Difference between revisions of "Team:OUC-China/Basic Part"

Revision as of 03:19, 17 October 2018

Team OUC-China: Main

Basic Parts

Part number	Type	Description	Designer	Length（bp）
BBa_K2615020	Regulatory	MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4.	Yunqian Zhang	68
BBa_K2615013	Coding	Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.	Yunqian Zhang	564
BBa_K2615014	Coding	Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.	Anyi Li	564
BBa_K2615015	Coding	Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.	Anyi Li	564
BBa_K2615016	Coding	Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin.	Anyi Li	564
BBa_K2615021	Regulatory	MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT.	Anyi Li	74
BBa_K2615022	Regulatory	MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT.	Anyi Li	74
BBa_K2615023	Regulatory	MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT.	Anyi Li	74
BBa_K2615024	Regulatory	MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT.	Anyi Li	74
BBa_K2615025	Regulatory	MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT.	Yunqian Zhang	74

@@ Line 161: / Line 161: @@
 <p align="justify">
+<div id="class" align="center" style= "margin: 0cm 0cm 0pt; text-align: left">
 	<table width="200" border="1">
    <tbody>