(Prototype team page) |
SAKANAhuman (Talk | contribs) |
||
Line 1: | Line 1: | ||
{{Kyoto}} | {{Kyoto}} | ||
+ | {{Kyoto/header}} | ||
<html> | <html> | ||
+ | <style type="text/css"> | ||
+ | ul.material { | ||
+ | margin-left:10%; | ||
+ | margin-right:10%; | ||
+ | list-style:none; | ||
+ | text-align:left; | ||
+ | font-family: serif, 'Times New Roman'; | ||
+ | font-size:150%; | ||
+ | } | ||
+ | ul.material ul{ | ||
+ | list-style:none; | ||
+ | } | ||
+ | .material > p { | ||
+ | word-wrap:break-word; | ||
+ | } | ||
+ | table{ | ||
+ | color:#000000; | ||
+ | border-collapse:collapse; | ||
+ | border-left:1px solid #000000; | ||
+ | border-top:1px solid #000000; | ||
+ | margin-top:30px; | ||
+ | width:95%; | ||
+ | table-layout:fixed; | ||
+ | } | ||
− | + | th{ | |
+ | border-right:1px solid #ffffff; | ||
+ | border-bottom:1px solid #ffffff; | ||
+ | background-color:#556c14; | ||
+ | color:#ffffff; | ||
+ | } | ||
− | + | td{ | |
− | + | border-right:1px solid #000000; | |
+ | border-bottom:1px solid #000000; | ||
+ | word-wrap:break-word; | ||
+ | } | ||
+ | p{font-size:100%;} | ||
+ | td.pcr{border-left:0; | ||
+ | border-top:0; | ||
+ | background-color:#e8f0d2;} | ||
+ | #jump{ | ||
+ | position:fixed; | ||
+ | bottom:10%; | ||
+ | right:7%; | ||
+ | width:9%; | ||
+ | } | ||
+ | #jump img{ | ||
+ | width:100%; | ||
+ | } | ||
− | < | + | </style> |
+ | |||
+ | <body> | ||
+ | <div id="jump"><a href="#wrapper"><img src="https://static.igem.org/mediawiki/2017/c/c5/Kyoto_notebook_jump.png"></a></div> | ||
+ | <div id="BACKGROUND"> | ||
+ | <div id="wrapper"> | ||
+ | <h1>Material&Methods</h1> | ||
+ | <ul class="material"> | ||
+ | <li><a href="#Parts">1) Parts</a></li> | ||
+ | <li><a href="#Primer">2) Primer list</a></li> | ||
+ | <li><a href="#Materials">3) Materials</a></li> | ||
+ | <ul> | ||
+ | <li><a href="#Kit">3-1 Kit</a></li> | ||
+ | <li><a href="#Restriction Enzyme">3-2 Restriction Enzyme</a></li> | ||
+ | <li><a href="#Polymerase">3-3 Polymerase</a></li> | ||
+ | <li><a href="#DNA ligase">3-4 DNA ligase</a></li> | ||
+ | <li><a href="#Marker">3-5 Marker</a></li> | ||
+ | <li><a href="#Organism">3-6 Organism</a></li> | ||
+ | <li><a href="#Antibiotics">3-7 Antibiotics</a></li> | ||
+ | <li><a href="#Equipment">3-8 Equipment</a></li> | ||
+ | <li><a href="#Backbone">3-9 Backbone</a></li> | ||
+ | <li><a href="#Buffer">3-10 Buffer</a></li> | ||
+ | <li><a href="#SDS-PAGE&Westernblotting">3-11 SDS-PAGE&Westernblotting</a></li> | ||
+ | <!--------------------------------------------------------- BLOCK Contents-2 Materials END-----------------------------------------------------------> | ||
+ | </ul> | ||
+ | |||
+ | <li><a href="#methods">4) Methods</a></li> | ||
+ | <ul> | ||
− | </ | + | <!--------------------------------------------------------- BLOCK Contents-3 Methods PY------------------------------------------------------------> |
+ | <li><a href="#Miniprep">4-1 Miniprep</a></li> | ||
+ | <li><a href="#Gel Extraction and PCR purification">4-2 Gel Extraction and PCR purification</a></li> | ||
+ | <li><a href="#Restriction Enzyme Digestion">4-3 Restriction Enzyme Digestion</a></li> | ||
+ | <li><a href="#Ligation">4-4 Ligation</a></li> | ||
+ | <li><a href="#Transformation">4-5 Transformation</a></li> | ||
+ | <!--------------------------------------------------------- BLOCK Contents-3 Methods END------------------------------------------------------------> | ||
+ | </ul> | ||
+ | </ul> | ||
+ | <!-- ###################################################### BLOCK Contents END #################################################--> | ||
− | |||
− | |||
− | < | + | <!-----------------------------------------------------BLOCK Parts--------------------------------------------------------------> |
+ | <h5 id="Parts">1) Parts</h5> | ||
+ | <h6><a href="https://2017.igem.org/Team:Kyoto/Basic_Part" target="brank">Basic Parts</a></h6> | ||
+ | <h6><a href="https://2017.igem.org/Team:Kyoto/Composite_Part" target="brank">Composite Parts</a></h6> | ||
+ | <!-----------------------------------------------------BLOCK Parts END----------------------------------------------------------> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | <div class=" | + | <!------------------------------------------------------BLOCK primer PY----------------------------------------------------------> |
− | < | + | <!-- Table Generated by TableMaker.py Author: OHAD --> |
+ | <h5 id = "Primer">2) Primer List</h5> | ||
+ | <div class="example"> | ||
+ | <table width="20px"> | ||
+ | <tr><th>primer name</th><th class="example" width=40%>sequence</th><th width=8%>Length</th><th width=5%>Tm</th><th width=8%>GC%</th><th width=10%>Designer</th><th>Manufacturer</th></tr><tr><td>tropomyosinF</td><td>GATCGAGAAGGACAACGCCC</td><td>20</td><td>65</td><td>60</td><td>Fukuda</td><td>Macrogen Japan Corp</td></tr><tr><td>IK107</td><td>cccgccgccaccatggaggcggccgcaaaatcagg</td><td>35</td><td>94</td><td>71</td><td>Yoshimoto</td><td>Macrogen Japan Corp</td></tr></table> | ||
+ | </div> <!-- Table end --> | ||
+ | |||
+ | <!------------------------------------------------------BLOCK primer.py END----------------------------------------------------------> | ||
+ | |||
+ | |||
+ | |||
+ | <h5 id="Materials">3) Materials</h5> | ||
+ | |||
+ | <!------------------------------------------------------BLOCK TableMaker PY------------------------------------------------------><!-- Table Generated by TableMaker.py Author: OHAD --> | ||
+ | <h6 id = "Kit">3-1 Kit</h6> | ||
+ | <table> | ||
+ | <tr><th>Name</th><th>Supplier</th></tr><tr><td>Wizard® SV Gel and PCR</td><td>Promega</td></tr><tr><td>FastGene™Plasmid Mini Kit</td><td>NIPPON Genetics Co.,Ltd</td></tr> | ||
+ | </table> | ||
+ | <!-- Table end --> | ||
+ | <!------------------------------------------------------BLOCK TableMaker.py END------------------------------------------------------> | ||
+ | |||
+ | |||
+ | <h5 id="methods">4) Methods</h5> | ||
+ | <!------------------------------------------------------BLOCK Methods PY----------------------------------------------------------------> | ||
+ | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | ||
+ | <h6 id = "Miniprep">4-1 Miniprep</h6> | ||
+ | <p> | ||
+ | Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols. | ||
+ | </p> | ||
+ | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | ||
+ | |||
+ | <!-- ##############The below part of block is Generated by Methods.py Author: OHAD################# --> | ||
+ | <h6 id = "Soaking">4-17 Soaking</h6> | ||
+ | <p>We followed this paper as for soaking.<br> | ||
+ | <a href="https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf">https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf</a></p> | ||
+ | </ol> | ||
+ | <br> | ||
+ | <br> | ||
+ | <!-- ~~~~~~~~~~~~~Part END~~~~~~~~~~~~~~ --> | ||
+ | |||
+ | <!------------------------------------------------------BLOCK Methods.py END -----------------------------------------------------------> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | </p> | ||
+ | <!-- | ||
+ | NewPP limit report | ||
+ | CPU time usage: 0.007 seconds | ||
+ | Real time usage: 0.007 seconds | ||
+ | Preprocessor visited node count: 9/1000000 | ||
+ | Preprocessor generated node count: 42/1000000 | ||
+ | Post‐expand include size: 41/2097152 bytes | ||
+ | Template argument size: 0/2097152 bytes | ||
+ | Highest expansion depth: 2/40 | ||
+ | Expensive parser function count: 0/100 | ||
+ | --> | ||
+ | |||
+ | <!-- Saved in parser cache with key 2017_igem_org:pcache:idhash:1170-0!*!*!*!*!*!* and timestamp 20171027171725 and revision id 271514 | ||
+ | --> | ||
+ | </div> <div class="visualClear"></div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | |||
+ | <!-- Side Menubar --> | ||
+ | <div id="sideMenu"> | ||
+ | <a href="https://2017.igem.org"> | ||
+ | <div id="home_logo" > | ||
+ | <img src="https://static.igem.org/mediawiki/2017/b/bf/HQ_menu_logo.jpg"> | ||
+ | </div> | ||
+ | </a> | ||
− | < | + | <div style="clear:both; height:5px;"></div> |
+ | <div id="menuDisplay"></div> <!- Menu will be loaded here -> | ||
+ | </div> | ||
− | < | + | <!-- Pop_Why Div is definded here --> |
+ | <div class="pop_why_cover"></div> | ||
− | < | + | <div class="pop_why_box" > |
− | </div> | + | <div class="pop_close">× </div> |
+ | <div class="pop_why_content"><h3> Loading ... </h3></div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </body> | ||
</html> | </html> |
Revision as of 08:02, 2 October 2018
Material&Methods
- 1) Parts
- 2) Primer list
- 3) Materials
- 3-1 Kit
- 3-2 Restriction Enzyme
- 3-3 Polymerase
- 3-4 DNA ligase
- 3-5 Marker
- 3-6 Organism
- 3-7 Antibiotics
- 3-8 Equipment
- 3-9 Backbone
- 3-10 Buffer
- 3-11 SDS-PAGE&Westernblotting
- 4) Methods
1) Parts
Basic Parts
Composite Parts
2) Primer List
primer name | sequence | Length | Tm | GC% | Designer | Manufacturer |
---|---|---|---|---|---|---|
tropomyosinF | GATCGAGAAGGACAACGCCC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
IK107 | cccgccgccaccatggaggcggccgcaaaatcagg | 35 | 94 | 71 | Yoshimoto | Macrogen Japan Corp |
3) Materials
3-1 Kit
Name | Supplier |
---|---|
Wizard® SV Gel and PCR | Promega |
FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
4) Methods
4-1 Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
4-17 Soaking
We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf