<figcaption class="mt-3 text-muted"><i>On the left:</i> Generic interaction between a target and a gRNA for Cas9 [Reproduced from <a href="#Xie"><span style="color:blue">Xie and Yang</span></a> (Figure 1A)]. <i>On the right:</i> Predicted interaction of one subunit of the amplicon of Probe 2 with the gRNA.</figcaption>
</figure>
</figure>
+
</center>
<p class="lead">We can observe how the PAM sequence (in red in the figure) is located at the very beginning of the large loop in the amplicon, whereas the gRNA binds to the whole stem part and partially to the small loop.</p>
<p class="lead">We can observe how the PAM sequence (in red in the figure) is located at the very beginning of the large loop in the amplicon, whereas the gRNA binds to the whole stem part and partially to the small loop.</p>
The aim of the follow-up part is to provide a proof of concept for detecting disease recurrence, as well as to monitor our treatment efficacy in melanoma patients by detecting specific biomarkers present in the blood. This is particularly important for our project since it constitutes a non-invasive way of validating our vaccine efficacy: tumor biopsies are indeed very invasive, time consuming, and often difficult to perform. Here, we envision a new generation of diagnostic approach, by which a simple liquid biopsy could give us an accurate prognosis regarding the genetic evolution of the tumor in response to our immunotherapy treatment, and would also enable us to detect relapses. This requires a detection system that is both highly sensitive and highly specific, since these biomarkers yield a very precise sequence and are often present in extremely low concentrations in the blood. Our idea to solve this problem is to combine RCA or PCR amplification with a Cas12a-protein based system for a rapid and specific detection. We divided this part in two separate modules, designed to tackle the two different biomarkers we are using: circulating tumor DNA and microRNAs.
Blood Biomarkers
Blood Biomarkers
Cas12a
To answer the need for a fast and robust detection method we chose to work with the newly characterized Cas12a (Cpf1) protein.
CRISPR-Cas (clustered regularly interspaced short palindromic repeats–CRISPR-associated) system are originally inspired by an antiviral defense mechanism used by prokaryotes which essentially works by recognizing and cleaving the foreign DNA/RNA. It has in the recent years widely been used as a gene editing tool for its ability to find and cut a specific target sequence (the activator).
This activator is composed of two different strands: the target strand (TS) and the non-targeted strand (NTS). The NTS requires a T-rich protospacer adjacent motif (PAM) sequence to be recognized by Cas12a whereas the TS contains the complement sequence of the guide RNA (gRNA), the gRNA being part of the crRNA.
With both these requirements completed, the interchangeable CRISPR RNA (crRNA) will successfully guide the protein to the target.
As a result of cleaving its double stranded DNA (dsDNA) target, Cas12a will undergo a conformational change which will unleash the protein’s endonuclease activity with a single active site in the RuvC catalytic region against any single stranded DNA (ssDNA). This unspecific collateral cleavage is what makes this system so suitable for detection as it greatly amplifies the signal.
In our assays we decided to work with the purified Lba Cas12a (type V-A CRISPR) extracted from Lachnospiraceae bacterium ND2006 and provided by New England BioLabs.
One disadvantage of a classic CRISPR-Cas based assay is the need to have a PAM sequence near the region that we want to detect, for efficient RNA-guided DNA binding. To eliminate this need, we designed PCR primers that would specifically introduce the PAM sequence, for efficient and sequence-independent detection of any given junction or mutation
The first miRNA we decided to target is let-7a-5p: this miRNA is not among the ones found to be relevant as melanoma biomarkers (as instead are other miRNAs of the let-7 family) (Larrea et al.; Mirzaei et al.); nonetheless, we thought it might
be the best option to start from it as a proof of concept, because it was already well characterized for Rolling Circle Amplification (RCA) by Deng et al. and Qiu et al.
Qiu et al., as well as our colleagues from the related 2016 iGEM team of NUDT China, had designed their probes in order for the amplicons to be recognized by a CRISPR-Cas 9 system. Since our project deals instead with CRISPR-Cas
12a, despite the miRNA sequence being the same, we therefore had to modify the sequences of our probes accordingly. More specifically, we had to adapt the PAM sequence (placed on the amplicon of the probe) in order to match
our Cas protein (we worked with LbCpf1): while the requirement for Cas9 was NGG on the 3' of the amplicon, in our case we needed to have TTTN on the 5'. More details on the design are described in the section "Detailed design".
We wanted to test different designs of probes: some were conceived to have the PAM at the beginning of the larger loop of the amplicon (as in the probes from NUDT China), but we also investigated the case where the PAM was placed
on the double-stranded part (the stem) instead; the sequence on the uncostrained large loop was also changed among the probes.
We ordered 10 different probes; the sequence and related notes are described in the Table below.
Probe from Deng et al. and Qiu et al. (respectively referred to as "SP-let-7a" and "let-7a probe 1"), designed for Cas9. Used as a control for the efficiency of the amplification.
Probe designed by our team for Cas 12a. PAM on the large loop of the amplicon. Single base mismatch on the stem with respect to the target miRNA sequence.
Note: The sequences of the probes include a phosphate group at the 5' end (in order to ligate the probes). We nonetheless always ordered the oligonucleotides without the phosphate (because the cost was significantly lower) and
then performed phosphorylation by means of T4 Polynucleotide Kinase prior to ligation.
