see if this basic transformation attempt is successful
Added golden gate primers onto Lsrk using same method as yesterday
Ran golden gate reaction on the LsrK plasmid, used NEB protocol and equimolar calculator from Zargar (<a class="c45" href="https://www.google.com/url?q=http://www.insilico.uni-duesseldorf.de/Lig_Input.html&sa=D&ust=1535736625227000">http://www.insilico.uni-duesseldorf.de/Lig_Input.html</a>)

2.6ul pSB4A5
2ul Golden Gate NEB Buffer
1ul Golden Gate NEB Assembly master mix
2.3ul T7_term
0.5ul B0015
1.2ul LsrR_rbs_pLsr_rbs
3.8ul LsrK
6.6ul water

Transformed 2ul of golden gate result
Transformed LsrR_RBS_pLsr_RBS in chloramphenicol backbone.
Grew out culture of B0015 transformed E. Coli for future B0015 terminator use.
Received sequencing results for rbs_sfgfp...still analyzing them

Date:

07/16

To Do

Received second set of sequencing primers
First attempt of golden gate, single plasmid
Remove sites from single copy plasmid.

Accomplishment

Added golden gate primers onto pSB4A5, LsrR_rbs_pLsr_rbs, T7_term, and term(B0015) using pcr

Used Q5 High Fidelity Master Mix and protocol

Did not receive great results based on the nanodrop

Date:

07/15

To Do

Accomplishment

LsrACDBTT, YdgGTT, LsrKTT, LuxSTT colony PCR were failures; they had bands at 300 but no other bands, which means no part was inserted into the plasmid backbone. 3A probably is not good for such short ligation.

Date:

07/11

To Do

Accomplishment

We got colonies on the sfGFP controlled by the constitutive promoter all the colonies were not flourescing, only a portion of them. We think this is due to the lack of terminator...need to do some testing to figure out why
Ligated LsrR_rbs_pLsr_rbs_T7_term + pT7_rbs_sfGFP_term in pSB1K3 backbone
Ligated LuxS, LsrK, and LsrACDB into pSB1k3 backbone and transformed them

Date:

07/10

To Do

Accomplishment

pT7+RBS confirmed: ~300bps, because it was PCRed with VF2 & Vr primers<img alt="" src="/images/LabJournal/image12.jpg" style="width: 482.00px; height: 336.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
pT7+RBS+sfGFP+pT7+RBS confirmed:<img alt="" src="/images/LabJournal/image1.jpg" style="width: 482.00px; height: 337.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
Transformed constitutive promoter(plus rbs) sfGFP (in pSB1K3)

Date:

07/09

To Do

Create standard sequencing protocol in the handbook
Get forward only primers for sequencing
Run gels on LsrKTT & LsrACDBTT
Make mid-sequence primers for LsrK (1600+), T7-term (3000), LsrACDB (4500) for sequencing.
Resend samples for sequencing (9/13)
Obtain all plasmids necessary for further work (9/13)

Accomplishment

(assuming that all parts are in vectors and also using VF2&VR primers)

LsrK (BBa_K1202109) primer:

Ctgtggctggcacatcatcgtagcg (@500bp)

T7-term (BBa_K145001) primer:

Gttcaggctgtagcaagcgcaatcg (@400bp) - 1
Cagtaagaaagcactgatgcgctac (@900bp) - 2
Tgcgggtgtcgataaggttccgttc (@1400bp) - 3
Tcatgacgctggcttacgggtccaa (@1900bp) - 4

LsrACDB primer:

GCCGATCGCCAAATGGTGGAAATCC (@430bp)-1
TATGCTGAATGGTAAAGAGATCAAT(@960bp)-2
TGCGCGTTGCCTTCGGCGATAGTCA(@1490bp)-3
GGTTGACGATAATTCTGGTGGCATT (@2020bp)-4
CCGCATAATGCGTATTCGCTACGGT (@2550bp)-5
CTCGTTTTCTGGCTCTGGCTGCATA (@3080bp)-6
ATTGCCGCAATCTCTATGAATGTGC (@3610bp)-7

Golden gate primers for LsrK plasmid...check csv file
Ligated a constitutive promoter(plus rbs) onto sfGFP to check if fluorescence actually occurs with a Kanamicin backbone(pSB1K3)

Date:

07/06

To Do

Need more Amp plates

Accomplishment

Redid ligation of LsrKTT & LsrACDBTT because gel did not show proper bands

Date:

07/05

To Do

Accomplishment

Ran gel of digested LsrK+TT, LsrACDB+TT, pT7rbs+sfGFP+pT7rbs, strong RBS, pT7sfGFP, lsrR+rbs+plsr+rbs, B0034, T7+terminator (F1, I2, G2, H8)(orange samples are the parts sent for sequencing
Another gel of LuxS, LsrK, YdgG, LsrACDB, pT7rbs

Date:

07/03

To Do

Accomplishment

Ligated and transformed pT7rbs+sfGFP+pT7rbs
Cultured LsrK+TT, LsrACDB+TT

Date:

07/02

To Do

Accomplishment

LuxS, LsrK, YdgG, LsrACDB, Lsr+rbs+plsr+rbs, pT7+rbs+sfGFP, B0034, T7-terminator sent to sequencing
Ligated and transformed LsrK+TT, LsrACDB+TT
Agar plates with both Amp and Cm made

Date:

06/29

To Do

PCR lsrACDB out of genome again
Purify and send out parts for sequencing
Religate the first plasmid

Accomplishment

Date:

06/28

To Do

Run digests and gels on all unconfirmed parts (ACDB, ACDB + RBS, LsrK, Plasmid 1 religation)
PCR LuxS
Prepare parts with proper lengths for sequencing
List which parts need to be remade

Accomplishment

PCR on LuxS
Ran a gel on LuxS and other parts. Confirmed LuxS length.
Ran a gel on lsrACDB, RBS+ACDB, pT7+RBS+sfGFP, RBS+YdgG, and sfGFP digested with E-HF and P-HF. P-HF cannot be heat killed, so this was a mistake. Both parts with ACDB show problems. The other three parts look the correct length, although sfGFP looks to be a partial digest.<img alt="" src="/images/LabJournal/image6.jpg" style="width: 482.00px; height: 241.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">

Date:

06/27

To Do

Do PCR to make more parts, especially kanamycin backbone
Transform LsrR+rbs+pLsr+rbs+pSB1C3

Goals/Deadlines

Complete ILS (6/29)
Complete and verify lengths of pT7 + RBS + sfGFP, RBS + LsrACDB, RBS + LuxS, RBS + LsrK, and Ordered part + T7term (06/29)
Find Single copy backbone (for double plasmid)

Accomplishment

Transformed YFL, CFP, OFL, PFP to create fluorescent plates
Restriction digest on pT7+rbs+sfGFP
Transformed IDT Part that was cloned into a vector yesterday (LsR+rbs+pLsr+rbs)
Performed PCR on pSB1C3/A3/K3 as well as pT7-RBS, and pT7-RBS-sfGFP
Ran a gel on the above parts. Backbone PCRs showed success. pT7-RBS-sfGFP looks to have successfully ligated, but not fully digested. New gel will be run tomorrow. pT7-RBS band appears at 400bp, which is approx. where it should be due to extra bps from the PCR primers used. A second band appears in the well however, there should only be one.
Competed ILS

Date:

06/26

To Do

Move pT7-RBS-sfGFP transformants to cultures and restreak plates.
Purify pT7-RBS-sfGFP
Troubleshoot problems in digest procedure
Verify lengths of parts

Goals/Deadlines

Complete ILS (6/29)
Complete and verify lengths of pT7 + RBS + sfGFP, RBS + LsrACDB, RBS + LuxS, RBS + LsrK, and Ordered part + T7term (06/29)
Find Single copy backbone (for double plasmid)

Accomplishment

Moved pT7-RBS-sfGFP transformants to cultures and restreak plates.
New digest procedures tested successfully, neither using BSA. The first digest used Cutsmart and the second digest used NEBuffer 2.1. Gel revealed that the insert length for plasmid 1 is approximately 1500 bp (near the 1337 of the IDT ordered part), rather than the 6000 bp it should have been.

Gel of plasmid 1 digested with (from left) cutsmart buffer, buffer 2.1, and uncut.<img alt="" src="/images/LabJournal/image3.jpg" style="width: 482.00px; height: 241.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
Appears that there is the backbone (~2200 bp) and IDT part (1337 bp)
7 μL DNA, 2.5 μL buffer, 0.5 μL per enzyme (E & S used), 14.5 μL H2O. 37˚C for rxn and 80˚C for heat kill, 20 minutes each.
Digested pSB1C3 and IDT Part (LsrR+rbs+pLsr+rbs) both with E|S. Then ligated both:

Ligation protocol → 20uL Reaction

2uL of pSB1C3
4uL of IDT Part
1uL of T4 Ligase Buffer
0.5uL of T4 Ligase Buffer
12.5uL of MilliQ Water
Incubate at 16C for 30 mins then heat killed at 80C for 20 mins

Date:

06/25

To Do

Email Endy again
Restreak pSB4K5 and pSB4A5 restreaks
Purify pSB4K5, pSB4A5, and Plasmid 1 from O/N cultures
Sequence stuff!

Goals/Deadlines

Complete ILS (6/29)
Complete and verify lengths of pT7 + RBS + sfGFP, RBS + LsrACDB, RBS + LuxS, RBS + LsrK, and Ordered part + T7term (06/29)
Find Single copy backbone (for double plasmid)

Accomplishment

Learned gateway assembly
pSB4A5 and pSB4K5 restreaked
Emailed Endy, Clonetegration is coming
Ran 2 half gels on Plasmid 1 digest. Nothing was seen in the wells, but DNA was apparent when undigested Plasmid 1 DNA was run. Potential problem with the new enzymes, buffer, or the digest procedure. The following is Plasmid 1 undigested. The lane appears much smaller than it should be (must be noted that plasmid is still in a circular form)<img alt="" src="/images/LabJournal/image14.jpg" style="width: 482.00px; height: 337.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">

Date:

06/22

To Do

Assess new competent cells
Check for successful transformants and move to shaker O/N
PCR LuxS out of iGEM part (Will)
Transform pSB4C5 and pSB4A5 (Vignesh)
Catalogue successfully made parts

Goals/Deadlines

Go and learn how to do Goldengate

Accomplishment

New competent cells have transformation efficiency of 1.6 x 107
Primers for amplifying iGEM parts ordered from IDT

Date:

06/21

To Do

Make new competent cells (Nick, Paul, Kevin)
Transformations of pSB4A3, pSB4K3, IDT-T7-Term (Vignesh)
Mini-prep RBS-Shaker (Paul)
PCR out of iGEM parts (Will, Kevin)
Make more agar plates (Dylan)
Email Endy

Goals/Deadlines

Complete ILS (6/29)
Complete RBS + sfGFP, T7 + Term, RBS + YdgG, RBS + LsrACDB, Ordered part + T7term (06/29)
Find Single copy backbone (for double plasmid)

Accomplishment

Made new competent cells
Made more Ampicillin and Kanamycin plates
Transformed pSB4A3, pSB4K3, IDT-T7-Term
Began test of new vs old competent cells
PCR done with LsrK, LuxS on iGEM parts; used primers from IDT

Date:

06/20

To Do

Make more agarose gels (Nick)
Run gels of ligation products
Transfer RBS-sfGFP to shaker tubes
Restreak?
Ligate IDT part + T7-Term
Check on growth for competent cell creation (Nick, Vignesh)
Get more pipette tips and foil
Check on status of iGEM ordered parts
Order primer for PCR on plasmid backbones
Order Gibson/Gate primers

Goals/Deadlines

Complete ILS
Complete RBS + sfGFP, T7 + Term, RBS + YdgG, RBS + LsrACDB, Ordered part + T7term (06/29)
Find Single copy backbone (for double plasmid)

Accomplishment

Did miniprep of grown cultures of RBS+YdgG, T7-terminator, RBS+LsrADCB.
Made a gel
Got more pipette tips
Received iGEM parts
Ordered backbone primers
Ran gel of (from left) T7+terminator, RBS+YdgG, RBS+LsrACDB digested with EcoRI, SpeI, XbaI, and Cutsmart buffer newly arrived from NEB. Used the old PstI-HF instead of new PstI<img alt="" src="/images/LabJournal/image9.jpg" style="width: 482.00px; height: 241.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">
The plasmids seem not cut properly. We messed up in the preparation, or the new enzymes were bad.

Date:

06/19

To Do

Rerun gel on RBS, Term, and LsrACDB (Will)

Begin ILS cell measurement (Ngozi)
Rehydrate and store LsrR+RBS+Proms+RBS (Kevin)
Religate RBS + sfGFP
Transform bacteria with RBS-sfGFP
Transfer successful transformants to overnight broths
Prepare for creation of new competent cells on Thursday (Vignesh)

Goals/Deadlines

Complete ILS
Complete RBS + sfGFP, T7 + Term, RBS + YdgG, RBS + LsrACDB, Ordered part + T7term (06/29)

Accomplishment

Received NEB Order, added to inventory
Prepared LB and DH5 preculture for competent cell creation
Made overnight transformant pre-cultures
Redid RBS + sfGFP ligation and plated
Reran gel on RBS, Term, and LsrACDB. Gels imaged very poorly
Rehydrated and stored LsrR+RBS+Proms+RBS

Date:

06/18

To Do

Make more gels
Check PCR of ACDB
Check transformations of Term. and RBS
Assemble RBS + sfGFP, T7 + Term, RBS + YdgG, RBS + LsrACDB, Ordered part + T7term.
Make orders for supplies

Accomplishment

Made Kanamycin agar plates
Made 2 agarose gels, used 1
Two unknown gels run. One at 10 am, 1 at 4 pm.
Obtained more agarose, ph probe storage buffer, and petri plates from Ms. Christopher; she will order more plates for us.
Assembled RBS + sfGFP, T7 + Term, RBS + YdgG, RBS + LsrACDB

Date:

06/15

To Do

Re-run gels
PCR using the primers we got (single colony PCR)
Pick the transformed colonies
Transform RBS and terminator
Purify T7 rna polymerase from cut gel
Glycerol stock solution of the original cells

Goals/Deadlines

Make pT7+sfGFP & first plasmid by end of June/start of July

Accomplishment

Glycerol stock solution of DH5 alpha, JM109, XL1-Blue made and stored in -80 degrees celsius
Gel purification done
The reason why B0034 was not transforming found: it is in an ampicillin resistance backbone, but we have been growing it in chloramphenicol agar plate.
All ILS transformants were inoculated into 15 mL falcon tubes to grow overnight.
Duplicate transformant plates were disposed of.
Inventory was made of plates in the 4˚C refrigerator.
PCR was completed for YdgG

Two reactions worth of mastermix was made in a tube with 10 microL Buffer, 2 microL dNTPs, 6 microL MgCl2, 0.8 microL Taq polymerase, and 61.2 microL water.
Dissolved 1 colony of non-competent, un-transformed DH5-alpha in 25 microL water.
Diluted 100 mM of RNA primer into a 10 mM stock.
Pipetted 50 microL of the mastermix into a tube with 5 microL of diluted primer, and 5 microL of dissolved DH5.
PCR was set to denature a 95˚C for 1 min, then cycle 8 times with an annealing temperature of 51˚C and extension temperature of 68˚C for 1 minute 2 seconds. The next 22 cycles were with an annealing temperature of 60˚C and extension temperature of 68˚C 1 minute 2 seconds. Final extension was 10 minutes at 68˚C.
Same done for ACDB, except that the second annealing temperature was 61˚C and each extension cycle was 4:36.

YdgG gel

Gel confirms that YdgG was amplified. Since this gel was run from PCR product, only one band was expected. The band is seen between 1615 and 1018 bp, but much closer to 1018. Its expected length is 1035.

Date:

06/14

To Do

Restreak bottom row plates again
Check growth in ILS plates
Analyze results from yesterday’s gel
Rerun gel for gel excision and purification

Accomplishment

Gel of 1kb ladder, T7 rna polymerase (left)(E/S) and B0017 terminator (right)(X/P)
The terminator is not showing two bands again… sequencing these would be nice. Why is this happening?
The E/S pair used this time proves to be working.

Cut gels and stored in 4 degree C for purification tomorrow

Date:

06/13

To Do

Miniprep DNA from successful transformants</span></p> <p class="c29"></em> Create agarose gel</p> <p class="c29"> Run gel with transformant DNA and RFP insert as positive control to verify transformation and working restriction enzymes</span></p> </td> </tr>

         <p class="c19">Goals/Deadlines</p>
       </td>

         <p class="c29"></em> Gibson Primers</p>
         <p class="c29"> Successfully transform </span>sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase, Terminator, and plasmid backbones. (by 6/15)</p>
         <p class="c29"></em> Verify transformations by running a gel. (by 6/15)</p>
         <p class="c29"> Assemble T7 RNA Polymerase + Terminator (by 6/22)</span></p>
         <p class="c29"></em> PCR out all necessary genes and transform (6/22)</p>
       </td>
     </tr>

         <p class="c19">Accomplishment</p>
       </td>

         <p class="c29"> Ran gel to assess transformations and enzyme function</span></p>
         <p class="c29"></em> Mini-prepped DNA</p>
         <p class="c29"> Ran gel </span></p>
         <p class="c29"><img
                                                                                                                                                                                                                                                                         alt="" src="/images/LabJournal/image4.png" style="width: 482.00px; height: 349.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></p>

Gel of (from left) 1kb ladder, T7 rna polymerase(X/P), B0017 terminator(X/P), sfGFP(E/S), pT7 (E/S), pSB4C5 (X/P), strong RBS + Promotor (E/S). One out of E or S is probably bad

T7 rna polymerase, as it should be, is in two pieces of ~2000 (psb1c3 backbone) & ~2700 bps.

B0017 terminator, as it should, has a piece ~2000 (backbone), but is missing the 170bp part. Perhaps it is not visible because it is too small. But 2000 bp shows that it cut properly at both X and P sites.

sfGFP part is 717bp, backbone is pSB1C3. So the total should be ~2700bp. The band shown is about 3000bp. This is likely because there has been only one cut but no second cut, so the entire linear plasmid ran through the gel.

That explains why pT7, also cut with E/S, seems to be ~2000 bp just like it should. Since at least one site was cut, the band appears at 2000 bp. Same conclusion with strong RBS + promotor

The fact that there are two bands for pSB4C5 means that both sites have been cut. But the sequence for pSB4C5 is unknown.

<p class="c29"></em> Retried unsuccessful transformants</p> <p class="c29"> Re-Streaked plates from successful transformants</span></p> </td> </tr> </tbody> </table>

<a id="t.55265fab6785646e4f6d0eabacd416c9af7c184c"></a><a id="t.60"></a> <tbody>

Date:06/12

To Do

</em> Find, order Restriction Enzymes

Check Transformed Bacteria → Transfer to Broth </span></p> <p class="c29"></em> Check for IDT orders </p> </td> </tr>

<p class="c19">Goals/Deadlines</p> </td>

Successfully transform sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase, Terminator, and plasmid backbones. (by 6/15)

Verify transformations by running a gel. (by 6/15)

Assemble T7 RNA Polymerase + Terminator (by 6/22)

PCR out all necessary genes and transform (6/22)

</td> </tr>

<p class="c19">Accomplishment</p> </td>

Successful colonies (sfGFP, strong promoter + RBS, pT7, T7 RNA polymerase, psb4c5). LsrR was unsuccessful

Made stock solutions of the colonies, 6 mL each

Found and made list of previous iGEM team’s restriction enzymes

</td> </tr> </tbody> </table>

<a id="t.26c34e8a86dd14f5195b11ba3ab9cd457c2b5e49"></a><a id="t.61"></a> <tbody> </tbody>

Date:06/11

To Do

Make agarose gels and glycerol stock for long term bacterial storage.

Goals/Deadlines

Successfully transform sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase, Terminator, and plasmid backbones. (by 6/15)

Verify transformations by running a gel. (by 6/15)

Assemble T7 RNA Polymerase + Terminator (by 6/22)

Accomplishment

Transformed LsrR, sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase

Agarose gel made and run with B0017; but we did not cut the DNA before running it on gel, so the true plasmid size was undetermined (should be around 2200bps, shown is only 1500bp)<img alt="" src="/images/LabJournal/image8.jpg" style="width: 482.00px; height: 236.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">

Glycerol stock solution of B0017 cells made (50:50 glycerol:cell volume) and stored in -80, at the 2nd compartment from top

<a id="t.47541bbe02fa7224879d29ed50739e55b9d790a8"></a><a id="t.62"></a> <tbody> </tbody>

Date:06/10

To Do

Goals/Deadlines

Successfully transform sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase, Terminator, and plasmid backbones. (by 6/15)

Verify transformations by running a gel. (by 6/15)

Assemble T7 RNA Polymerase + Terminator (by 6/20)

Accomplishments

Successfully transformed, bred, and miniprepped B0017

Some B0017 cells still left in fridge

<a id="t.e4a680e67a031c21f22712841a4e6c20788d1a12"></a><a id="t.63"></a> <tbody>

Date:06/08

To Do

Make Agar plates with Amp

Obtained from Prof. Koz his competent cells (1,2,2,3,3) and DNA: Transform the cells with his DNA and B0017.

Goals/Deadlines

Successfully transform sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase, Terminator, and plasmid backbones. (by 6/15)

Verify transformations by running a gel. (by 6/15)

Assemble T7 RNA Polymerase + Terminator (by 6/20)

Accomplishment

1, 2, 2, 3 were transformed with Amp resistance gene.

Standard heat shock

1uL of dna into 100uL of competent cells

Incubate on ice for 15-20 mins

Heat shock at 42C for 90 seconds

Incubate on ice for 5 minutes

Add 900uL of LB to competent cells

Grow in 37°C for 1 hour in long glass tubes, shaking

Transfer 1 mL to eppendorf tube

Spin down @ 8000rpm for 1 min

Take out 800 µL of supernatant

Resuspend pellet in remaining 200µL

Plate 50 µL on one plate, 150 µL on another

centrifuged samples twice because pellets were so small.</span></p> <p class="c29 c37"></em>because pellets were so small after 1 hours incubation, 2, 2, 3 were incubated an additional hour and then centrifuged again. 1 and DHL were plated normally.</p> <p class="c14 c67"></p> </td> </tr> </tbody> </table>

<a id="t.2633fcdaed3ea1843426bbd085c684f9512b70d3"></a><a id="t.64"></a> <tbody> </tbody>

Date:06/07

To Do

Fix transformation protocol

Analyze results from yesterday

Send out IDT order (DNA + primers)

Goals/Deadlines

Verify transformation of cells with sfGFP(1365020), pT7 (K525088), RBS (K608022), T7Rpol, and Terminator (B0017) with gel. (by 6/8)

Accomplishment

We got competent cell success on the plate without any antibiotic but none of the transformed bacteria on plates with Cm grew. Going to try a new protocol (God Eric’s) using SOC media instead of LB media.

Ordered primers and one item for synthesis

Creating new Cm stock with 350 mg in 10 mL EtOH.

SOC Protocol (<a class="c45" href="https://www.google.com/url?q=http://www.fbs.leeds.ac.uk/facilities/protein/documents/SOC.pdf&sa=D&ust=1535736625381000">http://www.fbs.leeds.ac.uk/facilities/protein/documents/SOC.pdf</a>)

For 500ml:

10g tryptone

2.5g yeast extract

0.25g NaCl

0.5ml 2.5M KCl

Then autoclave

2.5 ml 2M MgCl2

10ml 1M Glucose

Transformed and Plated sfGFP (one with SOC media and the other with LB), pLsrA, T7 RNA Polymerase, LsrR, pT7. Using LB unless specified otherwise

Made new Chloromphenical Plates (35ug/ml)

Diluted RBS(B0034), Strong Promoter + RBS (K608022), Promoter (K823003), and Double Terminator (B0017) from the distribution kit with 10ul of MilliQ water.

Finished ordering all primers (LsrK, LuxS, LsrACDB, YdgG) and DNA (LsrR + pLsrR + pLsrA) with IDT

<p class="c14"></p>

<a id="t.3e2d0ce51fdcd426bfc65dbd94a98fd68fe08419"></a><a id="t.65"></a> <tbody> </tbody>

Date:06/06

To Do

Order all DNA and RNA primers (complete by 5 pm today)

Send out IDT order

Goals/Deadlines

Verify transformation of cells with sfGFP(1365020), pT7 (K525088), RBS (K608022), T7Rpol, and Terminator (B0017) with gel. (by 6/8)

Accomplishment

Finished iGEM Safety Form (Proofreading required from other team members)

Created new Chloramphenicol plates with 500 ul of 350 mg/ml stock chloramphenicol in 500 mL LB. Stock Cm solution may be mislabeled.

<a id="t.7217c3ee48c9aa006260faa5bb21b08bca89dcfa"></a><a id="t.66"></a> <tbody> </tbody>

Date:06/05

To Do

Goals/Deadlines

Order all DNA and RNA primers (complete by 5/31)

Send out IDT order

Accomplishment

Transformed competent cells with sfGFP(1365020), pLsrA(117002), LsrR (K091001), pT7 (K525088)

Failed: all plates had no growth after overnight culture

<a id="t.ce54728600b3f3c75ee431f472b39a7559fa87a5"></a><a id="t.67"></a> <tbody> </tbody>

To Do

Analyze results of competency test

Remake plates containing antibiotic (they were left out all night)

Transform competent cells with sfGFP(1365020), pLsrA(117002), LsrR (K091001), pT7 (K525088)

Find out how to sequence genes (do we need to?)

Interlab- Microsphere

Goals/Deadlines

Order all DNA and RNA primers (complete by 5/31)

Send out IDT order

Create Competent Cells (completed)

Interlab- Microsphere (completed)

Accomplishment

Confirmed successful competency test

Figure A. Cells transformed with BBa_J04450 grew on Chloramphenicol plates, while untransformed cells did not.

Figure B. Untransformed cells were unable to grow on Ampicillin, showing that there was no antibiotic resistant contamination. A second Chloramphenicol plate was inoculated with DH5-alpha transformed with BBa_J04450 to reconfirm.<img alt="" src="/images/LabJournal/image16.jpg" style="width: 237.68px; height: 317.50px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title="">

Created new Ampicillin and Chloramphenicol plates

Interlab- Microsphere (completed)

<a id="t.fbec18157d859d9eca19ebae2848461d001a1b25"></a><a id="t.68"></a> <tbody> </tbody>

Date:06/03

To Do

Continue incubating 500 mL of DH5-alpha to create competent cells

Continue monitoring growth to determine when OD will reach 0.12 (Its taking twice as long as it should).

Complete competent cell procedure if possible

Goals/Deadlines

Order all DNA and RNA primers (complete by 5/31)

Send out IDT order

Create Competent Cells (complete by 6/4)

Accomplishment

Growth continued DH5a culture in 500ml Flask (LB + 2.5ml MgCl20) in Kozminski lab for competent cells; 12:00 am = OD 0.09; 3:00 am = OD 0.104; 7:00 am = OD 0.13

Completed competent cell procedure

Prepared competence test (attempted transformation with RFP, plated on Chloramphenicol. Plated untransfromed cells on chloramphenicol and ampicillin as control. Incubated at 37˚C.)

<a id="t.ff58d6ba4a94a47aa9452ebc4a917f358f4c6847"></a><a id="t.69"></a> <tbody> </tbody>

Date:06/02

To Do

Continue incubating 500 mL of DH5-alpha to create competent cells

Continue monitoring growth to determine when OD will reach 0.12 (Its taking twice as long as it should).

