Team:Kyoto/Safety

• 
• Project
  • Description
  • Design
  　　　　
  • Results
  　　　　　　　　　
  • Demonstration
  • Discussion
• Modeling
• Lab Work
  • Notebook
  • Materials&Methods
  • Special Methods
  • Safety
• Parts
  • Basic Parts
  • Composite Parts
  • Improving parts
  • Parts Collection
• Human Practices
  • Human Practice/Silver
  • Integrated Human Practice/Gold
  • Collaborations
• Team
  • Members
  • Attributions

Safety

• 1) Safe project design
• 2) Safe lab work
• 3) Safe shipment
• 4) Link

1) Safe project design

All of the species we expect to use are not harmful for human.

All of the species we expect to use are not harmful for human.

Composite Parts

2) Safe lab work

primer name	sequence	Length	Tm	GC%	Designer	Manufacturer
tropomyosinF	GATCGAGAAGGACAACGCCC	20	65	60	Fukuda	Macrogen Japan Corp
IK107	cccgccgccaccatggaggcggccgcaaaatcagg	35	94	71	Yoshimoto	Macrogen Japan Corp

3) Safe shipment

3-1 Kit

Name	Supplier
Wizard® SV Gel and PCR	Promega
FastGene™Plasmid Mini Kit	NIPPON Genetics Co.,Ltd

4) Link

4-1 Miniprep

Minipreps were performed using FastGene™Plasmid Mini Kit and and Wizard® Plus SV Minipreps DNA Purification System according to the manufacturer's protocols.

4-17 Soaking

We followed this paper as for soaking.
https://link.springer.com/content/pdf/10.1007%2Fs10658-012-0035-0.pdf

For our full safety page please click here.