Difference between revisions of "Team:GO Paris-Saclay/labnotebook-ler"

Latest revision as of 15:31, 17 October 2018

03/07

PCR of LER

Arthur

The plasmid pKK-Ler was taken from Hervé’s database. A PCR Phusion was performed to amplify Ler.

Primer: GO2018-7 and GO2018-8

Gel 1

A PCR clean up was performed afterward and the concentration was 53, 74 ng/µL

04/07

Digestion pSB1C3-TetO and Ler

Arthur, William Britany

Component	Volume (μL)
pSB1C3 – TetO	10
SpeI	1
PstI	1
NEB buffer 2.1	2
H2O	6
Component	Volume (μL)
RBS-Ler	10
XbaI	1
PstI	1
NEB buffer 2.1	2
H2O	6

Fragment	Enzymes
pSB1C3-TetO	SpeI/PstI
RBS-Ler	XbaI/PstI

The digestion mix was then incubated at 37°C for 2 h.

DNA purification (PCR clean up)

Component	Concentration (ng/μL)
pSB1C3 – TetO	13, 74
RBS-Ler	2, 82

5/07

Ligation pSB1C3-TetO-Ler and pSB1C3-Ler

Yueying, William

We are aiming for a molar ratio insert:vector of around 1:3

Insert

Vector

T4 buffer x10

T4 ligase

Ligation 1

Ler :

0, 6 kb /C= 13, 74 ng/uL

→ 1, 5 μL

pSB1C3-TetO :

3 kb/C= 7 ng/μL

→ 5 μL

1

Ligation 2

Ler :

0, 6 kb/ C= 13, 74 ng/uL

→ 1, 5 μL

pSB1C3:

3 kb/ C= 7 ng/μL

→ 5 μL

1

For a total of 10 uL each. Then incubate the tubes at room temperature for 2 h.

Transformation of pSB1C3-TetO-Ler and pSB1C3-Ler

Britany, Clémence

DH5α cells were transformed with the 2 ligations, following standard transformation protocol by heat shock. A negative control (cells without any plasmid) was also done.

Results: No colonies on the negative control. There were 4 colonies for the pSB1C3-TetO-Ler, about 10 for the pSB1C3-Ler

Component	Volume (μL)
pGEMTeasy	10
HincII	1
Tango buffer	2
H2O	7

Digestion pGEMTeasy

Kenn, Julie M

Fragment	Enzymes
pGEMTeasy	HincII

The digestion mix was then incubated at 37°C for 2 h.

pGEMTeasy purification (PCR clean up)

Component	Concentration (ng/μL)
pGEMTeasy	23, 5 ng/μL

Kenn, Julie M

Ligation pGEMT-ler et pGEMT-CPG2

Kenn, Julie M

Insert

Vector

T4 buffer x10

T4 ligase

Ligation

Ler:

0, 6 kb /C= 23, 1 ng/uL

→ 1 μL

pGEMT easy:

3 kb/C= 53,74 ng/μL

→ 3 μL

1

The mix was left in the fridge overnight

06/07

Colony PCR check

Céline, Arthur, William

Colony PCRs were performed with, verification primers VR and VF2 which flank the biobrick insertion site. They amplify the insert from both parts of the vector pSB1C3.

Gel 2

Expected size of the fragments: 800 bp

Results: For the pSB1C3-TetO-Ler there were only empty vectors and for the pSB1C3-Ler the clones have the expected size.

06/07

Transformation pGEMT-LER

Yueying

DH5α cells were transformed with the ligation, following standard transformation protocol by heat shock. A negative control (cells without any plasmid) was also done). Cell culture was spread on two LB IPTG X-gal Ampicillin plates

08/07

Results: There are plenty of clones for the ligations pGEMT-easy-LER but most of them are blue (which means closed vector). 5 white clones for each were put in LB 4mL Ampicillin, X-gal, IPTG overnight at 37°C, for extraction by the kit (and to be sent for sequencing if they contain the insert).

09/07

Plasmid Extractions of pGEMt-Easy LER and pSB1C3-LER

Kenn William

All the extractions were realised with the extraction kit (Nucleospin plasmid).

We also noticed that the pGEMt easy Ler 5 were slightly blue during the extraction.

Nanodrop Results:

Component	Concentration (ng/μL)	A 280/260
pSB1C3 Ler 1	14	1,87
pSB1C3 Ler 2	20	1,82
pGEMt easy Ler 1	40	1.82
pGEMt easy Ler 2	61	1.76
pGEMt easy Ler 3	31	1.79
pGEMt easy Ler 4	34	1.81
pGEMt easy Ler 5	41	1.85

pGEMT easy ler-1 and 2 and pSB1C3 ler-1 and 2 were sent for sequencing

Digestion of the extracted plasmid

Kenn

Component	Volume (μL)
pGEMTeasy-Ler	4
EcoRI	0,5
FD buffer	1
H2O	4, 5
Component	Volume (μL)
pSB1C3-Ler	4
NotI	0,5
FD buffer	1
H2O	4, 5

Gel 3

Expected size: pGEMTeasy-ler:3,5 kb/ pGEMTeasy empty:3 kb

Result: Since the plasmid has the expected size, the insert, we expect that the clones sent for sequencing contain the insert. Sequencing will confirm whether the whole sequence is as expected.

Sequencing analysis

Concerning the two clones: pSB1C3-ler 1 and 2, the sequences are correct for both, but there is an extra sequence between the last nucleotide of the RBS and the first nucleotide of the ATG:

CATATGTAGATGTGTCCTAATTTGATAGATAAACGTTATCTCACATAATTTATATCATTTGATTAATTGTTGTCCTTCCTGATAAGGATAAGGTCGCTAATAGCTTAAAATATTAAAGC

This sequence corresponds to the native RBS (and more), it comes from the original DNA of the protein. The plasmid we used as a matrix was not correctly sequenced. Most likely, it would work, but since its complicated we will start again from the gBlock we received (the one with the RBS).

Concerning the two clones pGEMt-easy- ler 1 and 2: idem, the sequence is correct, but there is this extra piece of DNA. Still, it is reassuring the confirm that it has been cloned in pGEMt-easy. However, the surrounding plasmid does not seem correct. Anyway, we will not be using it since it has this extra DNA.

12/07

Ligation gBlock RBS LER in pGEMT easy

William

We ligated the gBlock received containing prefix-rbs-ler-suffix, in pGEMT easy, as a second source of ler sequence.

Insert

Vector

T4 buffer x10

T4 ligase

Ligation

Ler:

0, 6 kb /C= 10 ng/uL

→ 2 μL

pGEMT easy:

3 kb/C= 53,74 ng/μL

→ 6 μL

1

Transformation gBlock RBS LER in pGEMT easy

William

Heat shock transformation of DH5alpha with gBlock RBS LER in pGEMTeasy, following standard procedure.

Plated on LB Xgal IPTG Amp plates made the same day. The inadvertent presence of blue loading dye in the ligation mix was reported.

Overnight culture: colony a bit small, put back 3 hours then to the fridge for blue-white screen improvement.

16/07

Liquid cultures of pGEMT easy RBS ler

Kenn

Liquid culture of white clones of pGEMT easy RBS ler was launched.

17/07

Extraction pGEM-t-easy / RBS Ler

Clémence et Britany

Extraction were performed from 3 mL of the 16/07 culture (clones 1 to 8). Elution were done in 50 μL buffer AE.

Digestion of pGEM-t-easy / RBS Ler

Clémence et Britany

Component	Volume (μL)
pGEMTeasy-Ler	3
NotI	1
FD buffer	1
H2O	5

24/07

Gel verification

Yueying

The digestion was a success for the plasmids. We putted all the pGEMt-easy/RBS-ler digestion on a gel in order to purify the 500 pb signal stripe.

Gel purification of pGEMTeasy/RBS-Ler

Yueying

Component	Concentration (ng/μL)
RBS-Ler	3,5-5

Digestion of pSB1C3 TetO and RBS-Ler

Component	Volume (μL)	Component	Volume (μL)
pSB1C3-TetO	10	RBS-Ler	10
Pst1	1	Pst1	1
Spe1	1	Xba1	1
NEB buffer 2.1	2	NEB buffer 2.1	2
H2O	6	H2O	6

Fragment	Enzymes
pSB1C3-TetO	SpeI/PstI
RBS-Ler	XbaI/PstI

Gel verification

William

Gel

30/07

Ligation of pSB1C3 TetO and RBS-Ler

Julie M, William

Insert

Vector

T4 buffer x10

T4 ligase

H2O

Ligation

Ler:

0, 6 kb

→ 3 μL

pSB1C3-TetO:

3 kb

→ 1 μL

1

4

Transformation of pSB1C3-TetO/RBS-Ler in DH5alpha

We followed the standard procedure

Results: There were plenty of clones

31/07

@@ Line 436: / Line 436: @@
        <p class="c4"><span class="c24">09/07</span></p>
        <h2 class="c36"><span class="c31">Plasmid Extractions of pGEMt-Easy LER and pSB1C3-LER</span></h2>
-       <p class="c39"><span class="c8">Xavier Kenn William</span></p>
+       <p class="c39"><span class="c8"> Kenn William</span></p>
        <p class="c4"><span class="c22">All the extractions were realised with the extraction kit (Nucleospin plasmid). </span></p>
        <p class="c4"><span class="c22">&nbsp;We also noticed that the pGEMt easy Ler 5 were slightly blue during the extraction.</span></p>
@@ Line 536: / Line 536: @@
        <p class="c38"><span class="c23"><br></span><span class="c1">pGEMT easy ler-1 and 2 and pSB1C3 ler-1 and 2 were sent for sequencing</span></p>
        <h2 class="c36"><span class="c31">Digestion of the extracted plasmid</span></h2>
-       <p class="c39"><span class="c35">Xavier, Kenn</span></p>
+       <p class="c39"><span class="c35"> Kenn</span></p>
        <p class="c15 c14"><span class="c33"></span></p>
        <a id="t.d6a655362b17966526201aa2b70c9d318a2a6f94"></a><a id="t.9"></a>
@@ Line 644: / Line 644: @@
        <p class="c4"><span class="c24">12/07</span></p>
        <h2 class="c45"><span class="c31">Ligation gBlock RBS LER in pGEMT easy</span></h2>
-       <p class="c44"><span class="c8">Xavier, William</span></p>
+       <p class="c44"><span class="c8"> William</span></p>
        <p class="c44"><span class="c1">We ligated the gBlock received containing prefix-rbs-ler-suffix, in pGEMT easy, as a second source of ler sequence.</span></p>
        <a id="t.0117218317bf234f3403d251c79b69ce2e6d1e43"></a><a id="t.10"></a>