Team:JNFLS/Experiments

Protocols

Ligation

  1. Perform agarose gel/ethidium bromide electrophoresis to fractionate DNA fragments. Any type or grade of agarose may be used. However, it is strongly recommended that fresh TAE buffer or TBE buffer be used as running buffer. Do not reuse running buffer as its pH will increase and reduce yields.
  2. When adequate separation of bands has occurred, carefully excise the DNA fragment of interest using a wide, clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
  3. Determine the appropriate volume of the gel slice by weighing it in a clean 15 mL microcentrifuge tube. Assuming a density of 1 g/mL, the volume of gel is derived as follows: a gel slice of mass 0.3 g will have a volume of 0.3 mL
  4. Add1 volume Binding Buffer (XP2).
  5. Incubate at 50-60C for 7 minutes or until the gel has completely melted. Vortex or shake the tube every 2-3 minutes.
  6. Insert a HiBind* DNA Mini Column in a 2 mL Collection Tube.
  7. Add no more than 700 uL DNA/agarose solution from Step5 to the HiBind DNA Mini Column.
  8. Centrifuge at 10，000＊g for 1 minute at room temperature.
  9. Discard the filtrate and reuse collection tube.
  10. Repeat Steps 7-9 until all of the sample has been transferred to the column.
  11. Add 300 uL Binding Buffer (XP2).
  12. Centrifuge at maximum speed (>=13,000 x g) for 1 minute at room temperature.
  13. Discard the filtrate and reuse collection tube.
  14. Add 700 uL SPW Wash Buffer.
  15. Centrifuge at maximum speed for 1 minute at room temperature.
  16. Discard the filtrate and reuse collection tube.
  17. Centrifuge the empty HiBind DNA Mini Column for 2 minutes at maximum speed to dry the column matrix. Note: It is important to dry the HiBind DNA Mini Column matrix before elution.Residual ethanol may interfere with downstream applications.
  18. Transfer the HiBind DNA Mini Column to a clean 15 mL microcentrifuge tube.
  19. Add 15-30 uL Elution Buffer or deionized water directly to the center of the column membrane.
  20. Let sit at room temperature for 2 minutes.
  21. Centrifuge at maximum speed for 1 minute.
  22. Store DNA at -20”C.

Plasmid extraction

  1. Isolate a single colony from a freshly streaked selective plate, and inoculate a culture of 1- 5 mLLB medium containing the appropriate selective antibiotic. lnocubate for~12-16hours at 37C with vigorous shaking (~ 300 rpm). Use a 10-20 mL culture tube or a flask with a volume of at least 4 times the volume of the culture. It is strongly recommended that an endA negative strain of E. coli be used for routine plasmid isolation. Examples of such strains include DH5a* and JM1O9.
  2. Centrifuge at 10,O0Ox g for 1 minute at room temperature.
  3. Decant or aspirate and discard the culture media.
  4. Add 250 uL Solution I/RNase A. Vortex or pipet up and down to mix thoroughly.Complete resuspension of cell pellet is vital for obtaining good yields.
  5. Transfer suspension into a new 15 mL microcentrifuge tube.
  6. Add250 uL Solution IL Invert and gently rotate the tube several times to obtain a dear lysate. A 2-3minute incubation may be necessary.
  7. Add 350uL Solution I Immediately invert several times until a flocculent white precipitate forms.
  8. Centrifuge at maximum speed (213,000 x g) for 10 minutes. A compact white pellet will form. Promptly proceed to the next step.
  9. Insert a HiBinde DNA Mini Column into a 2 mL Collection Tube.
  10. Transfer the cleared supernatant from Step 8 by CAREFULLY aspirating it into the HiBind* DNA Mini Column. Be careful not to disturb the pellet and that no cellular debris is transferred to the HiBind" DNA Mini Column.
  11. Centrifuge at maximum speed for 1 minute.
  12. Discard the filtrate and reuse the collection tube.
  13. Add 500 uL HBC Buffer.
  14. centrifuge at maximum speed for 1 minute.
  15. Discard the filtrate and reuse collection tube.
  16. Add 700uL DNA Wash buffer.
  17. Centrifuge at maximum speed for 1 minute.
  18. Discard the filtrate and reuse the collection tube.
  19. Centrifuge the empty HiBind" DNA Mini Column for 2 minutes at maximum speed to dry the column matrix.
  20. Transfer the HiBind DNA Mini Column to a clean 1.5 mL microcentrifuge tube.
  21. Add 30100 uL Elution Buffer or sterile deionized water directly to the center of the column membrane.
  22. Let sit at room temperature for 1 minute.
  23. Centrifuge at maximum speed for 1 minute. Note: This represents approximately 7O% of bound DNA. An optional second elution will yield any residual DNA, though at a lower concentration
  24. Store DNA at -20C.

Transformation

  1. Select the plasmid needed on part and repeat with 10 uL water to dissolve the DNA
  2. All were sucked out and put into 1.5m| plastic centrifuge tube
  3. Place on ice for 30 minutes, mix twice
  4. Put in 42 degrees water bath and heat for 90s
  5. Place on ice for 2 minutes
  6. Add 500ul antibiotic free medium and resuscitate for 40-60 minutes.
  7. Put the bacteria into the culture medium with the head of the spear, and spread with the applicator
  8. Put in 37 degrees of shock culture

    9. Restrictive endonuclease digestion

    1. select plasmid(J04500) for 40ul
    2. add 10ul green buffer
    3. add 46ul distilled water
    4. add 2ul Spe1
    5. add 2ul Pst 1
    6. water bath at 37 degrees for 10 min

    1. select plasmid(K592009) for 40ul
    2. add 10ul green buffer
    3. add 46ul distilled water
    4. add 2ul Xba 1
    5. add 2ul Pst 1
    6. water bath at 37 degrees for 10 min

    Gel recycling

    1. Run electrophoresis separation of the target DNA fragment
    2. Cut off the target DNA fragments, as far as possible the unwanted cut off
    3. The cut of the glue into the 1.5m | plastic centrifuge tube, said the quality of the plastic
    4. Add the same amount of Binding Buffer(XP2), that is, add 0.3m| liquid if 0.3g is weighed
    5. Heat in a 50-60 degree bath for a few minutes until all the glue is melted, stirring to mix.
    6. Put the HiBind DNA Mini Column into the 2ml collection tube
    7. Add the HiBindDNA Mini Column with less than 700ul from the DNA solution in step 5
    8. Centrifuge 60s at 12000rpm at room temperature
    9. Discard the waste liquid and recycle the collection pipe
    10. Repeat steps 7-9 until all samples are transferred to column
    11. Add 300ul Binding Buffer
    12. Centrifuge 60s at 12000rpm at room temperature
    13. Discard the waste liquid and recycle the collection pipe
    14. Add the 700ul SPW Wash Buffer
    15. Centrifuge 60s at 12000rpm at room temperature
    16. Discard the waste liquid and recycle the collection pipe once again in steps 14-16
    17. Centrifuge the empty HiBind DNA Mini Column 1 2000rmp for 2 minutes
    18. The Hibind DNA Mini Column was transferred to 1.5m| plastic centrifuge tube
    19. Add 15-30ul Elution Buffer to the center of the membrane
    20. Let sit at room temperature for 2 minutes
    21. Centrifugation for 12000rmp at room temperature for 1 minute

