Team:UNSW Australia/Human Practices/Commercialisation

Overview

The commercialisation of scientific research is necessary for the funding of future research. Aware of this fact, UNSW iGEM explored the commercialisation potential of our modular enzyme scaffold. Our research into the commercialisation of our scaffold guided the future directions of our project. We sought the opinion of a number of industry experts to hear where they could see our scaffold fitting into industry, which resulted in numerous new commercialisation case studies, such as Taxol, Levofloxacin and Astaxanthin.

Integrating the information we obtained from industry, we redesigned our project with a focus on scaffolding the enzymes involved in Taxol side-chain synthesis. We designed the relevant DNA sequences relevant for the enzymes and applied our enzyme kinetics and diffusion model to theoretically test the rate of reaction which would be obtained through scaffolding.

Relevance

The foundational advance track exists to allow teams to come up with novel solutions to technical problems. For our solution to be successful for foundational advance, it relies heavily on being able to be integrated into industry and current industrial processes. As a part of our human practices, UNSW iGEM wanted to find and proceed with an application that is both useful to industry and works well with our scaffold. Therefore, a key focus of our project was visiting industry and determining the target market for our scaffold.

The aim of our scaffold is to produce complex high-value compounds for industry from simpler and cheaper substrates by enhancing rates of reaction. We decided that investigating the commerciality of our scaffold and exploring a range of different industrial applications was relevant to our human practices work.

Research & Analysis

Indole Acetic Acid

The proof of concept for our scaffold, synthesising indole acetic acid, was selected prior to considering the future commercialisation plans of our scaffold. Detailed reasoning for our choice of IAA can be found on our design page, however due to its use in previous iGEM scaffolding projects (LIST – On spreadsheet doc), and the ability to experimentally determine the concentration of products formed, IAA synthesis was the ideal candidate for a proof of concept. Although commercialisation of our proof of concept was not initially considered, we investigated the possibility through talking to people who use plant hormones in industry.

EMILY’S DAD – if necessary?

We contacted Amanda Rollason, a Technical Officer with the Australian Botanic Gardens who uses tissue culture methods for rainforest species conservation. Amanda informed us that in her work, and at the Australian Botanic Gardens, they determined that the use of IAA had no benefits in their processes. They instead used Indole butyric acid (IBA) as their rooting hormone.

Amanda kindly passed on our details to Lotte von Richter, a science facilities co-ordinator at the Australian PlantBank, who offered to take us on a tour of PlantBank and show us their tissue culturing methods.

Lotte von Richter

Science Facilities Co-ordinator – PlantBank

Lotte von Richter is the Science Facilities Co-ordinator at the Australian PlantBank, a science and research facility of the Royal Botanic Gardens and Domain Trust. Lotte has over 23 years of experience with the Botanic Gardens Trust, managing the PlantBank research facilities and developing the conservation of Australian native plants through tissue culture and cryopreservation. We contacted Lotte through her colleague Amanda Rollason, a Project Technical Offficer at PlantBank, as we were interested in speaking to someone with experience working with auxins and hope to observe how they are used in a research setting.

During the tour of PlantBank, Lotte showed us all of the equipment and methods that they used for their tissue cultures. We also received some advice as to how we should conduct our own plant experiments.

Pictured (Left to Right): Lotte von Richter, Emily Watson and Bec Schacht (UNSW iGEM members) in PlantBank’s tissue culture room.

After our visit to PlantBank, we decided that the synthesis of IAA using our scaffold was not a worthwhile pathway to commercialise. However, we still wished to experimentally determine the effect of IAA on promoting root growth. Using Lotte’s advice on tissue culturing, we started more plant experiments and applied the knowledge we had learned from PlantBank.

Stereoselective Synthesis

A target market proposed by Prof. Paul Groundwater was products where there is a requirement for a specific enantiomer or diastereomer. Stereoselective synthesis, also known as enantiomeric or asymmetrical synthesis, is defined by IUPAC as “A chemical reaction (or reaction sequence) in which one or more new elements of chirality are formed in a substrate molecule and which produces the stereoisomeric (enantiomeric or diastereoisomeric) products in unequal amounts” (IUPAC, 2006).

Prof. Paul Groundwater

School of Chemistry – University of Sydney

Paul's research interests include the design and synthesis of novel agents for the treatment of cancer and psoriasis; the identification of the active principle of medicinal plants; and new methods for the detection of bacteria. We approached Prof. Groundwater to discuss the potential future applications of our scaffold in regard to drug synthesis and possible drug delivery. He highlighted the significance of stereogenic centres as a candidate for enzymatic synthesis. Many drugs in industry will have an inflated price due to the producers having to separate the required enantiomers from that with the undesirable chirality. Being able to synthesise these drugs enzymatically would remove the need for resolution of the desired compound, potentially reducing the cost of synthesis.

A prime example he gave of this was the synthesis of Taxol side chains. Paclitaxel (Brand name Taxol) is a semi synthetic anti-cancer therapeutic. Its non-synthetic portion is readily available, being derived from conifer trees from New Zealand. However, the synthetic side chain required for its activity and targeted action is difficult to efficiently manufacture. The synthetic site contains two stereogenic centres, and in industrial synthesis, a racemic mixture is produced. Enzymes (potentially attached to our scaffold), could be used to extract the correct enantiomer from solution (Enzyme resolution), by reacting it with the next step of the side chain’s synthesis, whilst leaving the unneeded enantiomer unreacted. The precursor for Paclitaxel synthesis is relatively inexpensive and available for purchase on Sigma-Aldrich. He also suggested synthesis of the antimicrobial agent, Levofloxacin, which is costly to produce, therefore costly to purchase. Levofloxacin contains one stereocentre, and our complex could benefit its production in the same way it would benefit Paclitaxel production, greatly reducing the final product's cost.

Pictured (Left to Right): Prof. Paul Groundwater, Tobias Gaitt and Rebecca Schacht (UNSW iGEM members), and Prof. Andrew McLachlan.

Taxol Side-Chain Synthesis

Taxol, also known as paclitaxel, is an anticancer drug which is often used in chemotherapy for the treatment of ovarian and breast cancers (Croteau et al., 2006). Taxol is traditionally isolated from the Pacific yew tree (Taxus brevifolia) and research into cost-effectively producing Taxol has been ongoing since its isolation in 1967 (Li et al., 2015). Prof. Groundwater suggested that we look into the side-chain synthesis of Taxol, due to the production of a racemic mixture in industrial synthesis. To combat the production of a racemic mixture, biosynthetic pathways, such as the one shown for Taxol in figure 1, can be utilised to ensure the correct stereoisomers are produced (Croteau et al., 2006). However, these biosynthetic pathways are often slow and would benefit from co-localisation.

Figure 1: Overview of the Taxol biosynthetic pathway. Source: (Croteau et al., 2006).

The enzymes identified for the synthesis of the Taxol side-chain are Phenylalanine aminomutase (PAM) and Tyrocidine synthase I (S563A) (TycA-S563A). The enzymes have a slow turnover rate (Kcat of 0.015 /s and 0.05 /s respectively) which could be improved through co-localisation and altering the stoichiometry of the reaction, both of which can be achieved using our scaffold. We tested this assumption with our Enzyme Kinetics and Diffusion model, which showed…

Figure 2: Modelling Results

We have designed the synthetic DNA sequences that would be required to integrate the Taxol enzymes into our scaffold, but due to lack of time, we have not experimentally validated this section of our project. Insert sentence to wrap up taxol.

More case studies…

Integrate

Research into the commercialisation of our scaffold has guided the focus of our project and influenced the experiments we have performed. Through the team’s research into the use of IAA and plant hormones in industry, we have gained information about the commercial applications of IAA and the results of our research have directly influenced the experiments we have performed. This is demonstrated through the introduction of our plant experiments using IAA.

Although the prospects of commercialising our scaffold with a focus on IAA were bleak (due to the discovery that IAA was not widely used in industry), this information pushed the team to explore further applications. Our meeting with Prof. Paul Groundwater gave us a new perspective on the target market of our scaffold. The suggestion to concentrate our research to products in which chirality was an important factor in the synthesis (e.g. Taxol side-chain synthesis and Astaxanthin synthesis) directed our approach into future applications.

At our Symposium, we asked the audience for their opinion on which topic they would like to see advanced by synthetic biology. As 46 % of the respondents voted for pharmaceutical synthesis, we decided to make Taxol our preferred commercial case study. Following this decision, we tested the enzymes involved in Taxol side-chain synthesis with our model to determine the theoretical increase in reaction speed which would occur from co-localisation. We have additionally designed the synthetic DNA sequences that would be required to integrate the Taxol enzymes into our project, but did not get around to experimentally validating this section. We have put the effort into designing these future experiments for another team to be able to pick up from where we left off.

Resources

Guide to create new gBlock sequences for use with our scaffold

gBlock Sequence for 6xHis-PAM-SnoopTag

GAATTCGCGGCCGCTTCTAGATGCACCACCACCATCATCATGGAAGTGGCATGGGGTTTGCCGTGGAATCGCGTTCTCACGTAAAGGATATATTGGGGCT GATCAACGCGTTCAACGAGGTGAAGAAAATTACAGTAGACGGTACGACCCCCATCACGGTGGCCCATGTCGCGGCGCTGGCCCGGAGGCATGACGTGAAG GTTGCGTTGGAGGCGGAGCAATGCAGAGCCCGTGTGGAAACCTGCTCTTCGTGGGTGCAGCGCAAGGCGGAAGACGGCGCCGACATATACGGCGTCACCA CGGGCTTCGGCGCGTGCTCGAGCCGGAGGACCAACCGGCTGAGCGAGCTGCAGGAGTCGCTCATACGCTGCCTGCTCGCGGGGGTGTTTACTAAAGGATG CGCTCCCTCCGTCGACGAGCTCCCCGCGACCGCCACCCGCAGCGCCATGCTGCTCCGCCTTAATAGTTTTACCTATGGATGTTCCGGCATCCGGTGGGAG GTCATGGAAGCGCTGGAAAAGCTTCTCAACAGCAATGTCTCTCCTAAAGTGCCTCTCCGGGGTTCTGTGAGCGCTTCGGGAGACCTCATCCCGCTCGCCT ACATTGCAGGGCTCCTGATCGGGAAGCCTAGCGTAATCGCTCGCATAGGCGACGATGTCGAGGTCCCTGCGCCCGAGGCGTTGAGCAGGGTGGGGCTTCG GCCATTCAAGCTCCAGGCCAAAGAAGGGCTGGCGCTCGTCAACGGCACCTCCTTCGCCACCGCGGTCGCCTCCACCGTCATGTACGACGCCAATGTTCTG TTGCTGCTCGTCGAAACGCTTTGCGGAATGTTCTGCGAGGTGATCTTTGGAAGGGAGGAGTTCGCGCATCCGCTGATCCATAAAGTGAAGCCGCACCCGG GCCAGATCGAATCGGCGGAGCTGCTCGAGTGGCTGCTGCGGTCGAGCCCGTTTCAGGAGCTGTCGAGGGAGTATTACAGTATTGATAAGCTGAAGAAACC GAAACAGGATCGCTATGCTCTGAGGTCGAGCCCGCAGTGGTTGGCTCCTCTGGTGCAGACAATCAGAGACGCCACCACTACAGTGGAGACGGAGGTCAAT TCCGCCAATGATAACCCCATCATTGACCACGCCAATGACAGGGCTCTCCATGGTGCGAATTTCCAGGGCAGCGCCGTCGGTTTCTACATGGACTACGTGC GCATCGCAGTAGCCGGGCTGGGGAAACTCTTGTTCGCTCAGTTCACGGAGCTGATGATCGAATATTACAGCAACGGCCTACCGGGGAACCTCTCCCTGGG GCCGGACCTGAGCGTGGACTACGGCCTCAAGGGGCTCGACATCGCCATGGCCGCCTACAGCTCCGAGCTTCAGTACCTGGCGAATCCCGTGACCACACAC GTGCACAGCGCGGAACAGCACAACCAGGACATCAACTCTCTGGCGCTCATCTCCGCCCGCAAGACGGAGGAGGCGTTGGATATCTTAAAGCTCATGATCG CCTCGCATTTAACAGCAATGTGCCAGGCGGTGGACCTTCGGCAGCTCGAAGAAGCCCTAGTAAAAGTCGTGGAGAATGTCGTTTCCACCCTTGCAGACGA ATGCGGCCTCCCTAACGACACAAAGGCGAGGCTTTTATATGTAGCCAAAGCGGTGCCTGTTTACACATACCTGGAATCCCCCTGCGACCCCACGCTTCCC CTCTTGTTAGGCCTGAAACAGTCCTGTTTCGATACCATTCTGGCTCTCCACAAAAAAGACGGCATTGAGACGGACACCTTGGTCGATCGGCTCGCCGAGT TCGAGAAGCGGCTGTCCGACCGCCTGGAAAACGAGATGACGGCAGTGAGGGTTTTGTACGAAAAGAAAGGGCATAAAACGGCAGACAACAACGACGCCCT CGTGAGAATCCAGGGTTCCAAATTCCTTCCTTTTTACAGATTTGTTCGGGAAGAGCTCGACACAGGTGTGATGAGTGCGAGAAGAGAGCAGACGCCGCAA GAGGACGTGCAGAAAGTGTTCGATGCAATTGCCGACGGCAGAATTACGGTGCCTCTACTGCACTGCCTGCAAGGGTTTCTCGGCCAACCAAATGGGTGCG CCAACGGCGTCGGATCTGGCAAACTTGGGGATATTGAATTTATCAAGGTCAATAAGTAATACTAGTAGCGGCCGCTGCAG

gBlock Sequence for 6xHis-TycA-S563A-SpyTag

GAATTCGCGGCCGCTTCTAGATGCACCACCACCATCATCATGGAAGCATGTTAGCAAATCAGGCCAATCTCATCGACAACAAGCGGGAACTGGAGCAGCA TGCGCTAGTTCCATATGCACAGGGCAAGTCGATCCATCAATTGTTCGAGGAACAAGCAGAGGCTTTTCCAGACCGCGTTGCCATCGTTTTTGAAAACAGG CGGCTTTCGTATCAGGAGTTGAACAGGAAAGCCAATCAACTGGCAAGAGCCTTGCTCGAAAAAGGGGTGCAAACAGACAGCATCGTCGGTGTGATGATGG AGAAGTCCATCGAAAATGTCATCGCGATTCTGGCCGTTCTTAAAGCAGGCGGAGCCTATGTGCCCATCGACATCGAATATCCCCGCGATCGCATCCAATA TATTTTGCAGGATAGTCAAACGAAAATCGTGCTTACCCAAAAAAGCGTCAGCCAGCTCGTGCATGACGTCGGGTACAGCGGAGAGGTAGTTGTACTCGAC GAAGAACAGTTGGACGCTCGCGAGACTGCCAATCTGCACCAGCCCAGCAAGCCTACGGATCTTGCCTATGTCATTTACACCTCAGGCACGACAGGCAAGC CAAAAGGCACCATGCTTGAACATAAAGGCATCGCAATTTGCAATCCTTTTTCCAAAATTCGTTTGGCGTCACCGAGCAAGACAGGATCGGGCTTTTTGCC AGCATGTCGTTCGACGCATCCGTTTGGGAAATGTTCATGGCTTTGCTGTCTGGCGCCACGTGTACATCCTTCCAAACAGACGATCCATGATTTCGCTGCA TTTGAACACTATTTGAGTGAAAATGAATTGACCATCATCACACTGCCGCCGACTTATTTGACTCACCTCACCCCAGAGCGCATCACCTCGCTACGCATCA TGATTACGGCAGGATCAGCTTCCTCCGCACCCTTGGTAAACAAATGGAAAGACAAACTCAGGTACATAAATGCATACGGCCCGACGGAAACGAGCATTTG CGCGACGATCTGGGAAGCCCCGTCCAATCAGCTCTCCGTGCAATCGGTTCCGATCGGCAAACCGATTCAAAATACACATATTTATATCGTCAATGAAGAC TTGCAGCTACTGCCGACTGCGGACGAAGGCGAATTGTGCATCGGCGGAGTCGGCTTGGCAAGAGGCTATTGGAATCGGCCCGACTTGACCGCAGAAAAAT TCGTAGACAATCCGTTCGTACCAGGCGAAAAAATGTACCGCACAGGTGACTTGGCCAAATGGCTGACGGATGGAACGATCGAGTTTCTCGGCAGAATCGA CCATCAGGTGAAAATCAGAGGTCATCGCATCGAGCTTGGCGAAATCGAGTCTGTTTTGTTGGCACATGAACACATCACAGAGGCCGTGGTCATTGCCAGA GAGGATCAACACGCGGGACAGTATTTGTGCGCCTATTATATTTCGCAACAAGAAGCAACTCCTGCGCAGCTCAGAGACTACGCCGCCCAGAAGCTTCCGG CTTACATGCTGCCATCTTATTTCGTCAAGCTGGACAAAATGCCGCTTACGCCAAATGACAAGATCGACCGCAAAGCGTTGCCCGAGCCTGATCTTACGGC AAACCAAAGCCAGGCTGCCTACCATCCTCCGAGAACCGAGACAGAATCGATTCTCGTCTCCATCTGGCAAAACGTTTTGGGAATTGAAAAGATCGGGATT