Team:Kyoto/Safety

• 
• Project
  • Description
  • Design
  　　　　
  • Results
  　　　　　　　　　
  • Demonstration
  • Discussion
• Modeling
• Lab Work
  • Notebook
  • Materials&Methods
  • Special Methods
  • Safety
• Parts
  • Basic Parts
  • Composite Parts
  • Improving parts
  • Parts Collection
• Human Practices
  • Human Practice/Silver
  • Integrated Human Practice/Gold
  • Collaborations
• Team
  • Members
  • Attributions

Safety

• 1) Parts
• 2) Primer list
• 3) Materials
• 3-1 Kit
• 3-2 Restriction Enzyme
• 3-3 Polymerase
• 3-4 DNA ligase
• 3-5 Marker
• 3-6 Organism
• 3-7 Antibiotics
• 3-8 Equipment
• 3-9 Backbone
• 3-10 Buffer
• 3-11 SDS-PAGE&Westernblotting
• 4) Methods
• 4-1 Miniprep
• 4-2 Gel Extraction and PCR purification
• 4-3 Restriction Enzyme Digestion
• 4-4 Ligation
• 4-5 Transformation

1) Parts

Basic Parts

Composite Parts

2) Primer List

primer name	sequence	Length	Tm	GC%	Designer	Manufacturer
tropomyosinF	GATCGAGAAGGACAACGCCC	20	65	60	Fukuda	Macrogen Japan Corp
IK107	cccgccgccaccatggaggcggccgcaaaatcagg	35	94	71	Yoshimoto	Macrogen Japan Corp

3) Materials

3-1 Kit

Name	Supplier
Wizard® SV Gel and PCR	Promega
FastGene™Plasmid Mini Kit	NIPPON Genetics Co.,Ltd

4) Methods

4-1 Miniprep

Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.

4-17 Soaking

We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf