Difference between revisions of "Team:Grenoble-Alpes/construction"

PROBE CONSTRUCTION

• PROJECT
  • BIOLOGY
    • BACTERIA CHOICE
    • TARGET SELECTION
    • PHAGE LYSIS & DNA EXTRACTION
    • PROBE CONSTRUCTION
    • CONSERVATION
  • ENGINEERING
  • DEMONSTRATE

CONSTRUCTION FOR PSEUDOMONAS AERUGINOSA

LYSIS

1. Plasmid backbone selection

Among all the backbones proposed by iGEM, we decided to choose one for our probe insertion. In fact, the 2017 IGEM Grenoble team showed by their experiments, that the pSB1C3-BBa_J04450 backbone was the most suitable for the detection of a red fluorescence.

The BBa_J04450 biobrick is composed of a RFP gene which is controlled by a LacI promoter inducible by IPTG. Moreover, it has a resistance gene for chloramphenicol to be able to select only bacteria that have been transformed.

Several teams showed that BBa_J04450 LacI promoter leaks. iGEM Grenoble 2017 highlights the role of IPTG, at least 180 minutes after induction. IPTG appeared to be important in the detection because it triggers a shorter rise of the fluorescence. As we know, it triggers the transcription of lac operon inducing the expression of the reporter gene.

So BBa_J04450 was chosen because this iGEM part enables users to produce mRFP1, a fluorophore which is an engineered mutant of red fluorescent protein from Discosoma striata. This reporter gene is LacI sensitive and can be induced with IPTG. This biobrick was chosen to be able to see fluorescence even if no IPTG was added or adding it to have a more rapid kinetic production.

2. Design of the probe detecting a fragment of P.A characterizing the lysis

The addition of the bioinformatically designed probe in pSB1C3-BBa_J04450 is done using the Gibson technic.

First of all, as a reminder, the DNA fragment to characterize the lysis is :

The probe has been imagined based on the system of Cork Ireland 2015 team and all the data furnished by New England Biolabs (NEB) website. It contains :

- Two restriction enzymes producing cohesive end, SphI and NgoMIV. Their goal is to remove the little sequence in between on the bottom strand. Thus creating a perfect complementarity with the target and linearizing the plasmid. But at the end, we trust that using PCR linearization could reduce the background of uncut plasmid.

- Two nicking enzymes, Nt.BspQ1 and Nb.BsmI, i.e. enzymes that cut one strand of the double-stranded DNA. Thereby, the top strand is removed, allowing the binding of the target.

3. Probe insertion in the psB1C3-BBa_J04450 plasmid - Creation of BBa_K2629000

3.1 Preparation of psB1C3-BBa_J04450

To be able to use the Gibson technic, we had to “prepare” the backbone we chose. To do so, we decided to linearize it by using primers for a PCR. The insertion is between the backbone prefix and the inducible promoter.

All the experiments were done by ordering sequences to Integrated DNA Technologies (IDT).

This GIF explains the PCR linearization step of the backbone.

Following the PCR, we decided to digest our product with DPN1. DPN1 only cleaves methylated DNA. As we know, PCR products are not methylated, so the enzyme would just cleave the circularize DNA and so reduce considerably the number of circular DNA plasmid. This is to reduce the number of false positives.

As we can see on this 1% agarose gel, DPN1 digestion we see that the non digested plasmid has a band at about 3000 bp but also lower bands. When digesting with DPN1, only one clear band can be observed at 3000 bp showing the reduction in the number of non-linearized plasmids.

3.2. Lysis insert amplification

When using the Gibson technic, DNA fragments contain 20 to 40 base pair overlap with adjacent DNA fragments [1]. Indeed, the technic uses portions of both fragments that are similar so that it fuses them together.

We first wanted to perform a PCR in order to add the overlap to the probe.

After the PCR amplification of the insert it was 143 nucleotides long, so we expected to see on the electrophoresis one band at approximately this size.

We can see on this electrophoresis for the negative control one strip under 100 nucleotides and for the condition “L” two strips, one at the same size and the other between 100 and 200 nucleotides. We assume that the strips under 100 nucleotides are the primers (approximately 40 nucleotides) and the strip between 100 and 200 nucleotides represent the insert amplification.

After the overlap addition, we carried out the Gibson technic in order to clone the probe in psB1C3-BBa_J04450.

3.3. Probe insertion

The cloning is performed thanks to the Gibson technic. Indeed, inserts with the overlap are added to the linearized vector and the Gibson Master Mix (this mix contain a 5' exonuclease, a polymerase and a ligase).

Followed this experiment, a colony PCR was done. But this experiment did not show an amplification of the insert in any of the colony we screened. Several hypotheses emerged to explain why the Gibson did not work even though we had pretty good results on the two experiments individually:

• the PCR to linearize pSB1C3-BBa_J04450 did not work
• the PCR to amplify the lysis insert and add the overlap did not work due to the annealing temperatures

After trying for a month to linearize the vector, amplify the insert with the overlap and use the Gibson technic without any results. We had to come up with another approach so we decided to design the insert already containing the overlaps and order it to IDT:

As the insert is not similar to the primers we had designed for the colony PCR anymore, we had to do a digestion of the DNA from the colony newly transformed with the new insert. The digestion is done using NgoM IV.

As we can see on this electrophoresis gel, after colony PCR, the undigested extractions have the 3 forms in which you can find plasmid DNA (circular, coiled and supercoiled). When it comes to the digested ones, we only see one band at around 3000 bp which shows that the plasmid has been linearized by the NgoMIV enzyme. We can conclude about the presence of the insert into our vector as NgoMIV restriction site was only present in the insert’s sequence.

The product obtained was kept to use it later for the probe activation process.

4. Probe activation

The first approach was to use 4 digestions as told before

4.1. By four digestions

As the insert contains :

• Two restriction enzymes producing cohesive ends, SphI and NgoMIV.

• Two nicking enzymes, Nt.BspQ1 and Nb.BsmI

The first approach was to use those enzymes in the activation process of our probe. Indeed, SphI and NgoMIV are used to create a perfect complementarity with the target and linearizing the plasmid. And use Nt.BspQ1 and Nb.BsmI to remove the top strand and allow the binding of the target.

However, we thought it would be better to use the PCR technic for the linearization because it could reduce the background of non-linearized plasmids.









4.2. By PCR linearization and two digestions

To use PCR for the linearization of our plasmid, we had to order primers to IDT:









Regarding the removal of the top DNA strand, we still use the Nt.BspQ1 and Nb.BsmI.

5. Detection of the target

5.1- Transformation tests

Following the activation of the probe by PCR linearization, the detection probes were cleaned up (PureLink Quick PCR Purification kit by Thermofisher Scientific) to eliminate the top strand fragment just removed from the plasmid. The yield following this experiment was very low so we were losing a lot of DNA. The efficiency of the detection probe was checked using design targets from IDT.

We did have colonies but not the results we expected, we decided to proceed on the sensibility measure in order to test different ratios probe/target.

5.2 - Confirmation by sequencing

In parallel of the experiments, we sent our newly designed probe to sequencing. Unfortunately, the insert was not found in the sequence when the alignment was done, the size was not the right one and the only thing that we could find was the sequence of BBa_J04450.

RESISTANCE

1. Plasmid backbone selection

When detecting a marker of a bacteria’s antibiotic resistance we decided to use a reporter gene: the Blue Fluorescence Protein (BFP). We found a biobrick, BBa_K592027, containing this reporter gene (BBa_K592100) in the iGEM backbones. However, the data on the biobrick showed better results in another backbone and needs more than 48h to be able to transcript the BFP. This is why we decided to create a new plasmid.

Indeed, we know the promoter, RBS and terminator of BBa_J04450 work well. So the RFP gene is replaced from psB1C3-BBa_J04450 by the BFP gene from the psB1C3-BBa_K592027. The experiment is explained later.









2. Design of the probe that detects a market of resistance of Pyo

The probe is bioinformatically designed using the same strategy as for the probe design.

First of all, as a reminder, here is the target to characterize the resistance:

5’ - ACCACCCGCACGGCGACATCGCGGTCTACAACACCATCGTGC - 3’

The probe has been thought based on the system of Cork Ireland 2015 team and all the data furnished by New England Biolabs (NEB) website. The probe contains :

• Two restriction enzymes, SphI and NgoMIV, whose goal is to remove the little sequence between on the bottom strand and thus create a perfect complementarity with the target. But at the end, we trust that using PCR linearization could reduce the background of uncut plasmids.
• Two nicking enzymes, Nt.BspQ1 and Nb.BssSI, which are enzymes that cut one strand of the double DNA strand. Thereby, the top strand is removed, allowing the target to bind.















