Team:Nottingham/Lab

Ideas

Immediately after meeting for the first time, we were tasked with finding a project that we would be working on over the summer. At first, the idea seemed daunting but before we knew it, amazing (sometimes outrageous) ideas were being suggested.

Almost a month later, after numerous presentations, we narrowed down our potential projects to five:

Exploiting the PET-degrading qualities of Ideonella sakaiensisto tackle the plastic crisis

Creating a biosensor to detect harmful substances in water bottles

using Bdellovibrio bacteriovorus (and its enzymes) to attack and kill harmful/unwanted bacteria in food processes

using mRNA interference to silence Streptococcus mutanstoxins

using mRNA interference to silence Clostridium difficiletoxins

Ideonella sakaiensis

Ideonella sakaiensisis a bacterium that can degrade plastic (PET) using two enzymes. It was discovered outside a plastic recycling facility in Japan and subsequently isolated by research teams at Kyoto Institute of Technology and Keio University(Yoshida et al., 2016). The idea of being able to tackle the plastic crisis affecting the oceans and marine life was a particularly appealing one. However, we quickly realised that we didn’t know how to transform the organism and the time-scale for how long it would take. Also, our project was very similar to other research being conducted and so it would be difficult to come up with a novel way to address the crisis.

Water bottle biosensor

According to the House of Commons Environmental Audit Committee, in their first report of the season (2017-19), in the UK alone we use ‘13 billion plastic bottles every year’ and ‘only 7.5 billion are recycled’. This prompted the team to suggest a biosensor that detects harmful substance in plastic bottles. As a result, the average consumer would buy fewer plastic bottles and reuse their bottle. However, many solutions immediately were proposed that counteracted the need for the biosensor-this included the fact that many people buy permanent water bottles that they wash and reuse; it would be more cost effective to campaign recycling efforts than to market a biosensor and it is cheaper to just recycle a plastic bottle and buy a new one than to buy a biosensor. Indeed in the report by the Environmental Audit Committee (potential stakeholders), they suggest increasing the number of water fountains in open spaces and improving recycling through a number of methods including Deposit Return Schemes (which incentivise consumers).

Bdellovibrio bacteriovorus

Bdellovibrio bacteriovorus is a predatory bacterium that preys on other (Gram-negative) bacterial species (Rendulic et al., 2004). Its enzymes and their mechanisms are being studied in order to better understand the bacterium for future use as a possible therapeutic agent or as a method to penetrate biofilms (Kadouri and O'Toole, 2005; Sockett and Lambert, 2004). Our team was interested in engineering the bacterium to use it (and its enzymes) as a ‘pathogen eating machine’in food processes-for example targeting Clostridium botulinum, which releases the botulinum toxin. On top of it being an interesting species to work on, we had a leading expert on the Bdellovibrio species at our university. However, the main bacterium we were targeting (Clostridium botulinum) is a Gram-positive bacterium so is not recognised by Bdellovibrio. Also, it would take many weeks to engineer Bdellovibrio for single gene mutations, which is difficult to transform using random transposon mutagenesis. This was a project that required many years which our team did not have!

<4>mRNA interference of Streptococcus mutans

Streptococcus mutansis one of a number of bacteria involved in tooth decay and is the most prevalent. According to Public Health England, in the UK, ‘almost a quarter (24.7%) of 5 year olds have tooth decay’ of which 3 or 4 teeth are affected. Dental health problems also have a heavy financial burden on the NHS-it spends around £3.4 billion per year on dental care. What makes S. mutans particularly hard to deal wit his its ability to form biofilms regulated by glucosyltransferases which catalyse sucrose to adhesive glucan. In particular, GtfB and GtfB seem to be the most important in biofilm production-mutations in the gtfB and gtfC genes disrupted microcolony formation on saliva coated surfaces(Koo et al., 2010). Our idea was to use a bacteriophage (a virus that only infects bacteria) to deliver micro RNAs or small interfering RNAs to silence those genes. One of our supervisors works with phage so she would be able to guide the wet lab team. We opted to silence the toxins rather than kill the bacteria because we wanted a way of preventing glucan formation without disturbing the balance of the oral microbiome

mRNA interference of Clostridium difficile

Clostridium difficile is an anaerobic bacterium capable of forming spores (meaning it persists in the environment). Clostridium difficil einfection(CDI) is a major infection which causes hospital and community acquired-diarrhoea. It particularly affects those who have long-term hospital stays (especially the elderly), are immunocompromised/immunodeficient (for example due to chemotherapy) and/or are on broad-spectrum antibiotics. CDI has a heavy financial burden-according to Zhang et al. (2017), the annual costs due to C. difficile infections in the US alone are an estimated $6.3 billion with almost 2.4 million days spent in hospitals. According to the Centers for Disease Control and Prevention, between 1999 and 2007 there was an increase in the estimated number of deaths due to CDI from 3,000 to 14,000 which was seen across Europe and Canada as well (McDonaldet al., 2012; Lessa et al., 2012). This has been linked to a hypervirulent, resistance strain of C. difficile.

