Team:BNU-China/Interlab

Proof

Interlab

The Peking iGEM 2016 team is participating in the third year of the iGEM Interlab study along with about 100 teams. We focused on quantifying expression of GFP in common, comparable or absolute units.

Introduction

The Measurement Committee is committed to achieving reliable and repeatable measurement. Therefore the interlab study is established, measurements made in different laboratories by measuring the expression of GFP will be no more variable than measurements taken within the same lab.

After several years of hard work, the committee concluded a universal protocol for measuring GFP expression. In recent years, the interlab study aims to improve the protocol and identify and correct the sources of systematic variability as much as possible.

Method

This year’s interlab study aims to reduce a major source of variability during fluorescence measurements: the number of cells in the sample. Normally, we take the Abs600 of a sample as a representation of its cell density, but still many previous studies showed that there was significant lab-to-lab variability(?). Therefore, we followed the protocols delivered by the iGEM authority and carried out this verification.


According to the protocol, we performed three calibration experiments (OD600 reference point, particle standard curve and the fluorescence standard curve) before the body part began. Results shown below.

Table 1. OD600 reference point


Plasmids containing promoters and GFP were taken from The 2016 DNA Distribution Kit and all devices were transformed into E. coli. Fluorescence of colonies was checked up under UV light.

5 ml of liquid LB-M medium with chloramphenicol were inoculated with two chosen colonies of each device. Liquid cultures were incubated for 16~18 hours in HONOUR INCURATOR SHAKER placed in incubator. OD of these cultures was measured by MAPADA UV-3100PC SPECTROPHOTOMETER and diluted to 0.02. Fluorescence of biological and also technical replicates was measured using Thermo VARIOSKAN FLASH following our protocol.


Results

Sequencing

• Device 1: J23101+I13504
• Device 2: J23106+I13504
• Device 3: J23117+I13504
• Positive Control Device: I20270 in pSB1C3
• Negative Control Device: R0040 in pSB1C3

>BBa_J23101 Part-only sequence (35 bp)
Tttacagctagctcagtcctaggtattatgctagc

>BBa_J23106 Part-only sequence (35 bp)
Tttacggctagctcagtcctaggtatagtgctagc

>BBa_J23117 Part-only sequence (35 bp)
Ttgacagctagctcagtcctagggattgtgctagc

>BBa_I13504 Part-only sequence (875 bp)
Aaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

>BBa_I20270 Part-only sequence (919 bp)
Ttgatggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

>BBa_R0040 Part-only sequence (54 bp)
tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac

Data

OD600 Reference Point

Table 1. OD600 Reference Point.


FITC Standard Curve

Table 2. Data of FITC standard curve.

Figure 2. FITC standard curve.


Normalization

Table 3. Normalization.


Cell Measurement

Table 4. Raw data of Abs600 measurement.

Table 5. Blank subtraction and correction of Abs600 measurement.

Figure 3. Blank subtraction and correction of Abs600 measurement.

Table 6. Raw data of fluorescence measurement.

Table 7. Blank substraction and correction of fluorescence measurement.

Figure 4. Blank subtraction and correction of fluorescence measurement.

Table 8.Raw data of Fl/Abs600.

Table 9. Raw data of average and SD.

Figure 4. Average level of devices.

Discussion

It is noticeable that the promoter of the Device 1 is strongest followed by the promoter of the Device 2 and Device 3.

Appendix

Individuals responsible for conducting InterLab study • Dong Yiming measured the devices. • Li Cheng processed the data.