Complete competent cell procedure if possible

Interlab - Ludox protocol

Goals/Deadlines

Order all DNA and RNA primers (complete by 5/31)

Send out IDT order

Create Competent Cells (complete by 6/4)

Interlab - Ludox protocol

Accomplishment

Created Transformation Buffer

Started growth of DH5a culture in 500ml Flask (LB + 2.5ml MgCl20) in Kozminski lab for competent cells; 11:00 am = OD 0.053; 2:45 pm = OD 0.059; 9:00 pm = OD 0.074

Interlab - Ludox protocol is complete

<a id="t.eb523f913e19a729a1efce1cebdcbd834afc9b78"></a><a id="t.70"></a> <tbody> </tbody>

Date:06/01

To Do

Incubate 500 mL of DH5-alpha to create competent cells

Monitor growth to determine when OD will reach 0.12

Interlab - Plate reader information

Goals/Deadlines

Order all DNA and RNA primers (complete by 5/31)

Send out Free IDT Base Pair Application (cannot proceed with IDT orders until they respond)

Create Competent Cells (complete by 6/4)

Collect Plate reader information

Accomplishment

Sent out Free IDT Base Pair Application (cannot proceed with IDT orders until they respond)

Started growth of DH5a culture in 500ml Flask (LB + 2.5ml MgCl20) in Kozminski lab for competent cells; Growth started at 3:30 → t0 = 0.048 OD; 5:30 pm = OD 0.048;

Plate reader information collected except filter and bandpass information need to be confirmed from Koz and Dr.Spano

<a id="t.05a6b2ceef7cf5600b337a5fe80113d6a27b6fb1"></a><a id="t.71"></a> <tbody> </tbody>

Date:05/31

To Do

Grow up second set of cultures

Goals/Deadlines

Create competent cells (complete by 5/31)

Order all DNA and RNA primers (complete by 5/31)

Send out Free IDT Base Pair Application (cannot proceed with IDT orders until they respond)

Accomplishment

Created Transformation Buffer (This buffer ended up precipitating and needed to be remade).

<p class="c40 c64"></p>

<a id="t.7ce57a7ab42c13a5975ec3db3e804e6cad35cf10"></a><a id="t.72"></a> <tbody> </tbody>

Date:05/30

To Do

Take bacteria colony and put it into 2 mL of broth, incubate

Create competent cell reagents

Make 1M CaCl2/2H2O

Make 0.5 M MnCl2/4H2O

Find PIPES, N2, DMSO

Send out some IDT orders

Understand, Figure out

Golden Gate

J5

Clonetegration

AI-2 Assay

BglBricks

Goals/Deadlines

Create competent cells (complete by 5/31)

Order all DNA, DNA and RNA primers (complete by 6/1)

Accomplishment

Created bacterial colony

Created competent cell reagents

Info obtained on Goldengate

Obtained Flow Cytometry Authorization

<a id="t.473542692304ea324a8ea84fb98ceea548eac4c5"></a><a id="t.73"></a> <tbody> </tbody>

Date:05/29

To Do

Housekeeping: Inventory and reorganize lab

Create Ampicillin stock solution

Create Chloramphenicol stock solution

Create LB plates (Control, ampicillin, chloramphenicol)

Create LB broth

Incubate cells to be made competent

Goals/Deadlines

Create competent cells (complete by 5/31)

Order all DNA and RNA primers (complete by 5/31)

Accomplishment

Created Ampicillin stock solution

Created Chloramphenicol stock solution

Created LB plates (Control, ampicillin, chloramphenicol)

Created LB broth

Incubated cells to be made competent

Inventory

<a id="t.bb227e39ec9fcbaf26c7eddcc6087ff65921c7df"></a><a id="t.74"></a> <tbody> </tbody>

Date:05/23

To Do

Accomplishment

Synthesis and Assembly plan

Use IDT to synthesize the T7Rpol? Or the entire plsr + T7Rpol + terminator sequence. We have 20 kb of free synthesis, but it will likely take 18-25 days to ship.

We plan to try to make the plasmids with Gibson assembly unless it gives us significant trouble due to the size of the pieces being used. Contact former VA iGEM member Eric about his mastermix for Gibson assembly from last year.

</div>

@@ Line 274: / Line 274: @@
                the LsrK Block and sfgfp block this time. </span></li>
              <li class="c8"><span class="c0">Sent Experiment 1 results to W&amp;M</span></li>
-             <li class="c8"><span class="c0">Ran gel on W&amp;M experiment 2. All four lanes were failures.</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 361.33px;"><img alt="" src="https://static.igem.org/mediawiki/2018/0/00/T--Virginia--2018_image5.jpg" style="width: 482.00px; height: 361.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></li>
+             <li class="c8"><span class="c0">Ran gel on W&amp;M experiment 2. All four lanes were failures.</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 361.33px;"><img
+                                                                                                                                                                                                                                                                                                                                                                  alt="" src="/images/LabJournal/image5.jpg" style="width: 482.00px; height: 361.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                                                                                                                  title=""></span></li>
              <li class="c8"><span class="c0">Ran a gel on the 8 lsrACDBTT minipreps. All of them appear to be reannealed backbones.</span></li>
              <li class="c8"><span class="c0">Continued golden assembly for YdgG and LsrK plasmids </span></li>
@@ Line 292: / Line 294: @@
            <ul class="c17 lst-kix_9usocsnajri2-1 start">
              <li class="c12"><span class="c41"><a class="c45" href="https://www.google.com/url?q=https://clims4.genewiz.com/SangerSequencing/ViewResultFileByReaction?ReactionID%3D4243f3e4-bcff-4a8b-aced-3598a7e5feae&amp;sa=D&amp;ust=1535736625122000">https://clims4.genewiz.com/SangerSequencing/ViewResultFileByReaction?ReactionID=4243f3e4-bcff-4a8b-aced-3598a7e5feae</a></span></li>
-             <li class="c12"><span class="c41"><a class="c45" href="https://www.google.com/url?q=https://clims4.genewiz.com/SangerSequencing/ViewResultFileByReaction?ReactionID%3Dcec1f867-9e0f-4f69-b65d-98c88435d35b&amp;sa=D&amp;ust=1535736625122000">https://clims4.genewiz.com/SangerSequencing/ViewResultFileByReaction?ReactionID=cec1f867-9e0f-4f69-b65d-98c88435d35b</a></span><span class="c0">&nbsp; </span></li>
+             <li class="c12"><span class="c41"><a class="c45" href="https://www.google.com/url?q=https://clims4.genewiz.com/SangerSequencing/ViewResultFileByReaction?ReactionID%3Dcec1f867-9e0f-4f69-b65d-98c88435d35b&amp;sa=D&amp;ust=1535736625122000">https://clims4.genewiz.com/SangerSequencing/ViewResultFileByReaction?ReactionID=cec1f867-9e0f-4f69-b65d-98c88435d35b</a></span><span
+                                                                                                                                                                                                                                                                                                                                                                                           class="c0">&nbsp; </span></li>
            </ul>
            <ul class="c17 lst-kix_9usocsnajri2-0">
@@ Line 753: / Line 756: @@
              <li class="c8"><span class="c0">Ran gel on golden gate LuxS. Made a single cut so the resulting length should be ~3820 bp. Lane 5, colony B, seems to be closest to the length. Lane 3 and Lane 7 both seem to a partial digest
                so some of the uncut plasmid would be supercoiled, traveling farther down the gel. </span></li>
-             <li class="c8"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 393.53px; height: 438.50px;"><img alt="" src="https://static.igem.org/mediawiki/2018/6/6c/T--Virginia--2018_image11.jpg" style="width: 1154.94px; height: 578.74px; margin-left: -381.48px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></li>
+             <li class="c8"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 393.53px; height: 438.50px;"><img
+                                                                                                                                                                                                                                                                            alt="" src="/images/LabJournal/image11.jpg" style="width: 1154.94px; height: 578.74px; margin-left: -381.48px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                            title=""></span></li>
            </ul>
          </td>
@@ Line 1,185: / Line 1,190: @@
              <li class="c8"><span class="c0">All four reactions were transformed and plated on chloramphenicol plates (4ul of the ligation reaction was used to the transformation; 2ul of the Hansen PCRs were used for the transformation)</span></li>
              <li class="c8"><span>Tried to harvest more fluorescent colonies from the LsrR_rbs_pLsr_rbs_T7_term_pT7_rbs_sfgfp plate </span></li>
-             <li class="c8"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 364.00px;"><img alt="" src="https://static.igem.org/mediawiki/2018/a/a7/T--Virginia--2018_image10.jpg" style="width: 482.00px; height: 364.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></li>
+             <li class="c8"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 364.00px;"><img
-             <li class="c8"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 364.00px;"><img alt="" src="https://static.igem.org/mediawiki/2018/d/df/T--Virginia--2018_image15.jpg" style="width: 482.00px; height: 364.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></li>
+                                                                                                                                                                                                                                                                            alt="" src="/images/LabJournal/image10.jpg" style="width: 482.00px; height: 364.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                            title=""></span></li>
+             <li class="c8"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 364.00px;"><img
+                                                                                                                                                                                                                                                                            alt="" src="/images/LabJournal/image15.jpg" style="width: 482.00px; height: 364.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                            title=""></span></li>
              <li class="c8"><span class="c0">The first image is constitutively expressed sfGFP. The seond image shows a colony that looks to be flourescing from the LsrR_rbs_pLsr_rbs_T7_term_pT7_rbs_sfgfp plate </span></li>
              <li class="c8"><span>Ran Golden Gate PCR primer rxn on pSB4K5 and LsrR_rbs_pLsr_rbs (refer to written lab notebook for exact protocol used)</span></li>
@@ Line 1,286: / Line 1,295: @@
            </ul>
            <ul class="c17 lst-kix_hwfmngjwe59t-1 start">
-             <li class="c12"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 323.46px; height: 431.50px;"><img alt="" src="https://static.igem.org/mediawiki/2018/2/22/T--Virginia--2018_image13.jpg" style="width: 323.46px; height: 431.50px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></li>
+             <li class="c12"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 323.46px; height: 431.50px;"><img
+                                                                                                                                                                                                                                                                             alt="" src="/images/LabJournal/image13.jpg" style="width: 323.46px; height: 431.50px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                             title=""></span></li>
            </ul>
          </td>
@@ Line 1,502: / Line 1,513: @@
          <td class="c58" colspan="1" rowspan="1">
            <ul class="c17 lst-kix_9usocsnajri2-0">
-             <li class="c8"><span>pT7+RBS confirmed: ~300bps, because it was PCRed with VF2 &amp; Vr primers</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 336.00px;"><img alt="" src="https://static.igem.org/mediawiki/2018/4/47/T--Virginia--2018_image12.jpg" style="width: 482.00px; height: 336.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></li>
+             <li class="c8"><span>pT7+RBS confirmed: ~300bps, because it was PCRed with VF2 &amp; Vr primers</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 336.00px;"><img
-             <li class="c8"><span>pT7+RBS+sfGFP+pT7+RBS confirmed:</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 337.33px;"><img alt="" src="https://static.igem.org/mediawiki/2018/5/55/T--Virginia--2018_image1.jpg" style="width: 482.00px; height: 337.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></li>
+                                                                                                                                                                                                                                                                                                                                                                   alt="" src="/images/LabJournal/image12.jpg" style="width: 482.00px; height: 336.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                                                                                                                   title=""></span></li>
+             <li class="c8"><span>pT7+RBS+sfGFP+pT7+RBS confirmed:</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 337.33px;"><img
+                                                                                                                                                                                                                                                                                                                         alt="" src="/images/LabJournal/image1.jpg" style="width: 482.00px; height: 337.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                                                                         title=""></span></li>
              <li class="c8"><span class="c0">Transformed constitutive promoter(plus rbs) sfGFP (in pSB1K3)</span></li>
            </ul>
@@ Line 1,760: / Line 1,775: @@
              <li class="c8"><span class="c0">Ran a gel on LuxS and other parts. Confirmed LuxS length.</span></li>
              <li class="c8"><span>Ran a gel on lsrACDB, RBS+ACDB, pT7+RBS+sfGFP, RBS+YdgG, and sfGFP digested with E-HF and P-HF. P-HF cannot be heat killed, so this was a mistake. Both parts with ACDB show problems. The other three parts
-               look the correct length, although sfGFP looks to be a partial digest.</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 241.33px;"><img alt="" src="https://static.igem.org/mediawiki/2018/e/e9/T--Virginia--2018_image6.jpg" style="width: 482.00px; height: 241.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></li>
+               look the correct length, although sfGFP looks to be a partial digest.</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 241.33px;"><img
+                                                                                                                                                                                                                                                                                                                                           alt="" src="/images/LabJournal/image6.jpg" style="width: 482.00px; height: 241.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                                                                                           title=""></span></li>
            </ul>
          </td>
@@ Line 1,858: / Line 1,875: @@
            </ul>
            <ul class="c17 lst-kix_9usocsnajri2-1 start">
-             <li class="c12"><span>Gel of plasmid 1 digested with (from left) cutsmart buffer, buffer 2.1, and uncut.</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 241.33px;"><img alt="" src="https://static.igem.org/mediawiki/2018/8/84/T--Virginia--2018_image3.jpg" style="width: 482.00px; height: 241.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></li>
+             <li class="c12"><span>Gel of plasmid 1 digested with (from left) cutsmart buffer, buffer 2.1, and uncut.</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 241.33px;"><img
+                                                                                                                                                                                                                                                                                                                                                                            alt="" src="/images/LabJournal/image3.jpg" style="width: 482.00px; height: 241.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                                                                                                                            title=""></span></li>
              <li class="c12"><span class="c0">Appears that there is the backbone (~2200 bp) and IDT part (1337 bp)</span></li>
              <li class="c12"><span>7 &mu;L DNA, 2.5 &mu;L buffer, 0.5 &mu;L per enzyme (E &amp; S used), 14.5 &mu;L H</span><span class="c39">2</span><span class="c0">O. 37&#730;C for rxn and 80&#730;C for heat kill, 20 minutes each.</span></li>
@@ Line 1,921: / Line 1,940: @@
              <li class="c8"><span class="c0">Emailed Endy, Clonetegration is coming</span></li>
              <li class="c8"><span>Ran 2 half gels on Plasmid 1 digest. Nothing was seen in the wells, but DNA was apparent when undigested Plasmid 1 DNA was run. Potential problem with the new enzymes, buffer, or the digest procedure. The
-               following is Plasmid 1 undigested. The lane appears much smaller than it should be (must be noted that plas</span><span>mid is </span><span>still in a circular form)</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 337.33px;"><img alt="" src="https://static.igem.org/mediawiki/2018/2/2a/T--Virginia--2018_image14.jpg" style="width: 482.00px; height: 337.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span><span class="c0">&nbsp;</span></li>
+               following is Plasmid 1 undigested. The lane appears much smaller than it should be (must be noted that plas</span><span>mid is </span><span>still in a circular form)</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 337.33px;"><img
+                                                                                                                                                                                                                                                                                                                                                                                                                                           alt="" src="/images/LabJournal/image14.jpg" style="width: 482.00px; height: 337.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                                                                                                                                                                                           title=""></span><span class="c0">&nbsp;</span></li>
            </ul>
            <p class="c14"><span class="c0"></span></p>
@@ Line 2,072: / Line 2,093: @@
              <li class="c8"><span class="c0">Received iGEM parts</span></li>
              <li class="c8"><span class="c0">Ordered backbone primers</span></li>
-             <li class="c8"><span>Ran gel of (from left) T7+terminator, RBS+YdgG, RBS+LsrACDB digested with EcoRI, SpeI, XbaI, and Cutsmart buffer newly arrived from NEB. Used the old PstI-HF instead of new PstI</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 241.33px;"><img alt="" src="https://static.igem.org/mediawiki/2018/6/67/T--Virginia--2018_image9.jpg" style="width: 482.00px; height: 241.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></li>
+             <li class="c8"><span>Ran gel of (from left) T7+terminator, RBS+YdgG, RBS+LsrACDB digested with EcoRI, SpeI, XbaI, and Cutsmart buffer newly arrived from NEB. Used the old PstI-HF instead of new PstI</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 241.33px;"><img
+                                                                                                                                                                                                                                                                                                                                                                                                                                                                          alt="" src="/images/LabJournal/image9.jpg" style="width: 482.00px; height: 241.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                                                                                                                                                                                                                          title=""></span></li>
              <li class="c8"><span class="c0">The plasmids seem not cut properly. We messed up in the preparation, or the new enzymes were bad.</span></li>
            </ul>
@@ Line 2,226: / Line 2,249: @@
            </ul>
            <p class="c29"><span class="c0">YdgG gel</span></p>
-           <p class="c29"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 323.00px; height: 499.00px;"><img alt="" src="https://static.igem.org/mediawiki/2018/d/d7/T--Virginia--2018_image7.jpg" style="width: 323.00px; height: 499.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p>
+           <p class="c29"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 323.00px; height: 499.00px;"><img
+                                                                                                                                                                                                                                                                          alt="" src="/images/LabJournal/image7.jpg" style="width: 323.00px; height: 499.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p>
            <p class="c29"><span class="c0">Gel confirms that YdgG was amplified. Since this gel was run from PCR product, only one band was expected. The band is seen between 1615 and 1018 bp, but much closer to 1018. Its expected length is
 .</span></p>
@@ Line 2,258: / Line 2,282: @@
          </td>
          <td class="c6" colspan="1" rowspan="1">
-           <p class="c29"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 593.33px;"><img alt="" src="https://static.igem.org/mediawiki/2018/7/7c/T--Virginia--2018_image2.png" style="width: 482.00px; height: 593.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p>
+           <p class="c29"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 593.33px;"><img
+                                                                                                                                                                                                                                                                          alt="" src="/images/LabJournal/image2.png" style="width: 482.00px; height: 593.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p>
            <ul class="c17 lst-kix_vxbxo9396wpf-0 start">
              <li class="c8"><span class="c52">Gel of 1kb ladder, T7 rna polymerase (left)(E/S) and B0017 terminator (right)(X/P)</span></li>
@@ Line 2,284: / Line 2,309: @@
          </td>
          <td class="c6" colspan="1" rowspan="1">
-           <p class="c29"><span class="c0"><em> Miniprep DNA from successful transformants</em></span></p>
+           <p class="c29"><span class="c0"><em> Miniprep DNA from successful transformants</span></p>
-           <p class="c29"><span class="c0"> Create agarose gel</span></p>
+           <p class="c29"><span class="c0"></em> Create agarose gel</span></p>
-           <p class="c29"><span class="c0"><em> Run gel with transformant DNA and RFP insert as positive control to verify transformation and working restriction enzymes</em></span></p>
+           <p class="c29"><span class="c0"><em> Run gel with transformant DNA and RFP insert as positive control to verify transformation and working restriction enzymes</span></p>
          </td>
        </tr>
@@ Line 2,294: / Line 2,319: @@
          </td>
          <td class="c6" colspan="1" rowspan="1">
-           <p class="c29"><span class="c0"> Gibson Primers</span></p>
+           <p class="c29"><span class="c0"></em> Gibson Primers</span></p>
-           <p class="c29"><span><em> Successfully transform </em></span><span class="c0 c15">sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase, Terminator, and plasmid backbones. (by 6/15)</span></p>
+           <p class="c29"><span><em> Successfully transform </span><span class="c0 c15">sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase, Terminator, and plasmid backbones. (by 6/15)</span></p>
-           <p class="c29"><span> </span><span class="c0">Verify transformations by running a gel. (by 6/15)</span></p>
+           <p class="c29"><span></em> </span><span class="c0">Verify transformations by running a gel. (by 6/15)</span></p>
-           <p class="c29"><span class="c0"><em> Assemble T7 RNA Polymerase + Terminator (by 6/22)</em></span></p>
+           <p class="c29"><span class="c0"><em> Assemble T7 RNA Polymerase + Terminator (by 6/22)</span></p>
-           <p class="c29"><span class="c0"> PCR out all necessary genes and transform (6/22)</span></p>
+           <p class="c29"><span class="c0"></em> PCR out all necessary genes and transform (6/22)</span></p>
          </td>
        </tr>
@@ Line 2,306: / Line 2,331: @@
          </td>
          <td class="c6" colspan="1" rowspan="1">
-           <p class="c29"><span class="c0"><em> Ran gel to assess transformations and enzyme function</em></span></p>
+           <p class="c29"><span class="c0"><em> Ran gel to assess transformations and enzyme function</span></p>
-           <p class="c29"><span class="c0"> Mini-prepped DNA</span></p>
+           <p class="c29"><span class="c0"></em> Mini-prepped DNA</span></p>
-           <p class="c29"><span class="c0"><em> Ran gel </em></span></p>
+           <p class="c29"><span class="c0"><em> Ran gel </span></p>
-           <p class="c29"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 349.33px;"><img alt="" src="https://static.igem.org/mediawiki/2018/a/af/T--Virginia--2018_image4.png" style="width: 482.00px; height: 349.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p>
+           <p class="c29"><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 349.33px;"><img
+                                                                                                                                                                                                                                                                          alt="" src="/images/LabJournal/image4.png" style="width: 482.00px; height: 349.33px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></p>
            <ul class="c17 lst-kix_9usocsnajri2-0">
              <li class="c8"><span class="c52">Gel of (from left) 1kb ladder, T7 rna polymerase(X/P), B0017 terminator(X/P), sfGFP(E/S), pT7 (E/S), pSB4C5 (X/P), strong RBS + Promotor (E/S)</span><span class="c0">. One out of E or S is
@@ Line 2,321: / Line 2,347: @@
              <li class="c8"><span class="c0">The fact that there are two bands for pSB4C5 means that both sites have been cut. But the sequence for pSB4C5 is unknown.</span></li>
            </ul>
-           <p class="c29"><span class="c0"> Retried unsuccessful transformants</span></p>
+           <p class="c29"><span class="c0"></em> Retried unsuccessful transformants</span></p>
-           <p class="c29"><span><em> Re-Streaked plates from successful transformants</em></span></p>
+           <p class="c29"><span><em> Re-Streaked plates from successful transformants</span></p>
          </td>
        </tr>
@@ Line 2,339: / Line 2,365: @@
          </td>
          <td class="c6" colspan="1" rowspan="1">
-           <p class="c29"><span class="c0"> Find, order Restriction Enzymes &nbsp;</span></p>
+           <p class="c29"><span class="c0"></em> Find, order Restriction Enzymes &nbsp;</span></p>
-           <p class="c29"><span class="c0"><em> Check Transformed Bacteria &rarr; Transfer to Broth &nbsp;</em></span></p>
+           <p class="c29"><span class="c0"><em> Check Transformed Bacteria &rarr; Transfer to Broth &nbsp;</span></p>
-           <p class="c29"><span class="c0"> Check for IDT orders </span></p>
+           <p class="c29"><span class="c0"></em> Check for IDT orders </span></p>
          </td>
        </tr>
@@ Line 2,407: / Line 2,433: @@
            <ul class="c17 lst-kix_sgjjnwo5mex1-0 start">
              <li class="c8"><span class="c0 c15">Transformed LsrR, sfGFP, pT7, Strong Prom + RBS (K608002), RBS (B00344), T7 rna Polymerase</span></li>
-             <li class="c8"><span class="c15">Agarose gel made and run with B0017; but we did not cut the DNA before running it on gel, so the true plasmid size was undetermined (should be around 2200bps, shown is only 1500bp)</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 236.00px;"><img alt="" src="https://static.igem.org/mediawiki/2018/6/64/T--Virginia--2018_image8.jpg" style="width: 482.00px; height: 236.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></li>
+             <li class="c8"><span class="c15">Agarose gel made and run with B0017; but we did not cut the DNA before running it on gel, so the true plasmid size was undetermined (should be around 2200bps, shown is only 1500bp)</span><span
+                                                                                                                                                                                                                                          style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 482.00px; height: 236.00px;"><img
+                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     alt="" src="/images/LabJournal/image8.jpg" style="width: 482.00px; height: 236.00px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     title=""></span></li>
              <li class="c8"><span class="c15">Glycerol stock solution of B0017 cells made (50:50 glycerol:cell volume) and stored in -80, at the 2nd compartment from top</span></li>
            </ul>
@@ Line 2,509: / Line 2,538: @@
              <li class="c24"><span class="c21 c48 c15">Plate 50 &micro;L on one plate, 150 &micro;L on another</span></li>
            </ul>
-           <p class="c29 c37"><span class="c21 c48 c15"><em>centrifuged samples twice because pellets were so small.</em></span></p>
+           <p class="c29 c37"><span class="c21 c48 c15"><em>centrifuged samples twice because pellets were so small.</span></p>
-           <p class="c29 c37"><span class="c21 c48 c15">because pellets were so small after 1 hours incubation, 2, 2, 3 were incubated an additional hour and then centrifuged again. 1 and DHL were plated normally.</span></p>
+           <p class="c29 c37"><span class="c21 c48 c15"></em>because pellets were so small after 1 hours incubation, 2, 2, 3 were incubated an additional hour and then centrifuged again. 1 and DHL were plated normally.</span></p>
            <p class="c14 c67"><span class="c0 c15"></span></p>
          </td>
@@ Line 2,555: / Line 2,584: @@
              <li class="c8"><span class="c0">Ordered primers and one item for synthesis</span></li>
              <li class="c8"><span class="c0">Creating new Cm stock with 350 mg in 10 mL EtOH.</span></li>
-             <li class="c8"><span>SOC Protocol (</span><span class="c41"><a class="c45" href="https://www.google.com/url?q=http://www.fbs.leeds.ac.uk/facilities/protein/documents/SOC.pdf&amp;sa=D&amp;ust=1535736625381000">http://www.fbs.leeds.ac.uk/facilities/protein/documents/SOC.pdf</a></span><span class="c0">)</span></li>
+             <li class="c8"><span>SOC Protocol (</span><span class="c41"><a class="c45" href="https://www.google.com/url?q=http://www.fbs.leeds.ac.uk/facilities/protein/documents/SOC.pdf&amp;sa=D&amp;ust=1535736625381000">http://www.fbs.leeds.ac.uk/facilities/protein/documents/SOC.pdf</a></span><span
+                                                                                                                                                                                                                                                                                                         class="c0">)</span></li>
            </ul>
            <ul class="c17 lst-kix_wif204am9h7c-1 start">
@@ Line 2,702: / Line 2,732: @@
              <li class="c8"><span class="c0">Figure A. Cells transformed with BBa_J04450 grew on Chloramphenicol plates, while untransformed cells did not.</span></li>
              <li class="c8"><span class="c0">Figure B. Untransformed cells were unable to grow on Ampicillin, showing that there was no antibiotic resistant contamination. A second Chloramphenicol plate was inoculated with DH5-alpha
-               transformed with BBa_J04450 to reconfirm.</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 237.68px; height: 317.50px;"><img alt="" src="https://static.igem.org/mediawiki/2018/6/6e/T--Virginia--2018_image16.jpg" style="width: 237.68px; height: 317.50px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);" title=""></span></li>
+               transformed with BBa_J04450 to reconfirm.</span><span style="overflow: hidden; display: inline-block; margin: 0.00px 0.00px; border: 0.00px solid #000000; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px); width: 237.68px; height: 317.50px;"><img
+                                                                                                                                                                                                                                                                                                               alt="" src="/images/LabJournal/image16.jpg" style="width: 237.68px; height: 317.50px; margin-left: 0.00px; margin-top: 0.00px; transform: rotate(0.00rad) translateZ(0px); -webkit-transform: rotate(0.00rad) translateZ(0px);"
+                                                                                                                                                                                                                                                                                                               title=""></span></li>
              <li class="c8"><span class="c0">Created new Ampicillin and Chloramphenicol plates</span></li>
              <li class="c8"><span class="c0">Interlab- Microsphere (completed)</span></li>

Difference between revisions of "Template:Virginia/Notebook"

Revision as of 04:19, 4 October 2018

Contents

Description

Date:

Template

Date:

08/29

Date:

08/27

Date:

08/26

Date:

08/25

Date:

08/24

Date:

8/23

Date:

8/22

Date:

8/20

Date:

08/18

Date:

08/17

Date:

08/16

Date:

8/15

Date:

8/14

Date:

08/12

Date:

08/11

Date:

08/10

Date:

08/09

Date:

08/08

Date:

08/07

Date:

08/06

Date:

08/03

Date:

08/02

Date:

08/01

Date:

07/31

Date:

07/30

Date:

07/29

Date:

07/28

Date:

07/27

Date:

07/26

Date:

07/25

Date:

07/24

Date:

07/23

Date:

07/22

Date:

07/21

Date:

07/20

Date:

07/18

Date:

07/17