Difference between revisions of "Team:Kyoto/Safety"
SAKANAhuman (Talk | contribs) |
SAKANAhuman (Talk | contribs) |
||
| Line 73: | Line 73: | ||
<br><br><br><br><br><br><br><br> | <br><br><br><br><br><br><br><br> | ||
| − | <!-----------------------------------------------------BLOCK | + | <!-----------------------------------------------------BLOCK Safe project design--------------------------------------------------------------> |
| − | <h5 id=" | + | <h5 id="Safe project design">1) Safe project design</h5> |
<h6><a href="https://2017.igem.org/Team:Kyoto/Basic_Part" target="brank">Basic Parts</a></h6> | <h6><a href="https://2017.igem.org/Team:Kyoto/Basic_Part" target="brank">Basic Parts</a></h6> | ||
<h6><a href="https://2017.igem.org/Team:Kyoto/Composite_Part" target="brank">Composite Parts</a></h6> | <h6><a href="https://2017.igem.org/Team:Kyoto/Composite_Part" target="brank">Composite Parts</a></h6> | ||
| − | <!-----------------------------------------------------BLOCK | + | <!-----------------------------------------------------BLOCK Safe project design END----------------------------------------------------------> |
| − | <!------------------------------------------------------BLOCK | + | <!------------------------------------------------------BLOCK Safe lab work PY----------------------------------------------------------> |
<!-- Table Generated by TableMaker.py Author: OHAD --> | <!-- Table Generated by TableMaker.py Author: OHAD --> | ||
| − | <h5 id = " | + | <h5 id = "Safe lab work">2) Safe lab work</h5> |
<div class="example"> | <div class="example"> | ||
<table width="20px"> | <table width="20px"> | ||
| Line 89: | Line 89: | ||
</div> <!-- Table end --> | </div> <!-- Table end --> | ||
| − | <!------------------------------------------------------BLOCK | + | <!------------------------------------------------------BLOCK Safe lab work END----------------------------------------------------------> |
Revision as of 08:12, 2 October 2018
Safety
1) Safe project design
Basic Parts
Composite Parts
2) Safe lab work
| primer name | sequence | Length | Tm | GC% | Designer | Manufacturer |
|---|---|---|---|---|---|---|
| tropomyosinF | GATCGAGAAGGACAACGCCC | 20 | 65 | 60 | Fukuda | Macrogen Japan Corp |
| IK107 | cccgccgccaccatggaggcggccgcaaaatcagg | 35 | 94 | 71 | Yoshimoto | Macrogen Japan Corp |
3) Materials
3-1 Kit
| Name | Supplier |
|---|---|
| Wizard® SV Gel and PCR | Promega |
| FastGene™Plasmid Mini Kit | NIPPON Genetics Co.,Ltd |
4) Methods
4-1 Miniprep
Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.
4-17 Soaking
We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf
