Difference between revisions of "Team:Kyoto/Safety"
SAKANAhuman (Talk | contribs) |
SAKANAhuman (Talk | contribs) |
||
| Line 71: | Line 71: | ||
<!-- ###################################################### BLOCK Contents END #################################################--> | <!-- ###################################################### BLOCK Contents END #################################################--> | ||
| − | + | <br><br><br><br><br><br><br><br> | |
<!-----------------------------------------------------BLOCK Parts--------------------------------------------------------------> | <!-----------------------------------------------------BLOCK Parts--------------------------------------------------------------> | ||
Revision as of 08:09, 2 October 2018
Safety
1) Parts
Basic Parts
Composite Parts
2) Primer List
| primer name | sequence | Length | Tm | GC% | Designer | Manufacturer |
|---|---|---|---|---|---|---|
| tropomyosinF | GATCGAGAAGGACAACGCCC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
| IK107 | cccgccgccaccatggaggcggccgcaaaatcagg | 35 | 94 | 71 | Yoshimoto | Macrogen Japan Corp |
3) Materials
3-1 Kit
| Name | Supplier |
|---|---|
| Wizard® SV Gel and PCR | Promega |
| FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
4) Methods
4-1 Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
4-17 Soaking
We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf
