Difference between revisions of "Team:BioIQS-Barcelona/Standardization"

Line 59: Line 59:
  
 
     table {
 
     table {
     border: 1px solid #ccc !important;
+
     /*border: 1px solid #ccc !important;*/
 
     width: 100% !important;
 
     width: 100% !important;
 
     margin:0 !important;
 
     margin:0 !important;
Line 68: Line 68:
  
 
   table tr {
 
   table tr {
     border: 1px solid #ddd !important;
+
     /*border: 1px solid #ddd !important;*/
 
     padding: 5px !important;
 
     padding: 5px !important;
background: #fff !important;  
+
/*background: #fff;*/
 
     }
 
     }
  
Line 85: Line 85:
 
   @media screen and (max-width: 600px){
 
   @media screen and (max-width: 600px){
  
  #card table {
+
    .taulacarta table {
 
       border: 0 !important;
 
       border: 0 !important;
 
     }
 
     }
  
  #card table thead {
+
    .taulacarta table thead {
 
       display: none !important;
 
       display: none !important;
 
     }
 
     }
  
  #card table tr {
+
    .taulacarta table tr {
 
       margin-bottom: 20px !important;
 
       margin-bottom: 20px !important;
 
       display: block !important;
 
       display: block !important;
 
       border-bottom: 2px solid #ddd !important;
 
       border-bottom: 2px solid #ddd !important;
box-shadow: 2px 2px 1px #dadada !important;
+
  box-shadow: 2px 2px 1px #dadada !important;
 
     }
 
     }
  
  #card table td {
+
    .taulacarta table td {
 
       display: block !important;
 
       display: block !important;
 
       text-align: right !important;
 
       text-align: right !important;
Line 106: Line 106:
 
     }
 
     }
  
   #card table td:last-child {
+
   #taulacarta table td:last-child {
 
       border-bottom: 0 !important;
 
       border-bottom: 0 !important;
 
     }
 
     }
  
  #card table td::before {
+
    .taulacarta table td::before {
 
       content: attr(data-label) !important;
 
       content: attr(data-label) !important;
 
       float: left !important;
 
       float: left !important;
Line 116: Line 116:
 
       font-weight: bold !important;
 
       font-weight: bold !important;
 
     }
 
     }
    #card tbody{
+
    .taulacarta tbody{
line-height:0!important !important;
+
line-height:0!important;
 
}
 
}
  
Line 197: Line 197:
 
                                 </div>
 
                                 </div>
 
                             </div>
 
                             </div>
 
+
                        <div class="taulacarta">
 
                             <table class="table book text-b">
 
                             <table class="table book text-b">
 
                                 <thead class="orange-intense">
 
                                 <thead class="orange-intense">
Line 210: Line 210:
 
                                 <tbody class="orange-medium">
 
                                 <tbody class="orange-medium">
 
                                     <tr>
 
                                     <tr>
                                         <td>P1</td>
+
                                         <td data-label="Primer">P1</td>
                                         <td>A</td>
+
                                         <td data-label="Chain">A</td>
                                         <td>2 (5’->3’)</td>
+
                                         <td data-label="Exon">2 (5’->3’)</td>
                                         <td>4643-4664 bp</td>
+
                                         <td data-label="Genomic Location*">4643-4664 bp</td>
                                         <td>22</td>
+
                                         <td data-label="Length (bp)**">22</td>
 
                                     </tr>
 
                                     </tr>
 
                                     <tr>
 
                                     <tr>
                                         <td>P2</td>
+
                                         <td data-label="Primer">P2</td>
                                         <td>A</td>
+
                                         <td data-label="Chain">A</td>
                                         <td>2 (3’->5’)</td>
+
                                         <td data-label="Exon">2 (3’->5’)</td>
                                         <td>4867-4889 bp</td>
+
                                         <td data-label="Genomic Location*">4867-4889 bp</td>
                                         <td>23</td>
+
                                         <td data-label="Length (bp)**">23</td>
 
                                     </tr>
 
                                     </tr>
 
                                     <tr>
 
                                     <tr>
                                         <td>P3</td>
+
                                         <td data-label="Primer">P3</td>
                                         <td>A</td>
+
                                         <td data-label="Chain">A</td>
                                         <td>3 (5’->3’)</td>
+
                                         <td data-label="Exon">3 (5’->3’)</td>
                                         <td>5302-5326 bp</td>
+
                                         <td data-label="Genomic Location*">5302-5326 bp</td>
                                         <td>25</td>
+
                                         <td data-label="Length (bp)**">25</td>
 
                                     </tr>
 
                                     </tr>
 
                                     <tr>
 
                                     <tr>
                                         <td>P4</td>
+
                                         <td data-label="Primer">P4</td>
                                         <td>A</td>
+
                                         <td data-label="Chain">A</td>
                                         <td>3 (3’->5’)</td>
+
                                         <td data-label="Exon">3 (3’->5’)</td>
                                         <td>5561-5583 bp</td>
+
                                         <td data-label="Genomic Location*">5561-5583 bp</td>
                                         <td>23</td>
+
                                         <td data-label="Length (bp)**">23</td>
 
                                     </tr>
 
                                     </tr>
 
                                     <tr>
 
                                     <tr>
                                         <td>P1'</td>
+
                                         <td data-label="Primer">P1'</td>
                                         <td>B</td>
+
                                         <td data-label="Chain">B</td>
                                         <td>2 (5’->3’)</td>
+
                                         <td data-label="Exon">2 (5’->3’)</td>
                                         <td>2072-2097 bp</td>
+
                                         <td data-label="Genomic Location*">2072-2097 bp</td>
                                         <td>26</td>
+
                                         <td data-label="Length (bp)**">26</td>
 
                                     </tr>
 
                                     </tr>
 
                                     <tr>
 
                                     <tr>
                                         <td>P2'</td>
+
                                         <td data-label="Primer">P2'</td>
                                         <td>B</td>
+
                                         <td data-label="Chain">B</td>
                                         <td>2 (3’->5’)</td>
+
                                         <td data-label="Exon">2 (3’->5’)</td>
                                         <td>2436-2456 bp</td>
+
                                         <td data-label="Genomic Location*">2436-2456 bp</td>
                                         <td>21</td>
+
                                         <td data-label="Length (bp)**">21</td>
 
                                     </tr>
 
                                     </tr>
 
                                     <tr>
 
                                     <tr>
                                         <td>P3'</td>
+
                                         <td data-label="Primer">P3'</td>
                                         <td>B</td>
+
                                         <td data-label="Chain">B</td>
                                         <td>3 (5’->3’)</td>
+
                                         <td data-label="Exon">3 (5’->3’)</td>
                                         <td>5199-5226 bp</td>
+
                                         <td data-label="Genomic Location*">5199-5226 bp</td>
                                         <td>28</td>
+
                                         <td data-label="Length (bp)**">28</td>
 
                                     </tr>
 
                                     </tr>
 
                                     <tr>
 
                                     <tr>
                                         <td>P4'</td>
+
                                         <td data-label="Primer">P4'</td>
                                         <td>B</td>
+
                                         <td data-label="Chain">B</td>
                                         <td>3 (3’->5’)</td>
+
                                         <td data-label="Exon">3 (3’->5’)</td>
                                         <td>5504-5527 bp</td>
+
                                         <td data-label="Genomic Location*">5504-5527 bp</td>
                                         <td>24</td>
+
                                         <td data-label="Length (bp)**">24</td>
 
                                     </tr>
 
                                     </tr>
 
                                 </tbody>
 
                                 </tbody>
 
                             </table>
 
                             </table>
 +
                        </div>
 
                             <p class="book orange-medium n-p"><small>* All genomic locations are referred to the HLA DQA1*05:01:01:01 and DQB1*02:01:01, chain A and B respectively.</small></p>
 
                             <p class="book orange-medium n-p"><small>* All genomic locations are referred to the HLA DQA1*05:01:01:01 and DQB1*02:01:01, chain A and B respectively.</small></p>
 
                             <p class="book orange-medium n-p"><small>** Complementary primer overhangs are not taken into account for the analysis.</small></p>
 
                             <p class="book orange-medium n-p"><small>** Complementary primer overhangs are not taken into account for the analysis.</small></p>
Line 306: Line 307:
 
                         </div>
 
                         </div>
 
                     </div>
 
                     </div>
 
+
                <div class="taulacarta">
 
                     <table class="table book text-b">
 
                     <table class="table book text-b">
 
                         <tbody class="orange-medium">
 
                         <tbody class="orange-medium">
Line 317: Line 318:
 
                             </tr>
 
                             </tr>
 
                             <tr>
 
                             <tr>
                                 <th class="orange-intense">DQA1</th>
+
                                 <th data-label="" class="orange-intense">DQA1</th>
                                 <td>73</td>
+
                                 <td data-label="Download Sequences">73</td>
                                 <td>14</td>
+
                                 <td data-label="DQ2">14</td>
                                 <td>7</td>
+
                                 <td data-label="DQ8">7</td>
 
                             </tr>
 
                             </tr>
 
                             <tr>
 
                             <tr>
                                 <th class="orange-intense">DQB1</th>
+
                                 <th cdata-label="" lass="orange-intense">DQB1</th>
                                 <td>198</td>
+
                                 <td data-label="Download Sequences">198</td>
                                 <td>6</td>
+
                                 <td data-label="DQ2">6</td>
                                 <td>13</td>
+
                                 <td data-label="DQ8">13</td>
 
                             </tr>
 
                             </tr>
 
                         </tbody>
 
                         </tbody>
 
                     </table>
 
                     </table>
 +
                </div>
 
                     <div class="row block-desc">
 
                     <div class="row block-desc">
 
                         <div class="col-md-12 mx-auto">
 
                         <div class="col-md-12 mx-auto">
Line 339: Line 341:
 
                         </div>
 
                         </div>
 
                     </div>
 
                     </div>
                     <div id="card">
+
                     <div class="taulacarta">
 
                     <table class="table book text-b">
 
                     <table class="table book text-b">
 
                                 <thead class="orange-intense">
 
                                 <thead class="orange-intense">
Line 409: Line 411:
 
                                 </tbody>
 
                                 </tbody>
 
                             </table>
 
                             </table>
</div>
+
                        </div>
 
                         <p class="orange book">For P3’ primer, a two-base deletion is reported as <b>refSNP Cluster Report: rs756895762</b>. Therfore, this is the only primer that needs special attention, as it could compromise the capability to amplify the HLA-DQ genes by PCR of all possible celiac disease involved HLA-DQ genotypes.</p>
 
                         <p class="orange book">For P3’ primer, a two-base deletion is reported as <b>refSNP Cluster Report: rs756895762</b>. Therfore, this is the only primer that needs special attention, as it could compromise the capability to amplify the HLA-DQ genes by PCR of all possible celiac disease involved HLA-DQ genotypes.</p>
 
                         <div class="image">
 
                         <div class="image">

Revision as of 00:00, 11 December 2018

BIO IQS

Dry Lab | PCR Standardization

Have a look!

First steps

The first step to develop our sensor is to amplify, express and effectively obtain the HLA-DQ heterodimer (chains α and β) from the patient's DNA, regardless of the CD-haplotype of the patient (either DQ2 or DQ8).

Based on former studies, only the exons 2 and 3 from each chain codify for the extracellular domain of the HLA-DQ that interacts with the reactive gluten epitopes. With this in mind, we designed a robust model for the extraction of the α and β chains of the HLA-DQ from the genomic DNA of a celiac patient. A set of primers were designed to conduct 3 different PCR steps (in a total of 10 reactions) to obtain the α- and β-chains flanked with restriction sites for further cloning.

Therefore, we designed 8 specific primers (forward and reverse) to amplify the exons 2 and 3 of each chain. The nomenclature is as follows: P1 to P4 for the α-chain and P1’ to P4’ for the β-chain.

Primer Chain Exon Genomic Location* Length (bp)**
P1 A 2 (5’->3’) 4643-4664 bp 22
P2 A 2 (3’->5’) 4867-4889 bp 23
P3 A 3 (5’->3’) 5302-5326 bp 25
P4 A 3 (3’->5’) 5561-5583 bp 23
P1' B 2 (5’->3’) 2072-2097 bp 26
P2' B 2 (3’->5’) 2436-2456 bp 21
P3' B 3 (5’->3’) 5199-5226 bp 28
P4' B 3 (3’->5’) 5504-5527 bp 24

* All genomic locations are referred to the HLA DQA1*05:01:01:01 and DQB1*02:01:01, chain A and B respectively.

** Complementary primer overhangs are not taken into account for the analysis.

Since we started the project focusing on expressing HLA-DQ from Roger’s DNA sample, primers were designed accordingly to his HLA-DQ haplotype, which is DQ2 (HLA DQA1*05:01:01:01 and DQB1*02:01:01). Remember that, for celiac disease, the haplotype nomenclature is as follows:

DQ2-positive

(HLA-DQA1*05:01 or *05:05 and HLA-DQB1*02:01 or *02:02)

Half DQ2-positive

(HLA-DQA1*05:01 or 05:05 or HLA-DQB1*02:01 or 02:02)

DQ8-positive

(HLA-DQA1*03 and HLA-DQB1*03:02)

In order to elucidate if the designed primers are capable of amplifying every CD-associated genotype, a multiple sequence alignment (MSA) was performed to evaluate genetic variability at primer regions.

Genomic HLA-DQ sequences (DQA1_gen.fasta and DQB1_gen.fasta) were downloaded from IPD-IMGT/HLA (Directory hosted at the European Bioinformatics Institute) version 3.33.0. Then, the genomic sequences were curated for DQ2 and DQ8 haplotypes.

Download Sequences DQ2 DQ8
DQA1 73 14 7
DQB1 198 6 13

Genomic MSA surprisingly resulted on a perfect alignment for sequences sharing CD-DQ haplotypes. This means that, for primer regions, all DQ2-associated sequences match perfectly and the same happens on DQ8. Moreover, for P2, P3, P1’ and P4’, primer region alignment is perfect and so, there is no need to edit the standard primers.

* Hidden Markov Model of P1 genomic primer region curated for DQ2 and DQ8 genotypes. In this case, there are only 3 differing bases among primer region. Since 14 DQ2 and 6 DQ8 sequences were aligned, dominant residues are those corresponding to DQ2 genotypes. DQ2 sequences presents C-C-T and DQ8 presents T-T-C.

Primer Exon Total seq. DQ2 DQ8
P1 2 (5’->3’) 21 GCTGACCACGTCGCCTCTTATG GCTGACCATGTTGCCTCTTACG
P2 2 (3’->5’) 21 CATTGGTAGCAGCGGTAGAGTTG CATTGGTAGCAGCGGTAGAGTTG
P3 3 (5’->3’) 21 AGGTTCCTGAGGTCACAGTGTTTTC AGGTTCCTGAGGTCACAGTGTTTTC
P4 3 (3’->5’) 21 CCCAGTGTTTCAGAAGAGGCTTG CCCAGTGTTTCAGAAGAGGCTCA
P1' 2 (5’->3’) 19 GAGGATTTCGTGTACCAGTTTAAGGG GAGGATTTCGTGTACCAGTTTAAGGG
P2' 2 (3’->5’) 19 TCCTCTGGGGTGGAACAAACG TCAGCCGGGGTGGAACGAACA
P3' 3 (5’->3’) 19 CCTATATCTTTCCCTGTCTGTTACTGCC CC--TATCTTTCCCTGTCTGTTACTGCC
P4' 3 (3’->5’) 19 CAATATCCCCTTACGCCACTCCAC CAATATCCCCTTACGCCACTCCAC

For P3’ primer, a two-base deletion is reported as refSNP Cluster Report: rs756895762. Therfore, this is the only primer that needs special attention, as it could compromise the capability to amplify the HLA-DQ genes by PCR of all possible celiac disease involved HLA-DQ genotypes.

This are the Hidden Markov Models that represent the sequence conservation for the region complementary to each primer. For the α chain, the dominant bases correspond to DQ2, while for the β chain, the dominant bases correspond to DQ8.