CGCGATAATTTTTACTCGCTCGGCGGAGATTCGATCCAAGCGATCCAGGTCGTGGCTCGTCTGCATTCCTATCAATTGAAGCTAGAGACGAAAGACTTGC TGAATTACCCGACGATCGAGCAGGTTGCTCTTTTTGTCAAGAGCACGACGAGAAAAAGCGATCAGGGCATCATCGCTGGAAACGTACCGCTTACACCCAT TCAGAAGTGGTTTTTCGGGAAAAACTTTACGAATACAGGCCATTGGAACCAATCGTCTGTGCTCTATCGCCCGGAAGGCTTTGATCCTAAAGTCATCCAA AGTGTCATGGACAAAATCATCGAACACCACGACGCCGTCCGCATGGTCTATCAGCACGAAAACGGAAATGTCGTTCAGCACAACCGCGGCTTGGGTGGAC AATTATACGATTTCTTCTCTTATAATCTGACCGCGCAACCAGACGTCCAGCAGGCGATCGAAGCAGAGACGCAACGTCTGCACAGCAGCATGAATTTGCA GGAAGGACCTCTGGTGAAGGTTGCCTTATTTCAGACGTTACATGGCGATCATTTCTTTCTCGCAATTCATCATTTGGTCGTGGATGGCATTTCCTGGCGC ATTTTGTTTAAGATTTGGCAACCGGATACGCGCAGGCACTTGCAGGGCAAGCGATCAGTCTGCCCGAAAAAACGGATTCTTTTCAAAGCTGGTCACAATG GTTGCAAGAATAATGCGAACGAGGCGGATTTGCTGAGCGAGATTCCGTACTGGGAGAGTCTCGAATCGCAAGCAAAAAATGTGTCCCTGCCGAAAGACTA TGAAGTGACCGACTGCAAACAAAAGAGCGTGCGAAACATGCGGATACGGCTGCACCCGGAAGAGACCGAGCAGTTGTTGAAGCACGCCAATCAGGCCTAT CAAACGGAAATCAACGATCTGTTGTTGGCGGCGCTCGGCTTGGCTTTTGCGGAGTGGAGCAAGCTTGCGAAATCGTCATTCATTTGGAGGGGCACGGGCG CGAGGACATCATCGAACAGGCAAACGGTGGCCAGAACGGTCGGATGGTTTACGTCGCAATATCCGGTATTGCTCGACTTGAAGCAAACCGCTCCCTTGTC CGACTATATCAAGCTCACCAAAGAGAATATGCGGAAGATTCCTCGTAAAGGGATCGGTTACGACATCTTGAAGCATGTGACACTTCCAGAAAATCGCGGT TCCTTATCCTTCCGCGTGCAGCCGGAAGTGACGTTCAACTACTTGGGACAGTTTGATGCGGACATGAGAACGGAACTGTTTACCCGCTCACCCTACAGCG GCGGCAACACGTTAGGCGCAGATGGCAAAAACAATCTGAGTCCTGAGTCAGAGGTGTACACCGCTTTGAATATAACCGGATTGATTGAAGGCGGAGAGCT CGTCCTCACATTCTCTTACAGCTCGGAGCAGTATCGGGAAGAGTCCATCCAGCAATTGAGCCAAAGTTATCAAAAGCATCTGCTTGCCATCATCGCGCAT TGCACCGAGAAAAAAGAAGTAGAGCGAACGCCCAGCGATTTCAGCGTCAAAGGTCTCCAAATGGAAGAAATGGACGATATCTTCGAATTGCTTGCAAATA CACTGCGCGGATCAGGAGCCCACATTGTTATGGTTGACGCGTACAAACCAACTAAGTGATACTAGTAGCGGCCGCTGCAG