For each probe we ran an analysis of the secondary structure by means of available servers online (NUPACK, MFold): in all cases the structure of the probe, of its amplicon and of the series of 4-5 copies of the amplicon
were tested in order to check the absence of unwanted secondary structures. We also used RNAstructure DuplexFold to test the secondary structure of the dimer probe/miRNA: we were not able to find a more suitable tool for
the analysis of the duplex; nonetheless we believe that this server, despite its limitations with respect to our analysis (no possibility of having a circular probe, no possibility to have a DNA/RNA dimer), was enough to show
qualitatively the interaction between our probe and let-7a.
the regions in italic are those belonging to the loops of the hairpin
the regions in orange and green are those belonging to the stem of the hairpin (and which are complementary with each other)
the underlined region is the one complementary to the miRNA (let-7a-5p: UGAGGUAGUAGGUUGUAUAGUU)
Secondary structure of "let-7a probe 1" (Probe 2 for us). dG=-10.40.
Such probe consists of a double-stranded stem part, a 10 bases-long loop (which from now on we will refer to as "small loop" - on the right in the figure above) and a 16 bases-long loop ("large loop" - on the left). As we can
observe, the toehold region of the probe (i.e. the part on the small loop where the miRNA binds) is 7 bases long, in accordance with Deng et al., who proved it to be the optimal length to achieve both sensitivity and specificity.
the sequence in bold is the one which is complementary to the gRNA (except for two mismatches, which are highlighted) and the region in red is the PAM sequence (in this case single stranded).
We emphasize here that the PAM sequence is on a single-stranded part of the amplicon (the one complementary to the large loop of the probe): therefore, such single-stranded PAM can only be present on the amplicon, and not on the probe itself (as would have been instead if the PAM was on a double stranded part).
The gRNA sequence (as indicated by Qiu et al.) is:
with the scaffold region indicated in parentheses. The region out of the brackets is the spacer, binding to the amplicon, and the sequence in italic corresponds in particular to the part of the spacer binding on the loop of the
amplicon (with the rest of the spacer binding to the stem). The sign | indicates the position where the gRNA binds to the point on the amplicon where each new "copy" of the amplicon is considered to start (i.e. the point where
the 3' of a "subunit" of the amplicon and the 5' of the successive subunit are linked together).
More specifically, we can notice that in this design the spacer coincides with the reverse complement of let-7a, with the exception of the two mismatches and of a missing A at the beginning. The template of the gRNA for Cas9
would therefore be:
5'-[reverse complement of miRNA]-[scaffold]-3'
The expected interaction between amplicon and gRNA is outlined in the figure below:
On the left: Generic interaction between a target and a gRNA for Cas9 [Reproduced from Xie and Yang (Figure 1A)]. On the right: Predicted interaction of one subunit of the amplicon of Probe 2 with the gRNA.
We can observe how the PAM sequence (in red in the figure) is located at the very beginning of the large loop in the amplicon, whereas the gRNA binds to the whole stem part and partially to the small loop.
*Here and after, when referring to the "amplicon sequence", we only show one single copy of the reverse transcript of the probe. The actual amplicon, by definition of Rolling Circle Amplification, is of course made instead of
sequential copies of this "unitary" sequence.
We then tried to design our own probes for Cas 12a, working backwards from the gRNA.
Contrarily to Cas 9, for which the PAM must be on the 3' side of the target, for Cas12a the PAM must be on the 5’ side of the target instead. This implies that the scaffold part of the gRNA must be on the 5’ side (instead of the 3’) as well (Figure below).
Lorem ipsum dolor sit amet, consectetur adipisicing elit,
sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad
minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea
commodo consequat.
Lorem ipsum dolor sit amet, consectetur adipisicing elit,
sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad
minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea
commodo consequat.
One disadvantage of a classic CRISPR-Cas based assay is the need to have a PAM sequence near the region that we want to detect, for efficient RNA-guided DNA binding. To eliminate this need, we designed PCR primers that would specifically introduce the PAM sequence, for efficient and sequence-independent detection of any given junction or mutation
miRNA Cas assay
References
"EnGen Lba Cas12a (Cpf1)" - New England BioLabs website. URL: https://international.neb.com/products/m0653-engen-lba-cas12a-cpf1#Product%20Information_Notes (Accessed 24/09/2018)
Larrea, Erika, et al. "New concepts in cancer biomarkers: circulating miRNAs in liquid biopsies." International journal of molecular sciences, 17.5 (2016): 627.
Mirzaei, Hamed, et al. "MicroRNAs as potential diagnostic and prognostic biomarkers in melanoma." European journal of cancer, 53 (2016): 25-32.
Deng, Ruijie, et al. "Toehold-initiated rolling circle amplification for visualizing individual microRNAs in situ in single cells." Angewandte Chemie, 126.9 (2014): 2421-2425.
Qiu, Xin-Yuan, et al. "Highly Effective and Low-Cost MicroRNA Detection with CRISPR-Cas9." ACS synthetic biology, 7.3 (2018): 807-813.
Zadeh, Joseph N., et al. "NUPACK: analysis and design of nucleic acid systems." Journal of computational chemistry, 32.1 (2011): 170-173.
Zuker, Michael. "Mfold web server for nucleic acid folding and hybridization prediction." Nucleic acids research, 31.13 (2003): 3406-3415.
Reuter, Jessica S., and David H. Mathews. "RNAstructure: software for RNA secondary structure prediction and analysis." BMC bioinformatics, 11.1 (2010): 129.
Xie, Kabin, and Yinong Yang. "RNA-guided genome editing in plants using a CRISPR–Cas system." Molecular plant, 6.6 (2013): 1975-1983.