3. Probe insertion in psB1C3- BBa_J04450

3.1. Creation of BBa_K2629001

3.1.1. Linearization of psB1C3-BBa_J04450

The first step is the linearization of the psB1C3-BBa_J04450 at a very specific place. To do so, a PCR is performed with specific primers.

In order to optimize the experiment, we decided to realize an enzymatic digestion with DPN1. DPN1 cleaves only when it's recognition methylated site. Knowing that PCR products are not methylated, it will reduce considerably the number of false positive.

For the continuation, the same lot as presented in Figure X was used.

3.1.2. Probe resistance insert amplification with the addition of the overlaps

Like the lysis insert, the Gibson technic is used in order to realize the cloning. Thanks to a PCR, overlaps were added to the insert that will enable it to fuse with the linearized plasmid. Indeed, the technic uses portions of both fragments that are similar so that it can fuse them together.

Let us remind you the probe of 93bp (172bp after the PCR) :









On the electrophoresis, we can see two strips for the negative control. One between 100 and 200 nucleotides and the other under 100. The strip under 100 nucleotides represent the primers for the PCR. However, the strip between 100 and 200 nucleotides should not be here. This is due to a contamination following a mishandling. For the “RI” condition, one strong strip is observed between 100 and 200 nucleotides. This represents the insert. Indeed, its size is 172 nucleotides.









The vector and insert are now ready for the Gibson!

3.1.3. Probe insertion/ Cloning of the probe into psB1C3-BBa_J04450

The cloning is performed using the Gibson technic. Indeed, we amplified the insert and prepared the linearized plasmid. For this Gibson a 1:5 ratio was used. A bacterial transformation was done after the Gibson. Following by a DNA extraction and finally, in order to make sure we inserted the recognition sequence, an enzymatic digestion was done with NgoMIV for which the restriction site is localized into the insert.









This electrophoresis was performed in order to confirm that the Gibson technic works. We can see for the conditions “CUD” and “CD” the same profile. Indeed, the plasmid doesn’t have NgoMIV restriction site and so the probe wasn’t inserted. Then, for the experimental conditions (1 to 3) we can observe, in the cases of digestion, one strip at 3000 bp. This is what we expected. In fact, by adding NgoMIV restriction site the enzyme cuts one time in the plasmid proving the insertion of the probe.

Thanks to these results, we can confirm that the BBa_K2629001 worked.









3.2. Creation of BBa_K2629003

After adding the resistance probe, the RFP gene of BBa_J04450 is substituted by the BFP gene of BBa_K592027.

3.2.1. BFP amplification

At first, a PCR amplification of the BFP was realized. To do so, psB1C3-BBa_K592027 was extracted from the plate. Then, the BFP gene (705bp) was amplified thanks to primers. The 16th figure describes the strategy for the BFP amplification.









We can see on this electrophoresis, for the negative control, one strip at approximately 700 bp. The strip should not be there, this might be due to a contamination following a mishandling. For the “BFP” condition, we can observe several strips and a strong one at approximately at 700bp. This represents the amplified BFP gene.









3.2.2. BBa_K2629001 linearization

After the insert’s amplification, we proceed with the linearization of the vector using a PCR. However, previously, several steps have been carried out.

• Linearization of the plasmid

• Knockout of the RFP gene into the psB1C3-BBa_J04450 plasmid

• Adding the overlap at the extremities for the Gibson









We can see on this electrophoresis for the negative control one strip under 100 nucleotides. This represents the primers used for the PCR. For the “JR” condition we can observe one strip at approximately 2000 bp. This strip is the BFP insert.

Now the vector and insert are ready for the Gibson.

3.2.3. Cloning of BFP gene into BBa_K2629001

The cloning is performed using the Gibson technic. Indeed, we amplified the insert and prepared the linearized plasmid. For this Gibson a 1:3 ratio was used. After, a transformation was done in order to realize a colony PCR to verify the success of the cloning.







We can see on this electrophoresis for the positive control one strip at approximately 700 bp. This is the amplified BFP gene. For the negative control, we can observe one strip at 700 too but it should not be here. This is probably a contamination. Regarding the CFU conditions, we can observe one strong strip at 700 bp. This is certainly the BFP gene.