|
|
Line 245: |
Line 245: |
| | | |
| <h4><a href="#Introduction">Introduction</a></h4> | | <h4><a href="#Introduction">Introduction</a></h4> |
− |
| |
| <h4><a href="#Method">Method</a></h4> | | <h4><a href="#Method">Method</a></h4> |
− | <h4>Results</h4>
| |
− | <ul>
| |
− | <li><a href="#sequencing">Sequencing</a></li>
| |
− | <li><a href="#data">Data</a></li>
| |
− | </ul>
| |
− | <h4>Discussion</h4>
| |
| </div> | | </div> |
− | </div> | + | </div |
− | | + | </div> |
− |
| + | |
− | </div> | + | |
− |
| + | |
− | | + | |
| <div class="nine columns texttext"> | | <div class="nine columns texttext"> |
| <a id = "Introduction"></a> | | <a id = "Introduction"></a> |
Line 272: |
Line 261: |
| </p> | | </p> |
| <br> | | <br> |
− |
| |
− |
| |
− |
| |
| <a id = "Method"></a> | | <a id = "Method"></a> |
| <div class="texttitle">Method</div> | | <div class="texttitle">Method</div> |
Line 301: |
Line 287: |
| <p>Secondly, the cell cultures were diluted to the concentration of Abs600=0.02 for target start and were transferred to the same LB medium of 12mL in 50mL falcon tubes, at the same incubator above. At the time of 0 and 6 hours of incubation, we took off 500μL into 1.5 ml eppendorf tubes of each colony of 8 devices, and placed them on ice to prevent from further growth.</p> | | <p>Secondly, the cell cultures were diluted to the concentration of Abs600=0.02 for target start and were transferred to the same LB medium of 12mL in 50mL falcon tubes, at the same incubator above. At the time of 0 and 6 hours of incubation, we took off 500μL into 1.5 ml eppendorf tubes of each colony of 8 devices, and placed them on ice to prevent from further growth.</p> |
| <p>Last but most importantly, we pipetted 4 replicates samples of each devices, 100μL per well, into a 96-well plate. Samples were laid out according to the plate diagram shown in the protocol.</p> | | <p>Last but most importantly, we pipetted 4 replicates samples of each devices, 100μL per well, into a 96-well plate. Samples were laid out according to the plate diagram shown in the protocol.</p> |
− |
| |
− | <a id="sequencing"></a>
| |
− | <br>
| |
− | <div class="texttitle">Results</div>
| |
− | <h3 class="classic-title";"><span>Sequencing</span></h3>
| |
− | <p> • Device 1: J23101+I13504<br>
| |
− | • Device 2: J23106+I13504<br>
| |
− | • Device 3: J23117+I13504<br>
| |
− | • Positive Control Device: I20270 in pSB1C3<br>
| |
− | • Negative Control Device: R0040 in pSB1C3 </p>
| |
− | <p>
| |
− | >BBa_J23101 Part-only sequence (35 bp)<br>
| |
− | <span style="padding-left:45px">Tttacagctagctcagtcctaggtattatgctagc</span></p><p>
| |
− | >BBa_J23106 Part-only sequence (35 bp)<br>
| |
− | <span style="padding-left:45px">Tttacggctagctcagtcctaggtatagtgctagc</span></p><p>
| |
− | >BBa_J23117 Part-only sequence (35 bp)<br>
| |
− | <span style="padding-left:45px">Ttgacagctagctcagtcctagggattgtgctagc</span></p><p>
| |
− | >BBa_I13504 Part-only sequence (875 bp)<br>
| |
− | <span style="padding-left:45px">Aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata</span></p><p>
| |
− | >BBa_I20270 Part-only sequence (919 bp)<br>
| |
− | <span style="padding-left:45px">Ttgatggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata</span></p><p>
| |
− | >BBa_R0040 Part-only sequence (54 bp)<br>
| |
− | <span style="padding-left:45px">tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac</span>
| |
− | </p></p>
| |
− |
| |
− | <a id="data"></a>
| |
− | <h3 class="classic-title";"><span>Data</span></h3>
| |
− | <h4>OD600 Reference Point</h4>
| |
− | <p><b>Table 1. OD600 Reference Point.</b></p>
| |
− | <img src="https://static.igem.org/mediawiki/2016/f/f4/T--Peking--image_interlab_3.png">
| |
− | <br>
| |
− | <h4>FITC Standard Curve</h4>
| |
− | <p ><b>Table 2. Data of FITC standard curve.</b></p>
| |
− | <img src="https://static.igem.org/mediawiki/2016/1/1b/T--Peking--image_interlab_4.png">
| |
− | <img src="https://static.igem.org/mediawiki/2016/0/03/T--Peking--image_interlab_5.png">
| |
− | <p ><b>Figure 2. FITC standard curve.</b></p>
| |
− | <br>
| |
− | <h4>Normalization</h4>
| |
− | <p ><b>Table 3. Normalization.</b></p>
| |
− | <img src="https://static.igem.org/mediawiki/2016/d/db/T--Peking--image_interlab_6.png">
| |
− | <br>
| |
− | <h4>Cell Measurement</h4>
| |
− | <p ><b>Table 4. Raw data of Abs600 measurement.</b></p>
| |
− | <img src="https://static.igem.org/mediawiki/2016/0/04/T--Peking--image_interlab_7.png">
| |
− | <p ><b>Table 5. Blank subtraction and correction of Abs600 measurement.</b></p>
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− | <img src="https://static.igem.org/mediawiki/2016/e/ee/T--Peking--image_interlab_8.png">
| |
− | <img src="https://static.igem.org/mediawiki/2016/7/71/T--Peking--image_interlab_9.png">
| |
− | <p ><b>Figure 3. Blank subtraction and correction of Abs600 measurement.</b></p>
| |
− | <p ><b>Table 6. Raw data of fluorescence measurement.</b></p>
| |
− | <img src="https://static.igem.org/mediawiki/2016/5/52/T--Peking--image_interlab_10.png">
| |
− | <p ><b>Table 7. Blank substraction and correction of fluorescence measurement.</b></p>
| |
− | <img src="https://static.igem.org/mediawiki/2016/3/32/T--Peking--image_interlab_11.png">
| |
− | <img src="https://static.igem.org/mediawiki/2016/6/67/T--Peking--image_interlab_12.png">
| |
− | <p ><b>Figure 4. Blank subtraction and correction of fluorescence measurement.</b></p>
| |
− | <p ><b>Table 8.Raw data of Fl/Abs600.</b></p>
| |
− | <img src="https://static.igem.org/mediawiki/2016/d/d3/T--Peking--image_interlab_13.png">
| |
− | <p ><b>Table 9. Raw data of average and SD.</b></p>
| |
− | <img src="https://static.igem.org/mediawiki/2016/a/a1/T--Peking--image_interlab_14.png">
| |
− | <img src="https://static.igem.org/mediawiki/2016/0/07/T--Peking--image_interlab_15.png">
| |
− | <p ><b>Figure 4. Average level of devices.</b></p>
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− | <div class="texttitle">Discussion</div>
| |
− | <p>It is noticeable that the promoter of the Device 1 is strongest followed by the promoter of the Device 2 and Device 3.</p>
| |
− |
| |
− | <h3 class="classic-title";"><span>Appendix</span></h3>
| |
− | <p>Individuals responsible for conducting InterLab study
| |
− | • Dong Yiming measured the devices.
| |
− | • Li Cheng processed the data.
| |
− | </p>
| |
− |
| |
− |
| |
− |
| |
| </div> | | </div> |
| </div> <!-- row End --> | | </div> <!-- row End --> |