Difference between revisions of "Team:Kyoto/Safety"
SAKANAhuman (Talk | contribs) |
SAKANAhuman (Talk | contribs) |
||
| Line 60: | Line 60: | ||
<div id="BACKGROUND"> | <div id="BACKGROUND"> | ||
<div id="wrapper"> | <div id="wrapper"> | ||
| − | <h1> | + | <h1>Safety</h1> |
<ul class="material"> | <ul class="material"> | ||
<li><a href="#Parts">1) Parts</a></li> | <li><a href="#Parts">1) Parts</a></li> | ||
Revision as of 08:02, 2 October 2018
Safety
- 1) Parts
- 2) Primer list
- 3) Materials
- 3-1 Kit
- 3-2 Restriction Enzyme
- 3-3 Polymerase
- 3-4 DNA ligase
- 3-5 Marker
- 3-6 Organism
- 3-7 Antibiotics
- 3-8 Equipment
- 3-9 Backbone
- 3-10 Buffer
- 3-11 SDS-PAGE&Westernblotting
- 4) Methods
1) Parts
Basic Parts
Composite Parts
2) Primer List
| primer name | sequence | Length | Tm | GC% | Designer | Manufacturer |
|---|---|---|---|---|---|---|
| tropomyosinF | GATCGAGAAGGACAACGCCC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
| IK107 | cccgccgccaccatggaggcggccgcaaaatcagg | 35 | 94 | 71 | Yoshimoto | Macrogen Japan Corp |
3) Materials
3-1 Kit
| Name | Supplier |
|---|---|
| Wizard® SV Gel and PCR | Promega |
| FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
4) Methods
4-1 Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
4-17 Soaking
We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf
