Team:TUDelft/Wetlab/Protocols

Wetlab Protocols

This protocol is based on the Pierce BCA protein assay kitby Thermo Scientific protocol.

  1. Prepare a set of protein standards using one 2mg/mL Albumin Standard (BSA) ampule according to the table below:
    NOTE: Use the same diluent as the samples. The expected working range = 20-2000µg/mL.
  2. Vial Volume of MilliQ (µL) Source of BSA Volume of source BSA (µL) Final BSA concentration (µg/µL)
    A 0 Stock 300 2000
    B 125 Stock 375 1500
    C 325 Stock 325 1000
    D 175 Vial B 175 750
    E 325 Vial C 325 500
    F 325 Vial E 325 250
    G 325 Vial F 325 125
    H 400 Vial G 100 25
    I 400 n/a 0 0
  3. Determine the amount of total volume of working reagent (WR) required by using the the following formula:
    Total volume WR = (# standards + # unknowns) × (# replicates) × (200 µl)
  4. Prepare the BCA working reagent by mixing 50 parts of BCA Reagent A with 1 part of BCA Reagent B (50:1, Reagent A:B).
    NOTE: The WR is stable for several days when stored in a closed container at room temperature.
  5. Pipette 25µL of each standard or unknown sample replicate into a microplate well.
  6. Add 200µL of the WR to each well and mix plate thoroughly.
  7. Cover plate and incubate at 37°C for 30 minutes.
  8. Cool plate to room temperature.
  9. Measure the absorbance at or near 562nm on a plate reader.

NOTE: All work is performed under asceptic conditions.

  1. For one cryostock, take a 1.5mL sample from an overnight liquid cultures.
  2. Centrifuge the 2mL tubes at 2000rpm for 10 min.
  3. Decant the supernatant without disturbing the pellet.
  4. Add fresh sterile LB medium to the pellet, 1/3 volume of the starting volume of the culture.
  5. Completely resuspended the pellet by vortexing the tube.
  6. Add sterile 80% glycerol solution, the same volume as fresh LB in step 4.
  7. Mix by vortexing.
  8. Make a 1mL aliquot in cryotubes and label it with the cell type, plasmid type, protein type, operator and date.
  9. Store the vials at -80ºC and update the inventory.

This protocol s over 3 days of execution time, starting from a -80°C mother stock. Throughout the protocol, it is recommended to work under aseptic conditions in order to prevent contamination risks.

    Day 1

  1. Keep the -80°C strain stock of interest on ice.
  2. Streak the strain on solid selective medium and incubate overnight at 37 °C while shaking.
  3. Day 2

  4. Prepare a 10mL liquid starter culture with one of the colonies that grew on the selective plate. Let the culture grow overnight at 37°C, shaking at 180rpm.
  5. Sterilise solutions of CaCl2 100 mM and of CaCl2 100 mM + 15 % Glycerol in advance.
    NOTE: Volumes depend on the total culture volume to be prepared in step 5. For example, if 1 L is used in step 7, 300 mL of CaCl2 100 mM and 10 mL of CaCl2 100 mM + 15 % glycerol will be used.
  6. Day 3

  7. Inoculate 1:100 of overnight culture in the desired volume of LB with antibiotic (eg. 10 mL of culture in 1 L of LB).
  8. Incubate in a shaker at 37 °C, 180 rpm to OD600nm ~0.4-0.6 (measure OD600nm every 30 minutes).
  9. Harvests the cells by centrifugation at 4000 x g for 5 minutes in centrifuge tubes, decant supernatant.
  10. Resuspend cells by gently pipetting 1/5 (of the volume of LB from step 5) of ice-cold 100 mM CaCl2 and incubate on ice for 20 minutes.
  11. Pellet the cells by centrifugation at 4000 x g for 5 minutes in centrifuge tubes, decant supernatant.
  12. Resuspend cells by gently pipetting 1/10 (of the volume of LB from step 5) of ice-cold 100 mM CaCl2 and incubate on ice for 60 minutes.
  13. Pellet the cells by centrifugation at 4000 x g for 5 minutes in centrifuge tubes, decant supernatant.
  14. Resuspend cells by gently pipetting 1/100 (of the volume of LB from step 5) of ice-cold 100 mM CaCl2 + 15% glycerol and keep on ice.
  15. Chemical competent cells can either immediately be used for heat shock transformation, or stored in aliquots of 50 µL in microcentrifuge tubes at -80 °C.

  1. Get as many aliquots of competent cells (50 µL) from the -80 °C freezer as transformations to be done and put them on ice for 10-15 min.
    NOTE: Don’t forget positive and negative controls (no DNA). If commercial competent cells (highly efficient) are used, an aliquot of 50 µL can be split in two equal volumes of 25 µL and used for two transformations.
  2. Add DNA of interest to the 50 µL of competent cells.
    1. Gibson Assembly products: 5µL
    2. Ligation products: 5 µL
    3. Plasmid isolates: 2 µL
  3. Incubate on ice for 10-20 minutes.
  4. Heat shock at 42 °C for exactly 45 seconds.
  5. Add 200 µL - 1L of hand-warm LB-medium.
  6. Incubate at 37°C with shaking (250 rpm) for 1 hour.
  7. Plate the cells on LB-agar plates with the correct antibiotic to select. You can plate out 50-75 µL on one plate and the remaining liquid on another.
    NOTE: When adding more than 200 µL LB medium during step 5, plate out 100 µL on selective medium. Then, briefly centrifuge the remaining cell culture and plate out the cell pellet on selective medium.
  8. Incubate plates at 37 °C overnight.
    NOTE: Alternatively, you can incubate over the weekend, leaving the plate on the bench.

  1. Under aseptic conditions, pick a colony, resuspend it in 10 µL of milli-Q water.
    NOTE: A picked colony cannot be used again; it is recommended to restreak on a 'back-up'-plate and incubate it overnight at 37 °C.
  2. Incubate the resuspended colony at 90 °C for 10 min. Spin the suspension down and use the supernatant as template DNA for the PCR.
    NOTE: Instead of separate boiling prior to PCR, this step can be incorporated in the PCR program. The initial denaturation step at 98 °C should then be prolonged to 5 minutes.
  3. Make sure every PCR reaction is composed as follows:
    Component Volume (µL) Final concentration
    GoTaq 5x buffer* 10 1 X
    10 mM dNTPs 1 200 µM
    Primer forward (10µM) 1 200 nM
    Primer reverse (10µM) 1 200 nM
    Boiled colony supernatant 5
    Gotaq polymerase (5u/µL) 0.2 20 U/mL
    MilliQ 31.8
    * NOTE: Use GoTaq Buffer Green when it is required to run a verification gel afterwards.
  4. Add 5 µL of supernatant of colony mixture to each PCR tube.
  5. Close all tubes thoroughly and place them in a thermocycler with the following protocol:
    Step Time (s) Temperature (°C)
    Initial denaturation 150 98
    Denaturation 60 94
    Annealing 60 Tann*
    Extension 60 sec per kb DNA 72
    Final extension 600 72
    Hold 4
    *NOTE: The annealing temperature (Tann) is dependent on the melting temperature (Tm) of the primers used. It is recommended to have Tann = Tm - 5°C.
  6. The PCR product(s) can be checked on gel. In order to do so, cast a gel and prepare the samples according to the DNA electrophoresis protocol.

The generation of dextrin-capped gold nanoparticles generation was performed according to the protocol described by Anderson et al. 2011.

  1. Prepare the following solutions:
    1. 20 mM Gold Chloride salt (HAuCl4) in MiliQ. Store under refrigeration.
    2. 25 g/L Dextrin in MiliQ.
    3. Sodium Carbonate (Na2CO3) 10 % (w/v) in MiliQ.
    4. dH2O pH=9, adjusted with sodium hydroxide (NaOH).
  2. Add 25 mL of the dextrin solution (25 g/L) to a sterile 250 mL flask.
  3. Add 5 mL of the Gold Chloride salt solution (20 mM) .
  4. Adjust pH of the solution to pH=9 with sodium carbonate (Na2CO3) 10 % (w/v) by checking the pH with pH indicator strips.
  5. Complete the reaction mixture by adding dH2O pH=9 up to a total reaction volume of 50 mL.
  6. Incubate the flask at 50 ºC in the dark with continuous shaking (250 rpm) for 3 hours.
  7. Measure the absorbance spectrum of the sample every 20 minutes.
    NOTE: Change in color to red is the final indication of the ion Au+3 reduction to Au0.
  8. When the reaction mixture shows aa clear shift in color to red, stop the reaction and store the dextrin-capped gold nanoparticle batch at room temperature in a closed glass container in the dark.

Evaluating of the functionality of dextrin-capped gold nanoparticles is performed in a 96 well plate. There are several analysis being conducted, which are:

  • Salt stability
  • ssDNA induced stability.
  • ssDNA and target DNA stability.

The following table indicates different solutions needed for each evaluation:

Analysis d-AuNPs (µL) ssDNAp (µL) NaCl solution (X mM) (µL) dsDNA target (µL) MilliQ / Hybridization buffer (µL)
Salt stability 20 0 20 0 20
ssDNA induced stability 20 4 20 0 16
ssDNA and target dsDNA induced stability 20 4 20 100 6

For each specific functionality testing reaction, perform the following steps directly in the wells of the 96 wells plate, unless indicated otherwise.

Salt Stability

  1. Add 20 µL of MilliQ.
  2. Add 20 µL of NaCl solutions (varying concentrations).
  3. Use one well as salt blank by adding 20 µL MilliQ instead of NaCl solution.
  4. Add 20 µL of d-AuNPs.
  5. Mix gently by pipetting and incubate at 21 ºC during 10 minutes.
  6. Quantify the visible absorption spectrum of the solutions or measure absorbance at 520 nm and 620 nm.

ssDNAp Induced Stability

  1. Add 4 µL of ssDNAp (1 µM).
  2. Use one wells as ssDNAp blank by adding 4 µL MilliQ instead of ssDNAp.
  3. Add 16 µL of MilliQ.
  4. Add 20 µL of NaCl solutions (varying concentrations).
  5. Use one well as salt blank by adding 20 µL MilliQ instead of NaCl solution.
  6. Add 20 µL of d-AuNPs.
  7. Mix gently by pipetting and incubate at 21 ºC during 10 minutes.
  8. Quantify the visible absorption spectrum of the solutions or measure absorbance at 520 nm and 620 nm.

ssDNAp and dsDNA Target Induced Stability

Prepare the following reaction in a PCR tube:

  1. Add 4 µL of ssDNAp (1 µM).
  2. Use one well as ssDNAp blank by adding 4 µL MilliQ instead of ssDNAp.
  3. Add 10 µL of dsDNA target (~1 nM).
  4. Add 6 µL of Hybridization buffer.
  5. Mix gently by pipetting and add tubes on thermal cycler with the following program:
    Step Time (s) Temperature (°C)
    Denaturation 300 95
    Annealing 60 57
    Relaxation 600 20
  6. Add 20 µL of the reaction mixture into the wells of 96 well plate
  7. Add 20 µL of NaCl solutions (varying concentrations or defined concentration based on previous results).
  8. Use one well as salt blank by adding 20 µL MilliQ instead of NaCl solution.
  9. Add 20 µL of d-AuNPs.
  10. Mix gently by pipetting and incubate at 21 ºC during 10 minutes.
  11. Quantify the visible absorption spectrum of the solutions or measure absorbance at 520 nm and 620 nm.

Gel Electrophoresis and DNA staining makes use of mutagenic chemicals like EtBr, SYBR Safe or any other DNA staining. Wear protection (gloves) when carrying out this protocol and work in an assigned area for this work to prevent contamination of the rest of the lab.

  1. Weigh agarose powder for a 0.8% (w/v) gel in TAE.
    E.g. weigh 1.6g and add to 200mL TAE buffer for a 0.8% gel.
  2. Add weighed agarose in TAE buffer (1X) and warm the solution (in a microwave) until it is completely dissolved. Let the solution cool down to hand warm temperature.
    NOTE: Make sure the lid is not completely closed to avoid possible exploding of the glass bottle.
  3. Pour gel in gel tray and mix well with SYBR Safe. For a small gel (~ 40 mL solution) add 1 µL of SYBR Safe; for a large gel (~80 mL) add 2 µL of SYBR Safe. Add a comb to create wells for the samples. Allow the agarose to solidify (approximately 20 minutes).
  4. Transfer the gel to the electrophoresis cell, remove the combs and cover the gel in TAE buffer (1X).
    NOTE: Mind the direction of DNA migration when placing the gel in the cell.
  5. Prepare the electrophoresis samples by adding Nucleic Acid Loading Buffer conform the manufacturer’s instructions.
  6. Load the molecular weight marker (DNA ladder) in the first well according to manufacturer’s instructions (generally 3-5 µL) and load 5-10 µL of the dyed samples in the other wells.
    NOTE: Do not contaminate the loading buffer and ladder with SYBR Safe! Do not touch it while wearing a glove.
  7. Connect the cables of the gel tray following the colour code and run at 80-110V for 40-60 min.
    NOTE: Mind the direction of DNA migration when placing the lid on the cell.
    NOTE: Time and voltage depend on the density of the gel and the length of the lane in the gel.

This protocol is based on the Wizard® SV Gel and PCR Clean-Up System of Promega Corporation.

  1. Place the excised gel slice in a 1.5 mL Eppendorf tube.
  2. Add 10 µL Membrane Binding Solution per 10 mg of gel slice. Vortex and incubate at 50-65 °C until gel slice is completely dissolved.
  3. Insert the SV Minicolumn into Collection Tube and label both of them according to the labelling of your samples.
  4. Transfer the dissolved gel mixture to the Minicolumn assembly. Incubate the Minicolumn at room temperature for 1 minute.
  5. Centrifuge the SV Minicolumn at maximum speed for 1 minute.
  6. Discard the flow through and reinsert the SV Minicolumn into the Collection Tube.
  7. Add 700µL of Membrane Wash Solution.
    NOTE: Upon prior use, dilute the solution with 95% ethanol following the manufacturer's’ instructions.
  8. Centrifuge the SV Minicolumn assembly at maximum speed for 1 minute.
  9. Discard the flow through and reinsert the SV Minicolumn into the Collection Tube.
  10. Repeat the washing step with 500µL of Membrane Wash Solution and centrifuge for 5 minutes at maximum speed.
  11. Once the Collection Tube is empty, centrifuge the Minicolumn assembly at maximum speed for 1 minute with the microcentrifuge lid open to allow ethanol full evaporation.
    NOTE: Leaving the column at room temperature ameliorates evaporation of residual ethanol traces.
  12. Transfer the SV Minicolumn to a clean labelled 1.5 mL Eppendorf tube.
  13. Add 50 µL of pre-warmed MilliQ directly to the centre of the SV Minicolumn, without touching the membrane with the pipette tip.
    NOTE: Use 30 µL when higher final concentrations of DNA are required or when small quantities of DNA are suspected.
  14. Incubate the SV Minicolumn at room temperature for 5 minutes.
  15. Centrifuge at maximum speed for 1 minute.
  16. Discard the SV Minicolumn, cap the tube containing the eluted DNA and keep the DNA at 4 °C (for immediate use) or -20 °C (for storage).

Our DpnI digestions were performed with New England Biolabs DpnI (20.000 units/mL), which is compatible with CutSmart Buffer by the same manufacturer.

  1. Prepare a sample in a 0.5 mL microcentrifuge tube as follows:
    Component Volume (µL)
    10x CutSmart buffer (NEB) 4
    Purified PCR product 30
    Restriction Enzyme DpnI 1
    MilliQ 5
  2. Incubate for 1.5 hours at 37°C.
  3. Heat inactivate the enzyme by incubating at 80oC for 20 minutes.

This protocol describes how we evaluated the functionality of the gRNA:dxCas9:DNA complex or the gRNA:dxCas9-Tn5:DNA complex to bindt to the target DNA using a mobility assay. The protocol consists of two parts: binding of dxCas9(-Tn5) to the gRNA and binding of the gRNA:dxCas9(-Tn5) to the target DNA

gRNA:dxCas9(-Tn5) complex formation

NOTE: all samples and reagents are kept on ice during preparation.
  1. Load the purified dxCas9 or dxCas9-Tn5 protein with gRNA provided by Arbor Biotechnologies by adding the following components:
    1. 1-100nM dxCas9 or dxCas9-Tn5
    2. 1.6-160nM gRNA
    3. NOTE: the gRNA and dxCas9 or dxCas9-Tn5 is mixed in a 1:1.6 molar ratio.
    4. 10x functionality buffer (20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol, 10mM MgCl2 pH 7.5)
    5. MilliQ (add up to a final volume of 10µL)
  2. Pipette the reagents in the following order in a 0.5 mL tube: MilliQ, 10x functionality buffer, dxCas9 or dxCas9-Tn5 protein and gRNA.
  3. Incubate at 37°C for 10 minutes.

gRNA:dxCas9(-Tn5):Target DNA complex formation

  1. Add 1nM Target DNA (our case EPO cDNA) to the gRNA:dxCas9 or gRNA:dxCas9-Tn5 complex.
  2. Incubate at 37°C for 1 hour.
  3. Analyse the samples on a 5% native TBE polyacrylamide gel to observe the mobility shift.

This protocol describes how we evaluated the trypsin resistance of the gRNA-loaded dxCas9 and dxCas9-Tn5 proteins due to a protein conformational change. The protocol consists of two parts: binding of dxCas9(-Tn5) to the gRNA and the trypsin resistance assay

gRNA:dxCas9(-Tn5) complex formation

NOTE: all samples and reagents are kept on ice during preparation.
  1. Load the purified dxCas9 or dxCas9-Tn5 protein with gRNA provided by Arbor Biotechnologies by adding the following components:
    1. 1-100nM dxCas9 or dxCas9-Tn5
    2. 1.6-160nM gRNA
    3. NOTE: the gRNA and dxCas9 or dxCas9-Tn5 is mixed in a 1:1.6 molar ratio.
    4. 10x functionality buffer (20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol, 10mM MgCl2 pH 7.5)
    5. MilliQ (add up to a final volume of 10µL)
  2. Pipette the reagents in the following order in a 0.5 mL tube: MilliQ, 10x functionality buffer, dxCas9 or dxCas9-Tn5 protein and gRNA.
  3. Incubate at 37°C for 10 minutes.

Trypsin Resistance Assay

  1. Add 0.1-10nM Trypsin to the gRNA:dxCas9 or gRNA:dxCas9-Tn5 complex.
  2. Incubate at 23°C for 30 minutes.
  3. Analyse the samples on a 8% SDS Tris-Glycine polyacrylamide gel to observe the trypsin resistance.

This protocol spans over 3 days of execution time, starting from a -80 °C mother stock. Throughout the protocol, it is recommended to work under aseptic conditions in order to prevent contamination risks.

    Day 1

  1. Sterilize the required 50 mL MilliQ and 250 µL glycerol in advance.
  2. Keep the -80 °C strain stock of interest on ice.
  3. Streak the strain on solid selective medium and incubate overnight at 37 °C.
  4. Day 2

  5. Prepare a 10mL liquid starter culture with one of the colonies that grew on the selective plate. Let the culture grow overnight at 37 °C, shaking at 180rpm.
  6. Day 3

  7. Use 0.5mL of the starter culture to inoculate 35mL selective liquid medium and keep track of the OD600.
  8. Grow at 37°C while shaking 250 rpm till an OD600 of ~0.5.
  9. Centrifuge for 10 minutes at 4 °C at 3900 rpm.
  10. Discard the supernatant and resuspend pellet in 20 mL cold Milli-Q.
  11. Centrifuge for 10 minutes at 4 °C at 3900 rpm.
  12. Discard the supernatant and resuspend pellet in 20 mL cold Milli-Q.
  13. Centrifuge for 10 minutes at 4 °C at 3900 rpm.
  14. Discard supernatant and resuspend in 200 µL 50% glycerol.
  15. Prepare aliquots of 50 µL.
  16. Either transform the electrocompetent cells straight away or store the electrocompetent cells at -80 °C.

NOTE: This protocol allows for a single transformation.

  1. Thaw a 50 µL aliquot of electrocompetent cells on ice.
  2. Add ~200 ng DNA to the cells and keep on ice for 20 minutes.
    NOTE: in case of purified plasmid DNA, 50 ng DNA is enough.
  3. Transfer all the content to an electro-shock cuvette.
  4. Electro-shock the cells with the Electro Cell Manipulator at 2.5 kV.
  5. Immediately add 0.2-1 mL of recovery medium (eg. SOC-medium). Resuspend and transfer to a 1.5 mL tube.
  6. Incubate at 37 °C at 250 rpm for 1 hour.
  7. Plate the cells on solid medium with appropriate antibiotics and incubate overnight at 37 °C.

This protocol is based on the instructions for G-Block resuspension given by Integrated DNA Technologies (IDT).

  1. Centrifuge the tube containing the gBlock for 3−5 seconds (>3,000 x g) to pellet the material to the bottom of the tube.
  2. Add an appropriate volume of sterile Milli-Q to the tube for a desired final concentration. The required volume of Milli-Q can be read from the table below (and the label on the IDT tube that contains your fragment):
    Final concentration (ng/µL) µL MilliQ to add to 250 ng µL MilliQ to add to 250 ng µL MilliQ to add to 250 ng
    10 25 50 100
    20 not recommended 25 50
    50 not recommended 10 20
  3. Incubate at 50°C for 20 minutes.
  4. Briefly vortex and centrifuge.
  5. Store the resuspended gBlock at -20 °C.

This protocol is based on MO BIO Laboratories Inc. UltraClean® Microbial DNA Isolation Kit. For more information on the composition of the MD solutions, and for safety precautions, we recommend consulting MO BIO Laboratories’ kit manual..

  1. Add 1.8 ml of microbial (bacteria, yeast) culture to a 2 ml Collection Tube (provided) and centrifuge at 10,000 x g for 30 seconds at room temperature. Decant the supernatant and spin the tubes at 10,000 x g for 30 seconds at room temperature and completely remove the media supernatant with a pipette tip. NOTE: Based on the type of microbial culture, it may be necessary to centrifuge longer than 30 seconds.
  2. Resuspend the cell pellet in 300 µl of MicroBead Solution and gently vortex to mix. Transfer resuspended cells to MicroBead Tube.
  3. Check Solution MD1. If Solution MD1 is precipitated, heat the solution at 60C until the precipitate has dissolved. Add 50 µl of Solution MD1 to the MicroBead Tube.
  4. Optional: To increase yields, to minimize DNA shearing, or for difficult cells, see Alternative lysis methods in the “Hints & Troubleshooting Guide” section before continuing.
  5. Secure MicroBead Tubes horizontally using the MO BIO Vortex Adapter tube holder for the vortex (MO BIO Catalog# 13000-V1) or secure tubes horizontally on a flat-bed vortex pad with tape. Vortex at maximum speed for 10 minutes. (See “Hints & Troubleshooting Guide” for less DNA shearing).
  6. Make sure the 2 ml MicroBead Tubes rotate freely in the centrifuge without rubbing. Centrifuge the tubes at 10,000 x g for 30 seconds at room temperature. CAUTION: Be sure not to exceed 10,000 x g or tubes may break.
  7. Transfer the supernatant to a clean 2 ml Collection Tube (provided). Expect 300 to 350 µl of supernatant.
  8. Add 100 µl of Solution MD2, to the supernatant. Vortex for 5 seconds. Then incubate at 4C for 5 minutes.
  9. Centrifuge the tubes at room temperature for 1 minute at 10,000 x g.
  10. Avoiding the pellet, transfer the entire volume of supernatant to a clean 2 ml Collection Tube (provided). Expect approximately 450 µl in volume.
  11. Shake to mix Solution MD3 before use. Add 900 µl of Solution MD3 to the supernatant and vortex for 5 seconds.
  12. Load about 700 µl into the Spin Filter and centrifuge at 10,000 x g for 30 seconds at room temperature. Discard the flow through, add the remaining supernatant to the Spin Filter, and centrifuge at 10,000 x g for 30 seconds at room temperature. NOTE: A total of 2 to 3 loads for each sample processed are required. Discard all flow through liquid.
  13. Add 300 µl of Solution MD4 and centrifuge at room temperature for 30 seconds at 10,000 x g.
  14. Discard the flow through.
  15. Centrifuge at room temperature for 1 minute at 10,000 x g.
  16. Being careful not to splash liquid on the spin filter basket, place Spin Filter in a new 2 ml Collection Tube (provided)
  17. Add 50 µl of Solution MD5 to the center of the white filter membrane.
  18. Centrifuge at room temperature for 30 seconds at 10,000 x g.
  19. Discard Spin Filter. The DNA in the tube is now ready for any downstream application. No further steps are required. Store the DNA at -20C until further use.

This Gibson Assembly protocol is based on the protocol provided by New England Biolabs.

  1. Thaw 10 µL of 2x Gibson Assembly mastermix (New England Biolabs) on ice.
  2. Add backbone and insert; depending on the assembly, assembly pieces can be added in a predetermined ratio (recommended is ratio 1:3 mol vector over mol insert, so not a 1:3 ratio based on weight). Do not exceed the total volume of 10µL.
    NOTE: An online ligation calculator can subsequently be used to calculate the amount of the assembly pieces that is required.
  3. If applicable, fill up the reaction volume to 20µL with Milli-Q.
    Component Volume (µL)
    Gibson Assembly Master Mix 2X (NEB) 10
    Vector X (? ng)
    Insert fragment Y (? ng)
    MilliQ 10-X-Y
  4. Incubate the assembly reaction at 50 °C for 60 minutes and place on ice for subsequent chemical transformation or electroporation. Otherwise, store at -20°C.

This protocol is based on the standard RNA synthesis of the New England Biolabs T7 RNA Polymerase.

  1. The following components should be assembled at room temperature in the following order:
    Component Volume (µL)
    10x Reaction Buffer 2
    NTP (each 25mM) 4
    Template DNA X (0.2 - 1 µg)
    RNase Inhibitor 1 U/µL (final)
    DTT 5 mM (final)
    T7 RNA Polymerase 2
    MilliQ add up to 20 µL
  2. The reaction is incubated at 37oC for 4-16 hours.
  3. The following sequence is used as the template DNA, in which “n” can be substituted to match the target DNA.

    TAATACGACTCACTATAGGnnnnnnnnnnnnnnnnnnnGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT

  4. Clean up sgRNA product(s) according to the RNA Clean Up protocol.

  1. For each PCR in 50µL reaction volume, make sure the composition is as follows:
    Component Volume (µL) Final concentration
    5x Phusion HF buffer 10 1 X
    10 mM dNTPs 1 200 µM
    Primer forward (10µM) 2.5 200 nM
    Primer reverse (10µM) 2.5 200 nM
    DNA template ~10 ng to 250 ng*
    Phusion polymerase 0.5 20 U/mL
    MilliQ up to 50 µL
    * NOTE: The 10 ng - 250 ng of template DNA are approximate, choose a volume that works fine for all your samples.
    NOTE: High fidelity PCR with Phusion polymerase can be optimized per case by adding 3% of DMSO.
  2. Close all tubes thoroughly and place them in a thermocycler with the following protocol:
    Step Time (s) Temperature (°C)
    Initial denaturation 30 98
    Denaturation 10 98
    Annealing 15 Tann*
    Extension 15-30 sec per kb DNA 72
    Final extension 300 72
    Hold 4
    * NOTE: The annealing temperature (Tann) is dependent on the melting temperature (Tm) of the primers used. It is recommended to have Tann = Tm - 5°C.
  3. The PCR product(s) can be checked on gel. In order to do so, cast a gel and prepare the samples according to the DNA electrophoresis protocol.

  1. Thaw the ligase buffer on ice, to prevent damaging the ATP.
  2. Prepare a sample as follows:
    Component Volume (µL)
    10x Ligase buffer 2
    T4 DNA Ligase 1
    DNA vector X (~100 ng)
    DNA fragment Y*
    MilliQ 20-X-Y
    * NOTE: The desired vector:insert ratio will be 1:3. Use a ligation calculator to calculate the amounts of vector DNA and insert DNA to be added.
  3. Incubate for at least one hour at 4 °C. Optimally, incubate overnight at 4 °C.

  1. Dissolve Luria Broth powder in water according to instructions by manufacturer.
  2. Heat sterilize (121°C) the medium in the autoclave.
  3. After cooling down, add the required antibiotic under aseptic conditions.
    NOTE: With our antibiotic stock solutions of 1000x we used 1 µL of antibiotic solution per mL of LB-agar.
  4. Store the medium at 4 °C if complemented with antibiotics.

  1. Label as many 15 mL Falcon tubes/Erlenmeyer flasks as the number of colonies you want to grow.
  2. Under aseptic conditions, distribute 10 mL of liquid medium (LB or SOC) for each starter culture.
    NOTE: Supply with relevant antibiotics.
  3. Under aseptic conditions, pick a colony with the inoculation loop and swirl it in the starter culture to inoculate.
    NOTE: A picked colony cannot be used again; it is recommended to restreak on a 'back-up'-plate and incubate it overnight at 37 °C.
  4. Grow the liquid cultures at 37 °C overnight, shaking at 250 rpm.

This protocol intends to quantify DNA, as well as the purity, in isolates, through spectroscopy. Make sure the Nanodrop machinery is installed to measure at wavelengths for dsDNA (260nm) and impurities at 230nm and 280nm.

  1. Clean the measurement surface with a piece of tissue and ethanol.
  2. Use 1 µL of sterile milli-Q as a blank.
  3. Clean the measurement surface with a piece of tissue.
  4. Use 1 µL of a sample to measure its concentration.
    NOTE: It is best to measure the same sample in triplo and use the average value. If you have multiple samples, clean the measurement surface in between measurements.
  5. When done measuring, wipe the measurement surface with a tissue and ethanol.

This protocol intends to quantify protein, as well as the purity, in isolates, through spectroscopy. Make sure the Nanodrop machinery is installed to measure at wavelengths for 280nm and 260nm.

  1. Clean the measurement surface with a piece of tissue and ethanol.
  2. Use 2 µL of sterile milli-Q as a blank.
  3. Clean the measurement surface with a piece of tissue.
  4. Use 2 µL of a sample to measure its concentration.
    NOTE: It is best to measure the same sample in triplo and use the average value. If you have multiple samples, clean the measurement surface in between measurements.
  5. When done measuring, wipe the measurement surface with a tissue and ethanol.

This protocol intends to quantify RNA, as well as the purity, in isolates, through spectroscopy. Make sure the Nanodrop machinery is installed to measure at wavelengths for ssRNA (260nm) and impurities at 230nm and 280nm.

  1. Clean the measurement surface with a piece of tissue and ethanol.
  2. Use 1 µL of sterile milli-Q as a blank.
  3. Clean the measurement surface with a piece of tissue.
  4. Use 1 µL of a sample to measure its concentration.
    NOTE: It is best to measure the same sample in triplo and use the average value. If you have multiple samples, clean the measurement surface in between measurements.
  5. When done measuring, wipe the measurement surface with a tissue and ethanol.

A native PAGE electrophoresis is used to separate DNA based on their size by using an electric current. This protocol describes how to prepare a native PAGE gels, how to prepare samples and how to run the electrophoresis.
NOTE: In this protocol we use a 5% separation gel (this is for DNA samples between 50 bp and 1,000 bp).

Preparing the native PAGE gel

  1. Prepare the following solutions for 2 gels (total 12 mL):
    Component Volume
    40% Acrylamide 1.5 mL
    10x TBE buffer 1.2 mL
    10% APS 120µL
    TEMED 12 µL
    MilliQ 9.168mL
    NOTE: Polymerization will start when 10% APS and TEMED is added.
  2. Assemble the casting station and pour the separation gel between the glass plates.
  3. Immediately place the gel comb on top of the gel.
  4. Allow the gel to solidify, then remove the plates from the casting station.
  5. The gels are ready for usage, or can be stored at 4 °C for later usage.
  6. Preparing samples

  7. Add 2μL protein 6x Loading Dye to 10μL of sample.
  8. Running PAGE gel

  9. Run the gel at 150 V and 25 mA.
  10. The gel is finished when the purple line is at the end of the gel.
  11. Processing PAGE gel: Ethidium bromide staining

  12. Turn off the power pack before opening the gel box.
  13. Remove the gel from the cassette and place the gel in a clean staining tray of the appropriate size filled with a layer of MilliQ or TBE buffer.
  14. Gently allow the gel to slide from the glass plate into the water.
  15. Add 1 µL of Ethidium bromide into the water.
  16. Allow the gel to shake on a moving platform for 10 minutes.
  17. Take a picture with the Gel doc system/Typhoon.

A native PAGE electrophoresis is used to separate DNA based on their size by using an electric current. This protocol describes how to prepare a native PAGE gels, how to prepare samples and how to run the electrophoresis.
NOTE: In this protocol we use a 5% separation gel (this is for DNA samples between 50 bp and 1,000 bp).

Preparing te native PAGE gel

  1. Prepare the following solutions for 2 gels (total 12 mL):
    Component Volume
    40% Acrylamide 1.5 mL
    10x TBE buffer 1.2 mL
    10% APS 120µL
    TEMED 12 µL
    MilliQ 9.168mL
    NOTE: Polymerization will start when 10% APS and TEMED is added.
  2. Assemble the casting station and pour the separation gel between the glass plates.
  3. Immediately place the gel comb on top of the gel.
  4. Allow the gel to solidify, then remove the plates from the casting station.
  5. The gels are ready for usage, or can be stored at 4 °C for later usage.
  6. Preparing samples

  7. Add 2μL protein 6x Loading Dye to 10μL of sample.
  8. Running PAGE gel

  9. Run the gel at 150 V and 25 mA.
  10. The gel is finished when the purple line is at the end of the gel.
  11. Processing PAGE gel: Silver staining

  12. Turn off the power pack before opening the gel box.
  13. Remove the gel from the cassette and place the gel in a clean staining tray of the appropriate size filled with a layer of MilliQ or TBE buffer.
  14. Gently allow the gel to slide from the glass plate into the water.
  15. Discard the water.
  16. Prepare the following solutions for silver staining with SilverQuest Silver staining kit.
    Solution Components
    Fixing solution 10mL Acetic Acid
    40mL Ethanol
    50mL MilliQ
    Sensitizing solution 30mL Ethanol
    10mL Sensitizer
    60mL MilliQ
    Staining solution 1mL Silver Stainer
    100mL MilliQ
    Developing solution 10mL Developer
    1 drop Developer Enhancer
    90mL MilliQ
    NOTE: All incubations are performed on a rotary shaker rotating at a speed of 1 revolution/second at room temperature.
  17. Cover the gel with 100mL fixing solution for one hour with gentle rotation.
    NOTE: The gel can be stored in the fixative overnight if there is not enough time to complete the staining protocol.
  18. Decant the fixative solution and wash the gel in 30% ethanol for 10 minutes.
  19. Decant the ethanol and wash the gel in 100 mL of Sensitizing solution for 10 minutes.
  20. Decant the Sensitizing solution and wash the gel in 100 mL of 30% ethanol for 10 minutes.
  21. Decant the 30% ethanol and wash the gel in 100 mL of ultrapure water for 10 minutes.
  22. Decant the water and indicate the gel in 100 mL of Staining solution for 15 minutes.
  23. Decant the Staining solution and wash the gel with 100 mL of ultrapure water for 20–60 seconds.
    Note: Washing the gel for more than a minute will remove silver ions from the gel resulting in decreased sensitivity.
  24. Incubate the gel in 100 mL of Developing solution for 4–8 minutes until bands start to appear and the desired band intensity is reached.
  25. After the appropriate staining intensity is achieved, immediately add 10 mL of Stopper directly to the gel still immersed in Developing solution.
  26. Gently agitate the gel for 10 minutes.
    Note: The color changes from pink to colorless indicating that the development has stopped.
  27. Decant the Stopper solution and wash the gel with 100 mL of ultrapure water for 10 minutes.
  28. Take a picture with the Gel doc system.

This protocol is based on the Wizard® SV Gel and PCR Clean-Up System of Promega Corporation.

  1. Add an equal volume of Membrane Binding Solution to the volume of PCR product.
  2. Insert the SV Minicolumn into Collection Tube and label both of them according to the labelling of your samples.
  3. Transfer the dissolved gel mixture to the Minicolumn assembly. Incubate the Minicolumn at room temperature for 1 minute.
  4. Centrifuge the SV Minicolumn at maximum speed for 1 minute.
  5. Discard the flow through and reinsert the SV Minicolumn into the Collection Tube.
  6. Add 700µL of Membrane Wash Solution.
    NOTE: Upon prior use, dilute the solution with 95% ethanol following the manufacturer's’ instructions.
  7. Centrifuge the SV Minicolumn assembly at maximum speed for 1 minute.
  8. Discard the flow through and reinsert the SV Minicolumn into the Collection Tube.
  9. Repeat the washing step with 500µL of Membrane Wash Solution and centrifuge for 5 minutes at maximum speed.
  10. Once the Collection Tube is empty, centrifuge the Minicolumn assembly at maximum speed for 1 minute with the microcentrifuge lid open to allow ethanol full evaporation.
    NOTE: Leaving the column at room temperature ameliorates evaporation of residual ethanol traces.
  11. Transfer the SV Minicolumn to a clean labelled 1.5 mL Eppendorf tube.
  12. Add 50 µL of pre-warmed MilliQ directly to the centre of the SV Minicolumn, without touching the membrane with the pipette tip.
    NOTE: Use 30 µL when higher final concentrations of DNA are required or when small quantities of DNA are suspected.
  13. Incubate the SV Minicolumn at room temperature for 5 minutes.
  14. Centrifuge at maximum speed for 1 minute.
  15. Discard the SV Minicolumn, cap the tube containing the eluted DNA and keep the DNA at 4 °C (for immediate use) or -20 °C (for storage).

This protocol is based on the protocol supplied with the Promega PureYield™ Plasmid Miniprep Kit of Promega Corporation.

  1. Centrifuge 1.5-3mL of a liquid (starter) culture for 1 minute in a 1.5mL microcentrifuge tube at maximum speed.
  2. Discard the supernatant and resuspend in 600µL of Milli-Q.
  3. Add 100 µL of Cell Lysis Buffer, and mix by inverting the tube.
  4. Add 350 µL of cold (4–8 °C) Neutralization Solution, and mix thoroughly by inverting.
  5. Centrifuge at maximum speed in a microcentrifuge for 3 minutes.
  6. Transfer the supernatant (~900 µl) to a PureYield™ Minicolumn without disturbing the cell debris pellet.
  7. Place the minicolumn into a Collection Tube and centrifuge at maximum speed in a microcentrifuge for 15 seconds.
  8. Discard the flow through, and place the minicolumn into the same Collection Tube.
  9. Add 200 µl of Endotoxin Removal Wash (ERB) to the minicolumn. Centrifuge at maximum speed in a microcentrifuge for 15 seconds.
  10. Add 400 µl of Column Wash Solution (CWC) to the minicolumn. Centrifuge at maximum speed in a microcentrifuge for 30 seconds.
  11. Transfer the minicolumn to a clean, labelled 1.5 ml microcentrifuge tube, then add 30 µl of sterile Milli-Q directly to the minicolumn matrix. Incubate for 1 minute at room temperature.
  12. Centrifuge for 15 seconds to elute the plasmid DNA. Discart the column and label the tube. The isolate should be stored at -20°C.

This protocol is based on the instructions for primer resuspension given by Integrated DNA Technologies (IDT).

  1. Centrifuge the tube containing the primer for 3−5 seconds (>3,000 x g) to pellet the material to the bottom of the tube.
  2. Dissolve the DNA material in sterile Milli-Q according to the supplier IDT. This creates a 100 µM stock solution.
  3. Heat the primer stock solution to 65 °C for 20 minutes.
  4. Centrifuge the primer stock solution at maximum speed (~17,000 x g) for 2 minutes.
  5. Prepare a 10x diluted work solution (10 µm) by dilution with sterile Milli-Q.
  6. Store both Stock and Work solutions at -20 °C.

All work was performed within a sterile field created by a bunsen burner flame.

    Cell Culture

  1. Inoculate a single colony from an agar plate containing transformed cells in a 10 mL starter culture with appropriate antibiotic selection marker.
  2. Let the seed culture grow overnight ot 37 °C with 180 rpm rotation.
  3. Measure the OD600 to confirm growth (an OD600 of around 2 is to be expected).
  4. Prepare 1 L of media with the required antibiotics.
  5. Inoculate the media with 10 mL of the seed culture (1:100 ratio).
  6. Let the culture grow until an OD600 of 0.5.
  7. When the required OD is reached, put the culture on ice for 30 minutes.
  8. After the 30 minutes, induce the expression of the protein by adding 1M IPTG to a final concentration of 1mM and 20% arabinose to a final concentration 0.2% arabinose.
  9. Grow the cells for 16 hours on 18 °C and 180 rpm rotation.
  10. Cell Harvest

  11. Harvest the liquid culture by centrifugation at 5200 g and 4°C for 15 minutes.
  12. Discard the supernatant and weigh the pellet. Resuspend the pellet with 6 mL PBS/g cells.
  13. Centrifuge the cells 15 minutes at 5200 g and 4°C, and again discard supernatant.
  14. The cells are now directly passed off to downstream processing.

This protocol describes how we finally performed the downstream processing of dxCas9.

    Cell Lysis

  1. Retrieve a washed cell pellet from upstream processing according to the protein expression protocol.
    NOTE: All following steps in this purification protocol are done at 4 °C.
  2. Resuspend the pellet in lysis buffer (20 mM Tris-HCL, 250 mM NaCl, 10% v/v glycerol, 1 mM DTT, 5 mM imidazole, pH 8.0) and one protease inhibitor tablet per 50mL lysis buffer. Make sure pellet is fully resuspended.
  3. Lyse the cells using a high-pressure homogenizer (French Press) (2 rounds at 1 kbar).
  4. Clarification

  5. Clarify the lysate via centrifugation for 45 min at 16,000 g.
    NOTE: The dxCas9 is now dissolved in the supernatant and the pellet contains cell debris.
  6. Nickel Affinity Chromatography

  7. Perform Nickel affinity chromatography with a gravity column.
    NOTE: 1 mL of 50% His-Select Ni resin per 15mL clarified lysate for high expression proteins.
  8. Resuspend 1 mL of 50% Hisselect Nickel Affinity gel in 10mL (20CV) water, spinning down at 3220 g for 1 min and discard the supernatant. Repeat this three times.
  9. Equilibrate the washed resin with 10mL (20CV) of equilibration buffer (20 mM Tris-HCl, 250 mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8), spinning down at 3220 g for 1 min and discard the supernatant.
  10. Add the Hisselect column material to the clarified lysate and incubate for one hour with gentle mixing.
  11. Spin down the mixture, for 1 min at 2000 g.
    NOTE: This mixture contains dxCas9 bound to Hisselect Nickel resin.
  12. Discard the supernatant by pipetting and load the resin onto a gravity column.
  13. Wash the resin five times in 2 mL (20CV) of washing buffer (20 mM Tris-HCl, 250 mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8) and collect the flowthrough.
  14. Elute the dxCas9 from the resin with six fractions of 500 μL of elution buffer (20 mM Tris-HCl, 250 mM NaCl, 1 mM DTT and 250 mM imidazole, pH 8.0), and collect in differently labeled tubes.
  15. Measure the A280 of all six elution fractions at the Nanodrop, to roughly estimate the protein concentrations.
  16. Load the all the samples including the elution fractions onto an SDS 8% Tris-Glycine PAGE gel to confirm presence of the protein.
  17. Pool the fraction that contains the dxCas9.
  18. Heparin Chromatography

  19. Perform heparin chromatography on the AKTA pure with a 1 mL HiTrap Heparin HP column.
  20. Set the following settings:
    • Flow rate: 0.5mL/min
    • Maximum column pressure: 0.5 MPa
  21. Perform the following method on the AKTA.
    Chromatography step Buffer Column Volume (CV) Volume (mL) Fractionation
    Column washing Water 20 20 0 Fractions
    Column equilibrating 20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1 mM DTT, pH 7.5 20 20 0 Fractions
    Sample loading Pooled dxCas9 fractions 1-20 1-20 1 Fraction in the appropriate tube
    Washing 20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1 mM DTT, pH 7.5 20 20 1 Fraction in a 50 mL Falcon tube
    Eluting 20 mM Tris-HCl, 1.5 M NaCl, 10% v/v glycerol, 1 mM DTT, pH 7.5 30 30 60 Fractions in a 1 mL tube
    Column Washing Water 20 20 0 Fractions
    Column Storage 20% ethanol 20 20 0 Fractions
  22. Based on the A280 seen on the chromatogram select desired elution fractions that contains protein.
  23. Load the all the samples including the desired elution fractions onto an SDS 8% Tris-Glycine PAGE gel to confirm presence of the protein.
  24. Dialysis

  25. Pool the fraction that contain the dxCas9.
  26. Prepare 2L of dialysis buffer (20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol and pH 7.5).
  27. Inject the pooled fractions (0.5-3mL) into a pierce 10,000 Molecular weight cut off cassette.
  28. Buffer exchange by dialysis of the pooled fractions for 1 hour in 1 L dialysis buffer.
  29. Replace the dialysis buffer with fresh buffer and repeat dialysis for 1 hour.
  30. Remove the dxCas9 solution out of the dialysis cassette and measure the concentration with the Pierce BCA protein assay kit by Thermo Scientific.
  31. Aliquote the dxCas9 solution in 25µL aliquots and freeze at -20℃ for functionality testing assays.

This protocol describes how we finally performed the downstream processing of Tn5.

    Cell Lysis

  1. Retrieve a washed cell pellet from upstream processing according to the protein expression protocol.
    NOTE: All following steps in this purification protocol are done at 4 °C.
  2. Resuspend the pellet in lysis buffer (20 mM Tris-HCL, 250 mM NaCl, 10% v/v glycerol, 1 mM DTT, 5 mM imidazole, pH 8.0) and one protease inhibitor tablet per 50mL lysis buffer. Make sure pellet is fully resuspended.
  3. Lyse the cells using a high-pressure homogenizer (French Press) (2 rounds at 1 kbar).
  4. Clarification

  5. Clarify the lysate via centrifugation for 45 min at 16,000 g.
    NOTE: The Tn5 is now dissolved in the supernatant and the pellet contains cell debris.
  6. Nickel Affinity Chromatography

  7. Perform Nickel affinity chromatography with a gravity column.
    NOTE: 1 mL of 50% His-Select Ni resin per 15mL clarified lysate for high expression proteins.
  8. Resuspend 1 mL of 50% Hisselect Nickel Affinity gel in 10mL (20CV) water, spinning down at 3220 g for 1 min and discard the supernatant. Repeat this three times.
  9. Equilibrate the washed resin with 10mL (20CV) of equilibration buffer (20 mM Tris-HCl, 250 mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8), spinning down at 3220 g for 1 min and discard the supernatant.
  10. Add the Hisselect column material to the clarified lysate and incubate for one hour with gentle mixing.
  11. Spin down the mixture, for 1 min at 2000 g.
    NOTE: This mixture contains Tn5 bound to Hisselect Nickel resin.
  12. Discard the supernatant by pipetting and load the resin onto a gravity column.
  13. Wash the resin five times in 2 mL (20CV) of washing buffer (20 mM Tris-HCl, 250 mM NaCl, 5mM Imidazole, 10% v/v glycerol, 1mM DTT, pH8) and collect the flowthrough.
  14. Elute the Tn5 from the resin with six fractions of 500 μL of elution buffer (20 mM Tris-HCl, 250 mM NaCl, 1 mM DTT and 250 mM imidazole, pH 8.0), and collect in differently labeled tubes.
  15. Measure the A280 of all six elution fractions at the Nanodrop, to roughly estimate the protein concentrations.
  16. Load the all the samples including the elution fractions onto an SDS 12% Tris-Glycine PAGE gel to confirm presence of the protein.
  17. Pool the fractions that contain the Tn5.
  18. Heparin Chromatography

  19. Perform heparin chromatography on the AKTA pure with a 1 mL HiTrap Heparin HP column.
  20. Set the following settings:
    • Flow rate: 0.5mL/min
    • Maximum column pressure: 0.5 MPa
  21. Perform the following method on the AKTA.
    Chromatography step Buffer Column Volume (CV) Volume (mL) Fractionation
    Column washing Water 20 20 0 Fractions
    Column equilibrating 20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1 mM DTT, pH 7.5 20 20 0 Fractions
    Sample loading Pooled Tn5 fractions 1-20 1-20 1 Fraction in the appropriate tube
    Washing 20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1 mM DTT, pH 7.5 20 20 1 Fraction in a 50 mL Falcon tube
    Eluting 20 mM Tris-HCl, 1.5 M NaCl, 10% v/v glycerol, 1 mM DTT, pH 7.5 30 30 60 Fractions in a 1 mL tube
    Column Washing Water 20 20 0 Fractions
    Column Storage 20% ethanol 20 20 0 Fractions
  22. Based on the A280 seen on the chromatogram select desired elution fractions that contains protein.
  23. Load the all the samples including the desired elution fractions onto an SDS 12% Tris-Glycine PAGE gel to confirm presence of the protein.
  24. Dialysis

  25. Pool the fraction that contain the Tn5.
  26. Prepare 2L of dialysis buffer (20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol and pH 7.5).
  27. Inject the pooled fractions (0.5-3mL) into a pierce 10,000 Molecular weight cut off cassette.
  28. Buffer exchange by dialysis of the pooled fractions for 1 hour in 1 L dialysis buffer.
  29. Replace the dialysis buffer with fresh buffer and repeat dialysis for 1 hour.
  30. Remove the Tn5 solution out of the dialysis cassette.
  31. Protein Concentration

  32. Wash a Amicon ultra-15mL centrifugal filter units with an 10,000 molecular weight cutoff with Milli-Q water by centrifuging at 4,000 × g for approximately 10–20 minutes.
  33. Add the Tn5 sample to the filter and centrifuged at 4,000 × g for approximately 10–20 minutes.
  34. Measure the Tn5 protein concentration with the Pierce BCA protein assay kit by Thermo Scientific.
  35. Aliquote the Tn5 solution in 25µL aliquots and freeze at -20℃ for functionality testing assays.

This protocol describes how we finally performed the downstream processing of dxCas9-Tn5.

    Cell Lysis

  1. Retrieve a washed cell pellet from upstream processing according to the protein expression protocol.
    NOTE: All following steps in this purification protocol are done at 4 °C.
  2. Resuspend the pellet in lysis buffer (20 mM Tris-HCL, 250 mM NaCl, 1 mM DTT, 10% v/v glycerol, 1mM PMSF, pH 7.5) and one protease inhibitor tablet per 50mL lysis buffer. Make sure pellet is fully resuspended.
  3. Lyse the cells using a high-pressure homogenizer (French Press) (2 rounds at 1 kbar).
  4. Clarification

  5. Clarify the lysate via centrifugation for 45 min at 16,000 g.
    NOTE: The dxCas9-Tn5 is now dissolved in the supernatant and the pellet contains cell debris.
  6. Filter the clarified lysate with a 0.45µm filter.

    Heparin Chromatography

  7. Perform heparin chromatography on the AKTA pure with a 1 mL HiTrap Heparin HP column.
  8. Set the following settings:
    • Flow rate: 0.5mL/min
    • Maximum column pressure: 0.5 MPa
  9. Perform the following method on the AKTA.
    Chromatography step Buffer Column Volume (CV) Volume (mL) Fractionation
    Column washing Water 20 20 0 Fractions
    Column equilibrating 20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1mM PMSF, pH 7.5 20 20 0 Fractions
    Sample loading Crude dxCas9-Tn5 extract 1-50 1-50 1 Fraction in the appropriate tube
    Washing 20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1mM PMSF, 1 mM DTT, pH 7.5 20 20 1 Fraction in a 50 mL Falcon tube
    Eluting 20 mM Tris-HCl, 1.5 M NaCl, 10% v/v glycerol, 1mM PMSF, 1 mM DTT, pH 7.5 30 30 60 Fractions in a 1 mL tube
    Column Washing Water 20 20 0 Fractions
    Column Storage 20% ethanol 20 20 0 Fractions
  10. Based on the A280 seen on the chromatogram select desired elution fractions that contains protein.
  11. Load the all the samples including the desired elution fractions onto an SDS 8% Tris-Glycine PAGE gel to confirm presence of the protein.
  12. MonoQ Chromatography

  13. Perform anionic exchange chromatography on the AKTA pure with a 1mL MonoQ 5/50 GL column on the crude extract.
  14. Set the following settings:
    • Flow rate: 0.5mL/min
    • Maximum column pressure: 20 MPa
  15. Follow the following method on the AKTA
    Chromatography step Buffer Column Volume (CV) Volume (mL) Fractionation
    Column washing Water 20 20 0 Fractions
    Column equilibrating 20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1mM PMSF, 1 mM DTT, pH 8.5 20 20 0 Fractions
    Sample loading Pooled fractions diluted 4 times with 20 mM Tris-HCl, 0 mM NaCl, 10% v/v glycerol, 1mM PMSF, 1 mM DTT, pH 8.5 1-20 1-20 1 Fraction in the appropriate tube
    Washing 20 mM Tris-HCl, 250 mM NaCl, 10% v/v glycerol, 1mM PMSF, 1 mM DTT, pH 8.5 20 20 1 Fraction in a 50 mL Falcon tube
    Eluting 20 mM Tris-HCl, 1.5 M NaCl, 10% v/v glycerol, 1mM PMSF, 1 mM DTT, pH 8.5 30 30 60 Fractions in a 1 mL tube
    Column Washing Water 20 20 0 Fractions
    Column Storage 20% ethanol 20 20 0 Fractions
  16. Based on the A280 seen on the chromatogram select desired elution fractions that contains protein.
  17. Load the all the samples including the desired elution fractions onto an SDS 8% Tris-Glycine PAGE gel to confirm presence of the protein.
  18. Dialysis

  19. Pool the fraction that contain the dxCas9-L-Tn5.
  20. Prepare 2L of dialysis buffer (20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol 1mM PMSF and pH 7.5).
  21. Inject the pooled fractions (0.5-3mL) into a pierce 10,000 Molecular weight cut off cassette.
  22. Buffer exchange by dialysis of the pooled fractions for 1 hour in 1 L dialysis buffer.
  23. Replace the dialysis buffer with fresh buffer and repeat dialysis for 1 hour.
  24. Remove the dxCas9-Tn5 solution out of the dialysis cassette.
  25. Protein Concentration

  26. Wash a Amicon ultra-15mL centrifugal filter units with an 10,000 molecular weight cutoff with Milli-Q water by centrifuging at 4,000 × g for approximately 10–20 minutes.
  27. Add the dxCas9-Tn5 sample to the filter and centrifuged at 4,000 × g for approximately 10–20 minutes.
  28. Measure the dxCas9-Tn5 protein concentration with the Pierce BCA protein assay kit by Thermo Scientific.
  29. Aliquote the dxCas9-Tn5 solution in 25µL aliquots and freeze at -20℃ for functionality testing assays.

  1. Decide on which enzyme(s) to cut with. Check online what buffer the enzyme(s) work(s) in (NEB). For most of the enzymes, the SmartCut buffer 10X can be used.
  2. Prepare a 20µL sample as follows:
  3. Component Volume (µL)
    10x CutSmart buffer (NEB) 2
    Fragment (~1-2 μg) X
    Restriction Enzyme(s) 1 per enzyme
    MilliQ 18 - #RE added - X)
  4. Incubate for 4 hours at 37 °C.
  5. Inactivate the restriction enzyme(s) by heating to 65 °C for 10 minutes.
    NOTE: This last step can be skipped if the sample is evaluated on gel electrophoresis immediately.
    NOTE: Some enzymes are not inactivated by increasing the temperature to 65 °C.
    NOTE: DNA Clean Up is recommended for subsequent cloning strategies.

This protocol is based on the QIAGEN RNeasy MinElute Cleanup Kit suited for volume <100µl.

  1. Adjust the the transcripts volume to 100µl with RNase-free water.
  2. Add 350µl Buffer RLT and mix.
  3. Add 250µl of absolute ethanol.
  4. Transfer the sample to RNeasy MinElute spin column placed in a 2 ml collection tube. Close the lid and centrifuge for 15 seconds at minimum speed 8000x g.
  5. Discard the flow-through and place the spin column in a new 2 ml collection tube.
  6. Add 500µl Buffer RPE to the spin column. Close the lid and centrifuge for 15 seconds at minimum speed 8000x g.
  7. Discard the flow-through and place back the spin column to the same 2ml collection tube.
  8. Add 500µl 80% ethanol to the spin column. Close the lid and centrifuge for 2 minutes at minimum speed 8000x g.
  9. Discard the flow-through and place the spin column in a new 2 ml collection tube.
  10. Open the lid and centrifuge at full speed for 5 minutes. Discard the flow through and the collection tube.
  11. Place spin column in a new 1.5ml collection tube. Add 14µl RNase-free water to the center of the spin column.
  12. Close the lid and centrifuge for 1 minute at full speed to elute the RNA.
  13. Store the purified RNA at -20°C?

  1. Add 1:1 volume ratio of a purified RNA sample to 2x RNA loading buffer.
  2. Boil at 90°C for 5 minutes to denature potential secondary structures and temporarily inactivate RNAse.
  3. Directly put on ice for ~2 minutes.
  4. Spin down and electrophorese on a 2% agarose gel (in TBE buffer) for visualisation through gel documentation system at UV light.

An SDS-PAGE electrophoresis is used to separate proteins based on their size by using an electric current. This protocol describes how to prepare SDS-PAGE gels, how to prepare samples and how to run the electrophoresis.

    Preparing of SDS-PAGE Gel

    NOTE: An SDS-PAGE gel consist of a stacking gel and a separation gel. In this protocol we use a 6% Stack gel and a 12% separation gel (this is for protein samples between 15 kDa and 250 kDa).

  1. Prepare the following solutions for 2 gels:
    Component Volume 6% stacking gel Volume 12% separation gel
    40% acrylamide 750 µL 3 mL
    0.25 M Tris-HCl pH 6.8 2.5 mL -
    0.55 M Tris-HCl pH 8.8 - 5 mL
    10% SDS 50 µL 100 µL
    10% APS 50 µL 100 µL
    TEMED 5 µL 10 µL
    MilliQ 1.645 mL 1.79 mL
    Total volume 5 mL 10 mL
    NOTE: Polymerization will start when 10% APS and TEMED is added.
  2. Assemble the casting station and pour the separation gel between the glass plates leaving enough space for the stacking gel.
  3. Add 75% Ethanol on top of the solidifying stacking gel.
  4. When the gel is solidified, remove the ethanol and pour the stacking gel on top of the separation gel and immediately place the gel comb on top of it.
  5. Allow the stacking gel to solidify, then remove the plates from the casting station.
  6. The gels are ready for usage, or can be stored at 4 °C in liquid for later usage.
  7. Preparing samples

  8. Add 5 μL protein Loading Dye to 20 μL of protein sample.
  9. Incubate the samples for 10 minutes at 90°C.

    Running SDS-PAGE gel

  10. Run the gel at 150 V and 25 mA.
  11. The gel is finished when the blue line is at the end of the gel.

    Processing SDS-PAGE gel

  12. Turn off the power pack before opening the gel box.
  13. Remove the gel from the cassette and place the gel in a clean staining tray of the appropriate size filled with a layer of MilliQ.
  14. Gently allow the gel to slide from the glass plate into the water.
  15. Microwave the gel for 40 seconds on low heat.
  16. Allow the gel to shake on a moving platform for 2 minutes.
  17. Discard the water.
  18. Add clean Milli-Q water and repeat step 15-17 two times.
  19. Cover the gel with a layer of SimplyBlue SafeStain.
  20. Let the gel stain on a moving plate for approximately 20 minutes.
  21. Discard the SimplyBlue SafeStain in the waste container.
  22. Cover the gel with Milli-Q water and allow the gel to shake on a moving platform until the gel is destained.
    NOTE: the water can be replaced frequently to remove all the stain.
  23. Take a picture with the Gel doc system.

This protocol is based on the protocol supplied with the MinION device from Oxford Nanopore Technologies.

    Flow cell QC and check

  1. Connect MinION device to a USB 3.0 port of a computer with recommended 1 Terabyte free space.
  2. Open MinKNOW GUI from desktop and execute quality control (QC) of the flow cell.
    NOTE: The number of available active pores to work with Flow cell from ONT is > 800 pores.
  3. Library preparation rapid sequencing (lambda DNA)

  4. Thaw the components of the kit for Rapid Sequencing on ice and keep on ice.
  5. Add 2.5 µL of DNA to 7.5 µL of FRA (fragmentation mix).
  6. Mix the content well by inversion and spin down.
  7. Incubate tube at 30 ºC for 1 minute and then at 80 ºC for another minute.
  8. After incubation, add 1 µL of RAP (Rapid Adapter) to the tube and incubate for 5 minutes at room temperature.
  9. Priming of Flow Cell

  10. Turn the lid of the Flow Cell clockwise in order to make visible the priming port.
  11. Remove bubbles from the priming port (not by directly pipetting but by changing pipette volume).
  12. Pipette 30 µL of Flush Tether into a tube of Flush Buffer and mix well by pipetting (priming mix).
  13. Add 800 µL of this priming mix to the priming port.
  14. Loading the SpotON Flow Cell

  15. Prepare the following reaction mixture:
    Component Volume (µL)
    Sequencing Buffer (SQB) 34
    Loading Beads (LB) 25.5
    Nuclease-free MilliQ 4.5
    Prepared DNA library 11
  16. Open the SpotON port making the sample port available.
  17. Add 200 µL of priming mix.
  18. Add 75 µL of sample in the sample port in a dropwise fashion, allowing every drop to enter the port before adding another drop.
  19. Close the priming port and replace the minION lid.
  20. Sequencing run and base calling

  21. Start the sequencing run once the sample is loaded on the Flow cell using the Desktop Agent.
  22. Check the progression of the upload and download of files, together with the network speed.
  23. Close down MinKNOW and Desktop Agent

  24. The run is stopped once the live base calling shows no DNA (or very little DNA) is being sequenced.
  25. Quit Desktop Agent and MinKNOW and disconnect MinION.
  26. To store the flow cell for a next run, follow the Wash Kit MinION protocol.

For sequence verification, we made use of the sequencing platform EZ-Seq established by Macrogen. This protocol is based on their instructions.

  1. Prepare a sequencing sample in a 1.5 mL microcentrifuge tube, labelled with a Macrogen sequencing sticker (QR-code) as follows:
    Component Volume (µL)
    DNA X (~500 ng is required*)
    Primer (10 µM) 2.5 (final concentration 5-10 pmol/µL)
    Sterile MilliQ 10-X

    * NOTE: The volume depends on the concentration of the sample.
  2. Make sure to keep the code of the QR-code and note down what sample is affiliated with it. Deliver the tubes for sequencing to the manufacturer and await results.
  3. Results are evaluated in silico by aligning expected sequences with obtained sequences and calculating the match percentage.

  1. Dissolve the LB-agar powder in sterile Milli-Q as directed by the manufacturer’s protocol.
  2. Autoclave the LB-agar solution (121°C).
  3. Cool the agar down to hand-warm temperature.
  4. Supplements the medium with any relevant antibiotics and/or inducers etc.
    NOTE: With our antibiotic stock solutions of 1000x we used 1 µL of antibiotic solution per mL of LB-agar.
  5. Under aseptic conditions, pour the medium in empty Petri dishes.
  6. Close the Petri dishes and let the agar solidify at room temperature.
  7. Store the Petri dishes upside down at 4°C.
    NOTE: When complimenting medium with X-gal, be sure to store the plates protected from light.

    This protocol describes how to evaluate the mobility shift of the Tn5:adapter DNA complex or the dxCas9-Tn5:adapter DNA complex.

    Adapter DNA Sequence

    To create 25µM adapter DNA molecule. Two primers shown on table 1 were annealed to each other as follow:
  1. Add 25µl of each primer (from 100µM stock)
  2. Add 50µl of MilliQ water
  3. Place tube in 90-95°C heating block and leave for 3-5 minutes to denature any secondary structure
  4. Remove the heating block from the heat source allowing for slow cooling to room temperature (~45 minutes)
  5. Table 1. Sequence of the adapter DNA. Note that 5’ of the upper strand of the adapter has to be phosphorylated for successful integration.

    Name Sequence (5’ - 3’)
    Adapter upper strand P-CTGTCTCTTATACACATCT
    Adapter lower strand GCATGGTAAACAGTTCATCCATTTCGCCAATAGATGTGTATAAGAGACAG

    Tn5:adapter DNA or dxCas9-Tn5:adapter DNA complex (transposome) formation

    1. Load the purified Tn5 or dxCas9-Tn5 protein with adapter DNA shown above. Note that all samples and reagents are kept on ice during preparation.
    2. Calculate all the volumes of the reagents required:
      • 1-6µM Tn5 or dxCas9-Tn5
      • 2.5µM adapter
      • Functionality buffer
        • dxCas9-Tn5 buffer: 20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol, 10mM MgCl2 pH 7.5
        • Tn5 buffer: 25 mM Tris-HCl, 500 mM NaCl, 1 mM DTT, 0.1mM EDTA, pH 7.5
      • Water to bring the final volume to 10uL
    3. Pipette the reagents in the following order: Water, 10x functionality buffer, Tn5 or Tn5-dxCas9 and adapter
    4. Incubate at 23°C for 1 hour.
      NOTE: The total reaction volume can be adjusted as long as molar ratios of the reagents are kept constant.
    5. Analyse the samples on a 8% native TBE polyacrylamide gel to observe the mobility shift

    This protocol describes how to evaluate the integration of adapter DNA by Tn5 or the dxCas9-Tn5 fusion protein.

    Adapter DNA Sequence

    To create 25µM adapter DNA molecule. Two primers shown on table 1 were annealed to each other as follow:
  1. Add 25µl of each primer (from 100µM stock)
  2. Add 50µl of MilliQ water
  3. Place tube in 90-95°C heating block and leave for 3-5 minutes to denature any secondary structure
  4. Remove the heating block from the heat source allowing for slow cooling to room temperature (~45 minutes)
  5. This protocol describes how to evaluate the integration of the Tn5 or the Tn5-dxCas9.

    Table 1. Sequence of the adapter DNA. Note that 5’ of the upper strand of the adapter has to be phosphorylated for successful integration.

    Name Sequence (5’ - 3’)
    Adapter upper strand P-CTGTCTCTTATACACATCT
    Adapter lower strand GCATGGTAAACAGTTCATCCATTTCGCCAATAGATGTGTATAAGAGACAG

    Tn5:adapter DNA or dxCas9-Tn5:adapter DNA complex (transposome) formation

    1. Load the purified Tn5 or dxCas9-Tn5 protein with adapter DNA shown above. Note that all samples and reagents are kept on ice during preparation.
    2. Calculate all the volumes of the reagents required:
      • 2.5µM Tn5 or Tn5-dxCas9
      • 2.5µM adapter
      • Functionality buffer (20 mM Tris-HCl, 100 mM KCl, 5% v/v glycerol, 1 mM beta-mercaptoethanol, 0.1mM EDTA pH 7.5)
      • Water to bring the final volume to 10uL
    3. Pipette the reagents in the following order: Water, 10x functionality buffer, Tn5 or dxCas9-Tn5 and adapter.
    4. Incubate at 23°C for 1 hour.
      NOTE: The total reaction volume can be adjusted as long as molar ratios of the reagents are kept constant.
    5. gRNA:Transposome complex formation (only for fusion protein)

    6. Load dxCas9-Tn5:adapter complex with gRNA provided by Arbor Biotechnologies.
      NOTE: all samples and reagents are kept on ice during preparation.
    7. Add the following reagents to 10µl transposome
      • 2µl sgRNA (100ng/µl stock solution) to make 1:1 sgRNA:transposome molar ratio
      • 0.5µl buffer (add concentration)
    8. Incubate at 37°C for 10 minutes.
    9. Target DNA integration

    10. Add 50ng target DNA, in our case EPO cDNA to 12.5µl of gRNA:Transposome complex.
    11. Incubate at 37°C for 1 hour.
    12. Amplification of integration products by PCR

    13. Targeted integration of adapter DNA to EPO cDNA (632bp) will result in two fragments of ~250bp and ~450bp. To visualize these fragments, PCR was done to amplify the two products separately. The sequence of the primers are found on table 2. Primer set 1 will amplify the first fragment, while primer set 2 will amplify the second fragment (figure 1).
    14. Table 2. Primer lists used for the functionality assay

      Primer set Fw primer Information Rv primer Information
      1 Fw EPO
      GATCGAATTCGCGGCCGCTTC
      This will bind to the start of the EPO gene (target gene) Rv adapter
      GCATGGTAAACAGTTCATCCATTTCGCCAATAGATGTGTATAAGAGACAG
      This will bind to the end of the adapter
      2 Rv adapter GCATGGTAAACAGTTCATCCATTTCGCCAATAGATGTGTATAAGAGACAG This will bind to the end of the adapter (start of the product) Rv EPO
      CGATTCTGCAGCGGCCGCTAC
      This will bind to the end of EPO gene (target gene)
      functionality assay Figure 1. Depiction of the binding location of the primer sets 1 (left) and 2 (right) for functionality assay PCR.
    15. The PCR reaction composition is shown in Table 3.
    16. Table 3. Pipetting scheme for PCR of integration products.

      Component Volume (µL)
      5x GoTaq buffer 4
      MgCl2 (25µM) 2
      10 mM dNTPs 0.4
      Primer forward (10µM) 0.4
      Primer reverse (10µM) 0.4
      GoTaq polymerase 0.1
      DNA template 2.5
      MilliQ up to 20 µL
    17. Close all tubes thoroughly and place them in a thermocycler with the following protocol:
      Step Time (s) Temperature (°C)
      Initial denaturation 150 98
      Denaturation 60 94
      Annealing 60 60
      Extension 60 72
      Final extension 480 72
      Hold 20
    18. The PCR product are analysed on 5% native TBE polyacrylamide gel. The resulting gel is either stained with ethidium bromide and imaged with GelDoc system, or directly imaged with Typhoon Imaging System. In order to see the position of the protein in the gel the gel can be stained with silver quest staining.