Difference between revisions of "Team:ZJU-China/Hardware"

2D printer

The first part is a 2-Demension printer consists of three motors and an arduino uno board that can receive a photo and print it on a plat surface with our special ink. The printer’s main control board is based on a windows application named Steroduino which can nearly translate all kinds of photo into an two-dimension array that will be printed on the surface by the motors with the main control board.

IDE (interdigital electrode) design

IDE (interdigital electrode) is composed of two interdigital electrodes with two connection tracks, on a insulative substrate. IDE is cheaper than normal electrode and can work with low volumes of sample. The interdigitated configuration typically enhances sensitivity and detection limits.

Taking our 2D-printer’s precision into consideration, we design our first generation of IDE (see Fig,1). The black part is 6×interdigital working electrodes, the green part is counter electrode and the red part is reference electrode. We plan to use Au as electrode material and PET as electrode base.

Fig. 1 First generation of IDE

To make it easier to adjust hardware for the above IDE and to print enzyme solution, we modify our IDE and create the second generation of IDE (see Fig.2). We design thicker working electrode and electrical contact, working electrode reaching the thickness of 0.44mm. And 0.48mm gap is left to avoid short circuit. And we separate each pair of interdigital electrode, following the principle of IDE design.

Fig. 2 Second generation of IDE

Integration

To accurately describe the results of protein production, simplify user operations and save time, we developed a complete system consisting of two parts. That is converter and amplifier, reporter.

We connect a Transimpedance Amplifiers together with a Bluetooth module an expansion on arduino nano board.

We printed the ink containing modified enzymes on IDE. IDE’s output ports are connected to the in-port of the second part with a very low electronic current which can accordingly form a voltage big enough that is sufficient to be detected by our detector. The detector is just an arduino nano board with an blueteeth board which, we use analog pin to detect the voltage and using blueteeth board to transfer the data to mobile phone running the WeChat mini-program which can show the data it received by blueteeth. In last part the reporter receives the voltage and transfer them with our algorithm into an actual current value, and then sends processed user-readable results to the applets on the user’s mobile phone. This app is developed in the WeChat Platform, here are some screen shoots in the app.

The hardware implementation not only solves the need to report wet experiment results, but also is much more user friendly, especially for non-professionals.

In order to verify the stability and accuracy, we conducted dozens of tests in the hospital using real blood samples and contacted the experts to evaluate the hardware.

Sequences of Modified Promoters

Part Number	Sequence(-17~+6)
BBa_R0085(wild type)	TAATACGACTCACTATAGGGAGA
BBa_K2721000	TAATACGACTCACTATCGCGGAG
BBa_K2721001	TAATACGACTCACTCCAGCAATC
BBa_K2721002	TAATACGACTCACTTCAGCGACC
BBa_K2721003	TAATACGACTCACACGAGCGAGA

Test

To test the function of mutant promoters, we chose the GFP as our reporter. By assessing the absolute fluorescence units(RFU) and OD600, we can conclude the relative strength of all promoters. When the E.coli BL21(DE3) is cultured at the stage of logarithmic phase, we added IPTG to induce the expression of GFP in strains BL21(DE3) for 4 hours. And the result is shown as Figure and Table below.

Fig.1 Relative Strength of wildtype T7 promoter and mutant promoters

Part Number	Relative Strength
BBa_R0085(wild type)	1
BBa_K2721000	20.99
BBa_K2721001	17.75
BBa_K2721002	7.63
BBa_K2721003	13.92

As we can see from the figure, our mutant promoters showed largely increased strength compared with wild type T7 promoter. Therefore, our mutant promoters offer users more opportunity to control the expression of protein using T7 promoter and permit higher levels of target protein expression to be obtained.

References

[1] Ikeda R A, Ligman C M, Warshamana S, et al. T7 promoter contacts essential for promoter activity in vivo[J]. Nucleic Acids Research, 1992, 20(10): 2517-2524.

[2] Paul S, Stang A, Lennartz K, Tenbusch M, Uberla K. Selection of a T7 promoter mutant with enhanced in vitro activity by a novel multi-copy bead display approach for in vitro evolution[J]. Nucleic Acids Research, 2013, 41(1):e29.