    Experiments

    Core protein expression

    1.materials

    1. Target gene HCVC, and the codon-optimized sequence connected to the pColdII vector. GGTACCATGAGTACCAATCCGAAACCGCAGCGCAAAACCAAACGTAATACCAATCGTCGTCCGGAAGATG TTAAATTTCCGGGCGGCGGTCAGATTGTGGGCGGCGTTTATCTGCTGCCGCGTCGTGGCCCGCGTCTGGG TGTTCGTACCACCCGTAAAACCAGTGAACGCAGTCAGCCGCGCGGCCGCCGTCAACCTATTCCGAAAGA TCGTCGCAGTACCGGCAAAGCCTGGGGCAAACCGGGCCGTCCGTGGCCTCTGTATGGTAATGAAGGTCT GGGCTGGGCCGGTTGGCTGCTGAGCCCTCGTGGTAGTCGTCCGAGTTGGGGCCCGACCGATCCGCGTCA TCGCAGTCGTAATGTGGGTAAAGTGATTGATACCCTGACCTGTGGCTTTGCAGATCTGATGGGCTATAT TCCGGTGGTTGGCGCACCGCTGAGCGGTGCAGCACGCGCAGTTGCACATGGCGTTCGTGTTCTGGAAGAT GGTGTTAATTATGCCACCGGCAATCTGCCGGGCTTTCCGTTTAGTATTTTTCTGCTGGCCCTGCTGAGCT GTATTACCGTGCCGGTGAGCGCCCTGCAG
    2. genetic map of truncated gene HCVCO173 and HCVCO120
    3. Instruments：
      • PCR machine: ABI 2700
      • Centrifuge machine: Eppendorf 5415D
      • Dyy-6c electrophoresis machine: Beijing liuyi instrument factory
      • Dycp-31dn electrophoresis tank: Beijing liuyi instrument factory
      • SC760 gel electrophoresis image collector: Shanghai shanfu scientific instrument co. LTD
      • 37 ℃ constant temperature incubator: VWR co., LTD
      • Super clean bench: suzhou purification equipment factory
    4. Reagents：
      • Plasmid extraction kit: nantong Biomics
      • Agarose gel recycle kit: nantong Biomics
      • Taq DNA polymerase: nantong Biomics
      • Pfu DNA polymerase: nantong Biomics
      • dNTPs: Shanghai migrant worker
      • T4 DNA Ligase: nantong Biomics Biomics
      • 10x T4 DNA Ligase Buffer: nantong Biomics
      • Endonuclease XhoI: NEB
      • Endonuclease pstI: NEB
      • Buffer 3: NEB
      • BSA: NEB
      • 1 KB plus DNA ladder: Tiangen
      • The primers were all synthesized by nantong Biomics

    2.Experiment procedures ：

    1. Plasmid design
    2. RT-PCR and electrophoresis examination

      Primers:

      Ligating site: Xhol+pstI

      PCR program：

      Condition:
      1. 95℃,5min
      2. 95℃, 30s
      3. 56℃,30s
      4. 72℃,30min
      5. 72℃,2min
      6. repeat 1-5 for 25cycles
      Electrophoresis examination：

      3. Subcloning the gene into pColdII vector plasmid

      Through analysis of sequencing results by DNAStar SeqMan software, recombinant plasmids whose sequencing results were consistent with the original sequence were screened out.

      Lane 1 and 2: recycled enzyme-digested PCR product: O120 and O173 (400bp 550bp) Lane M: Marker (400bp 500bp 850bp 1250bp 1750bp)

      c.Result of examination

      Lane 1: Linear pCold II Lane 2, 3: Enzyme-digested PCR product of O120 and O173 Lane M: 1kb plus DNA Ladder

      d．Recycle of pColdII plasmid and target gene

      Lane 1 and 2: recycled enzyme-digested PCR product: O120 and O173 (400bp 550bp) Lane M: Marker (400bp 500bp 850bp 1250bp 1750bp)

      e．Ligation

      f．Bacterial transformation Heat-shock method.

      g．Colony PCR

      pCold-F：ACGCCATATCGCCGAAAGG

      pCold-R：TGGCAGGGATCTTAGATTCTG

      4. Protein purification

      Stage 1

      SDS-PAGE result

      Result of induced expression