Difference between revisions of "Team:OUC-China/Basic Part"
| Line 273: | Line 273: | ||
| − | <div class="copyright1">Contact Us : oucigem@163.com | ©2018 OUC IGEM.All Rights Reserved. | + | <div class="copyright1">Contact Us : oucigem@163.com | ©2018 OUC IGEM.All Rights Reserved. <br /> |
| − | + | <img src="https://static.igem.org/mediawiki/2017/b/b4/T--OUC-China--foot1.jpeg"alt="banner"width="80px"> | |
| + | <img src="https://static.igem.org/mediawiki/2017/6/62/T--OUC-China--foot2.jpeg"alt="banner"width="80px"> | ||
| + | <img src="https://static.igem.org/mediawiki/2018/f/f3/T--OUC-China--lalala.png"alt="banner"width="80px"> | ||
| + | <img src="https://static.igem.org/mediawiki/2017/5/51/T--OUC-China--NSG.png"alt="banner"height="65px"> | ||
| + | <img src="https://static.igem.org/mediawiki/2017/2/2a/T--OUC-China--ML.png"alt="banner"height="65px">  | ||
| + | </div> | ||
<script> | <script> | ||
Revision as of 17:08, 17 October 2018
Basic Parts
| Part number | Type | Description | Designer | Length（bp） |
|---|---|---|---|---|
| BBa_K2615020 | Regulatory | MiniToe-WT, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. | Yunqian Zhang | 68 |
| BBa_K2615013 | Coding | Csy4-Q104A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. | Yunqian Zhang | 564 |
| BBa_K2615014 | Coding | Csy4-Y176F, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. | Anyi Li | 564 |
| BBa_K2615015 | Coding | Csy4-F155A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. | Anyi Li | 564 |
| BBa_K2615016 | Coding | Csy4-H29A, a new Csy4 mutant, which can recognize and cleave a 22nt hairpin. | Anyi Li | 564 |
| BBa_K2615021 | Regulatory | MiniToe-1, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bind to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTGCCGTGTAGGCAGCT. | Anyi Li | 74 |
| BBa_K2615022 | Regulatory | MiniToe-2, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACGGCCGTATAGGCCGCT. | Anyi Li | 74 |
| BBa_K2615023 | Regulatory | MiniToe-3, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAGTGCCGTATAGGCAGCT. | Anyi Li | 74 |
| BBa_K2615024 | Regulatory | MiniToe-4, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCAATGCCGTATAGGCATCT. | Anyi Li | 74 |
| BBa_K2615025 | Regulatory | MiniToe-5, a member of miniToe family, which can be specifically recognized and cleaved upon Csy4 expression. It has a RBS sequence and a crRBS sequence, which can bond to each other. And between them there is a 22nt hairpin structure that can be recognized by Csy4. This part is a mutant of miniToe-WT, its hairpin is changed from GTTCACTGCCGTATAGGCAGCT to GTTCACTATTGTATAATTAGCT. | Yunqian Zhang | 74 |
Contact Us : oucigem@163.com | ©2018 OUC IGEM.All Rights Reserved.
