Difference between revisions of "Team:Warwick/Design"

m
m
Line 133: Line 133:
 
         $("#Content1").html("<h2>Synthetic Gene Pathway</h2><img style='width: 100%; background-color: white !important; border-radius: 50px;' src='https://static.igem.org/mediawiki/2018/3/31/T--Warwick--ribodesign1.png'><br><br><p>ATC induces the circuit.<br><br>TetR is disabled by ATC.<br><br>The disabled TetR can no longer inhibit the transcription of the pathogen imitating <a href='http://parts.igem.org/wiki/index.php/Part:BBa_K2841531'>sRNA </a>.<br><br>The <a href='http://parts.igem.org/wiki/index.php/Part:BBa_K2841531'>sRNA</a> can bind to the constitutively expressed riboregulated <a href='http://parts.igem.org/Part:BBa_K2841541'>gRNA</a>, exposing the targeting domain.<br><br>The exposed <a href='http://parts.igem.org/wiki/index.php/Part:BBa_K2841510'>dCAS9</a> recognising cis-acting factor within the <a href='http://parts.igem.org/Part:BBa_K2841541'>gRNA</a> binds to the constitutively expressed <a href='http://parts.igem.org/wiki/index.php/Part:BBa_K2841510'>dCAS9</a> protein. <br><br>Once enabled the dCAS9 protein will bind to the <a href='http://parts.igem.org/wiki/index.php/Part:BBa_K2841517'>LacIq</a> promoter, inhibiting the expression of the LacI repressor protein.<br><br>Once the <a href='http://parts.igem.org/wiki/index.php/Part:BBa_K2841517'>LacI</a> repressor is inhibited, every pLAC will be upregulated due to lack of inhibition<br><br>The sfGFP will be synthesised from the pLAC, resulting in a green fluorescence.<br><br><br>The sRNA and dCAS9 are found on a Kanamycin resistant plasmid.<br><br><br>The gRNA and GFP are found on a Chloramphenicol plasmid.<br><br>The LacI is found on the Z1 cassette found in MG1655 Z1 cells. The Z1 cassette contains a set of repressors for the cell to utilise. Initially we designed our circuit to respond to the EndA gene in different strains of E.coli. Our project was going to be used to determine whether an unidentified strain of lab E.coli was MG1655 or DH5 alpha - or more importantly, whether or not the bacteria had a specific EndA mutant which could affect miniprep results. After our interview with Professor David Coleman we changed the course of the project and our entire iGEM team to focus on Legionella detection and water safety as a whole. We integrated his design suggestions into our <a href='http://parts.igem.org/Part:BBa_K2841515'>plasmid sequence design and function</a>. The new <a href='http://parts.igem.org/Part:BBa_K2841541'>plasmids were designed to target Legionella</a>.</p>");
 
         $("#Content1").html("<h2>Synthetic Gene Pathway</h2><img style='width: 100%; background-color: white !important; border-radius: 50px;' src='https://static.igem.org/mediawiki/2018/3/31/T--Warwick--ribodesign1.png'><br><br><p>ATC induces the circuit.<br><br>TetR is disabled by ATC.<br><br>The disabled TetR can no longer inhibit the transcription of the pathogen imitating <a href='http://parts.igem.org/wiki/index.php/Part:BBa_K2841531'>sRNA </a>.<br><br>The <a href='http://parts.igem.org/wiki/index.php/Part:BBa_K2841531'>sRNA</a> can bind to the constitutively expressed riboregulated <a href='http://parts.igem.org/Part:BBa_K2841541'>gRNA</a>, exposing the targeting domain.<br><br>The exposed <a href='http://parts.igem.org/wiki/index.php/Part:BBa_K2841510'>dCAS9</a> recognising cis-acting factor within the <a href='http://parts.igem.org/Part:BBa_K2841541'>gRNA</a> binds to the constitutively expressed <a href='http://parts.igem.org/wiki/index.php/Part:BBa_K2841510'>dCAS9</a> protein. <br><br>Once enabled the dCAS9 protein will bind to the <a href='http://parts.igem.org/wiki/index.php/Part:BBa_K2841517'>LacIq</a> promoter, inhibiting the expression of the LacI repressor protein.<br><br>Once the <a href='http://parts.igem.org/wiki/index.php/Part:BBa_K2841517'>LacI</a> repressor is inhibited, every pLAC will be upregulated due to lack of inhibition<br><br>The sfGFP will be synthesised from the pLAC, resulting in a green fluorescence.<br><br><br>The sRNA and dCAS9 are found on a Kanamycin resistant plasmid.<br><br><br>The gRNA and GFP are found on a Chloramphenicol plasmid.<br><br>The LacI is found on the Z1 cassette found in MG1655 Z1 cells. The Z1 cassette contains a set of repressors for the cell to utilise. Initially we designed our circuit to respond to the EndA gene in different strains of E.coli. Our project was going to be used to determine whether an unidentified strain of lab E.coli was MG1655 or DH5 alpha - or more importantly, whether or not the bacteria had a specific EndA mutant which could affect miniprep results. After our interview with Professor David Coleman we changed the course of the project and our entire iGEM team to focus on Legionella detection and water safety as a whole. We integrated his design suggestions into our <a href='http://parts.igem.org/Part:BBa_K2841515'>plasmid sequence design and function</a>. The new <a href='http://parts.igem.org/Part:BBa_K2841541'>plasmids were designed to target Legionella</a>.</p>");
  
−
         $("#Content2").html("<h2>Plasmids and Sequences</h2><img src='https://static.igem.org/mediawiki/2018/5/5d/T--Warwick--ribodesign2.png'><img style='width: 80%' src='https://static.igem.org/mediawiki/2018/5/59/T--Warwick--ribodesign3.png'><img style='width: 80%' src='https://static.igem.org/mediawiki/2018/f/f5/T--Warwick--ribodesign4.png'><img style='width: 80%' src='https://static.igem.org/mediawiki/2018/d/d2/T--Warwick--ribodesign5.png'><p>The full annotated plasmids which we used for our experiments are shared for the iGEM community to use. We have highlighted on every plasmid where our Legionella Sensing Lac Repressing and Pathogen Imitating Domains exist. All five iterations of plasmids that we designed are available in genbank format: <a href='http://parts.igem.org/File:T--Warwick--2018-Entire-Project.zip'>here</a><br><br>We have the full plasmid<br><br>gRNA secondary structure prediction<br><br>ATGTTTAAACACGGATGTTTTATACTAATAGTCTTTTTTT TAGCCAGCTGCTTGTCAGGCTGTCTGGGGGTTTTATGGAC TGGGGCAACTCTAGCCTATGACCGGCACAATGTATATAAA AAATTAGATGATTATAATTTAATAAAAGCTCTTAATGATG TTTTAGCTGTCAACCGGACATTTAAAAACTCAGAGACAGT ACTGGATATTGCTGTGTTCAACAGAGATATTTTAATAGCA GGGCATGTTCCAACCCAGGAGTTGTACGATGAATTACAAC TACGTCTAAGCAAAGTTAAAGGATACAGGCGGTTATTCAA TCGTGTAATTATCAATAAAATGCCATCCAACTCGATCCAG GACAGCTGGATTACCACGAAAATCCGTAGCCAAATTTTTG CAGACTCTTCAATCGATCCTAACGCTTTCAAGGTGGTTAC TTCTGATCGTGTTGTCTATTTGATGGGAGATGTTCAGACA GAACAAGCTGAAAAAGTGATTAAAATTGCAAGATACACAG GTGGTGTACAGAAAGTAATAAAACTTATGCGGTATTATAC TTATCAAACCAGTACGAATATGGCCTGA<br><br><br>Initially we determined the <a href='http://parts.igem.org/Part:BBa_K2841541'>Alpha riboswitch</a> by reading the DNA sequence and searching for potential loops by many repeated characters or similar bases near one another. The region in bold highlights a potential sense loop domain recognition region and the region in italics shows the extended sensing domain.</p>");
+
         $("#Content2").html("<h2>Plasmids and Sequences</h2><img src='https://static.igem.org/mediawiki/2018/5/5d/T--Warwick--ribodesign2.png'><img style='width: 80%' src='https://static.igem.org/mediawiki/2018/5/59/T--Warwick--ribodesign3.png'><img style='width: 80%' src='https://static.igem.org/mediawiki/2018/f/f5/T--Warwick--ribodesign4.png'><img style='width: 80%' src='https://static.igem.org/mediawiki/2018/d/d2/T--Warwick--ribodesign5.png'><p>The full annotated plasmids which we used for our experiments are shared for the iGEM community to use. We have highlighted on every plasmid where our Legionella Sensing Lac Repressing and Pathogen Imitating Domains exist. All five iterations of plasmids that we designed are available in genbank format: <a href='http://parts.igem.org/File:T--Warwick--2018-Entire-Project.zip'>here</a><br><br>We have the full plasmid<br><br>gRNA secondary structure prediction<br><br>ATGTTTAAACACGGATGTTTTATACTAATAGTCTTTTTTT TAGCCAGCTGCTTGTCAGGCTGTCTGGGGGTTTTATGGAC TGGGGCAACTCTAGCCTATGACCGGCACAATGTATATAAA AAATTAGATGATTATAATTTAATAAAAGCTCTTAATGATG TTTTAGCTGTCAACCGGACATTTAAAAACTCAGAGACAGT ACTGGATATTGCTGTGTTCAACAGAGATATTTTAATAGCA GGGCATGTTCCAACCCAGGAGTTGTACGATGAATTACAAC TACGTCTAAGCAAAGTTAAAGGATACAGGCGGTTATTCAA TCGTGTAATTATCAATAAAATGCCATCCAACTCGATCCAG GACAGCTGGATTACCACGAAAATCCGTAGCCAAATTTTTG CAGACTCTTCAATCGATCCTAACGCTTTCAAGGTGGTTAC TTCTGATCGTGTTGTCTATTTGATGGGAGATGTTCAGACA GAACAAGCTGAAAAAGTGATTAAAATTGCAAGATACACAG GTGGTGTACAGAAAGTAATAAAACTTATGCGGTATTATAC<br>TTATCAAACCAGTACGAATATGGCCTGA<br><br><br>Initially we determined the <a href='http://parts.igem.org/Part:BBa_K2841541'>Alpha riboswitch</a> by reading the DNA sequence and searching for potential loops by many repeated characters or similar bases near one another. The region in bold highlights a potential sense loop domain recognition region and the region in italics shows the extended sensing domain.</p>");
  
 
         $("#Content3").html("<img style='width: 80%; background-color: white;' src='https://static.igem.org/mediawiki/2018/7/77/T--Warwick--ribodesign6.png'><br><p>The Gamma construct was designed by analysing the secondary structure of the Legiolysin mRNA and locating exposed nucleotides. The potential loop recognition domain highlighted in red shows the region that construct Gamma was designed through prediction of exposed nucleotides for the optimal mRNA-gRNA interaction efficiency. We utilised extensive secondary structure prediction through our model utilising NuPack to determine functional switch sequences.</p><br><br><img style='width: 80%; background-color: white;' src='https://static.igem.org/mediawiki/2018/3/33/T--Warwick--ribodesign7.png'><br><p>The <a href='http://parts.igem.org/Part:BBa_K2841541'>Alpha construct</a> prediction determined that the Blocking domain effectively obstructed the Targeting Domain. The blocked targeting domain would not function, thus the switch would be in the off state.</p><br><br><img style='width: 80%; background-color: white;' src='https://static.igem.org/mediawiki/2018/9/94/T--Warwick--ribodesign8.png'><br>The Alpha and Pathogen Imitating Sequence complex prediction determined that the Blocking domain was not able to be removed from the Targeting Domain, implying that the switch would remain in the off state regardless of stimulation. Despite the information we experimented with the construct to test the accuracy of the modelling software and found that the model was not representative of results. A large amount of our time was dedicated to <a href='https://2018.igem.org/Team:Warwick/Model'>modelling</a> our constructs until they demonstrated effective function.<br><br><img style='width: 80%; background-color: white;' src='https://static.igem.org/mediawiki/2018/a/aa/T--Warwick--2018-DNAwhole.gif'><br><p>We used centrifold method of 3D RNA folding prediction with RNA composer to test the tertiary structure of our constructs with the 2D predicted structures from NuPack. <a href='https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2703931/'>The predicted structures</a> supported our initial conclusions that the targeting domain of the gRNA (green) was inhibited by the blocking domain (red) and that the sensing loop (blue) and extended sensing domain (light blue) could unfold the structure while the dCAS9 recognition cis acting factor (grey) did not disrupt the blocking and targeting domains. Watson-Crick base pairing of the gRNA targeting domain and the blocking domain is clear through analysis of the molecular structure. <br>We used centrifold method of folding with RNA composer to get some <a href='https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2703931/'>results</a></p>");
 
         $("#Content3").html("<img style='width: 80%; background-color: white;' src='https://static.igem.org/mediawiki/2018/7/77/T--Warwick--ribodesign6.png'><br><p>The Gamma construct was designed by analysing the secondary structure of the Legiolysin mRNA and locating exposed nucleotides. The potential loop recognition domain highlighted in red shows the region that construct Gamma was designed through prediction of exposed nucleotides for the optimal mRNA-gRNA interaction efficiency. We utilised extensive secondary structure prediction through our model utilising NuPack to determine functional switch sequences.</p><br><br><img style='width: 80%; background-color: white;' src='https://static.igem.org/mediawiki/2018/3/33/T--Warwick--ribodesign7.png'><br><p>The <a href='http://parts.igem.org/Part:BBa_K2841541'>Alpha construct</a> prediction determined that the Blocking domain effectively obstructed the Targeting Domain. The blocked targeting domain would not function, thus the switch would be in the off state.</p><br><br><img style='width: 80%; background-color: white;' src='https://static.igem.org/mediawiki/2018/9/94/T--Warwick--ribodesign8.png'><br>The Alpha and Pathogen Imitating Sequence complex prediction determined that the Blocking domain was not able to be removed from the Targeting Domain, implying that the switch would remain in the off state regardless of stimulation. Despite the information we experimented with the construct to test the accuracy of the modelling software and found that the model was not representative of results. A large amount of our time was dedicated to <a href='https://2018.igem.org/Team:Warwick/Model'>modelling</a> our constructs until they demonstrated effective function.<br><br><img style='width: 80%; background-color: white;' src='https://static.igem.org/mediawiki/2018/a/aa/T--Warwick--2018-DNAwhole.gif'><br><p>We used centrifold method of 3D RNA folding prediction with RNA composer to test the tertiary structure of our constructs with the 2D predicted structures from NuPack. <a href='https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2703931/'>The predicted structures</a> supported our initial conclusions that the targeting domain of the gRNA (green) was inhibited by the blocking domain (red) and that the sensing loop (blue) and extended sensing domain (light blue) could unfold the structure while the dCAS9 recognition cis acting factor (grey) did not disrupt the blocking and targeting domains. Watson-Crick base pairing of the gRNA targeting domain and the blocking domain is clear through analysis of the molecular structure. <br>We used centrifold method of folding with RNA composer to get some <a href='https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2703931/'>results</a></p>");

Revision as of 03:12, 18 October 2018

Ripple


Design