Within the SBRC, our supervisors work with a wide range of Clostridial species in the Clostridia Research Group. Unlike with S. mutans, there was more experience within the team and so the supervisors would be able to work with us more closely and advise us on this project.

It was hard to decide between working with Ideonella sakaiensis, Streptococcus mutansor and C. difficile. But in the end, the team voted and chose mRNA interference of C. difficile which became our project-ClostridiumdTox.

Bibliography

Design

C. difficile & phage characterisation

C. difficile strain SBRC 078 was isolated previously in the SBRC from clinical faecal samples and belongs to the hypervirulent PCR ribotype 078. The strain contains the genes tcdA and tcdB encoding for both toxins. Phage phiSBRC was previously isolated in the SBRC from an environmental sample and can infect and form plaques on C. difficile SBRC 078. A lysogenic version of C. difficile SBRC 078, which contains phage phiSBRC integrated into the bacterial chromosome, was created previously in the SBRC.

C. difficile growth analysis

The growth profile of the wildtype version of C. difficile SBRC 078 was compared to the growth profile of the lysogenic version of this strain. To assess this the growth of both strains was monitored for 24 hours and the OD at 600 nm was measured and the maximum growth rate was calculated using the equation

(2.303x(log10t2)–(log10t1))/3

where t1 is the OD at the start of exponential phase and t2 is the OD at the end of exponential phase. This data was used to inform the model parameters and was required to ensure that in the human gut the lysogenic bacterial strains created in this project would grow in the same manner as the wild-type cells and therefore would outcompete them.

Phage burst size

Phage burst size was assessed to determine the number of infectious phage particles produced per bacterial cell during one infection cycle. This was determined by measuring the number of infectious phage particles (in plaque forming units per ml) produced over a time-course after infection of C. difficile SBRC 078 with phiSBRC. The titre of free phage at each time point was determined by enumeration of plaques using a plaque assay. C. difficile SBRC 078 was infected to a multiplicity of infection (MOI) of 1. The burst size was calculated as the Final Phage Titre/(Infection Phage Titre – Titre of Unbound Phages). This data was used to inform the model parameters.

dCas 9

AS RNA

Promoters

Results

C. difficile & phage characterisation

C. difficile growth analysis

The growth of wild-type C. difficile SBRC 078 was compared with the growth of the lysogenic version of this strain. By measuring the OD at 600 nm of the two bacterial cultures over a 24-hour period. It was determined that the lysogenic strain has a slightly longer lag phase than the wild-type strain (Figure 1) but both strains reached the same maximum OD. The maximum growth rates for the two strains were similar with wild-type reporting a maximum growth rate of 0.26 µ/h and the lysogen measuring 0.23 µ/h. The negative control (broth containing no bacteria) reported a maximum growth rate of 0.007 µ/h showing no contamination over the time-period. The similar growth rates of the wild-type strain and lysogen showed that when lysogens were created in the gut as part of the therapy, the lysogens would be able to maintain their population over time in the same way as wild-type strains, therefore ensuring they are able to compete for nutrients and act as a probiotic to reduce colonisation of incoming toxigenic C. difficile strains.

**Figure 1: Growth profile of wild-type C. difficile SBRC 078 and lysogenic C. difficile SBRC 078.** The lysogenic strain has a slightly longer lag phase but both strains reach the same maximum OD. The negative control contains no bacteria and shows that no contamination has occurred over the time-period. OD was measured every hour for 24 hours in biological triplicate.

Phage burst size

The phage burst size was calculated to determine the number of infectious phage particles produced from one bacterial cell during one infection cycle. A culture of C. difficile SBRC 078 was infected with phiSBRC to a MOI of 1 (infection titre of phage of 1.38 x 106 pfu/ml) and incubated for 15 minutes to allow phages to adsorb. The culture was washed of any unbound phages and then incubated under anaerobic conditions for 80 minutes. The number of phages in the supernatant was monitored. Figure 2 shows the number of phages present at various intervals over the period. It was observed that between 65 and 70 minutes and then 75 and 80 minutes the phage titre seemed to plateau slightly, indicating the end of the first burst cycle. It was determined by plaque assay that the final phage titre at the end of the first burst cycle was 4.2 x 106 pfu/ml and the number of unbound phages after the 15-minute incubation was 1.05 x 104 pfu/ml. These values were used to calculate burst size which was determined as 33 phage particles per cell. The burst size was a useful parameter for the phage model and allowed the number of phages over time in the model to be more accurately determined.

Figure 2: Determination of phage phiSBRC burst size. C. difficile SBRC 078 was infected with phiSBRC and the subsequent burst was measured over 80 minutes. The first burst cycle is deemed complete when the phage titre, measured in plaque forming units per ml, reaches a small plateau. The burst size was calculated and determined as 33 phage particles per cell.

dCas 9

AS RNA

Promoters

Conclusion

Future Work

InterLab

Labfolder

Protocols

Lab book antisense RNA experiments

Lab book promoter experiments

Parts

tttttaacaaaatatattgataaaaataataatagtgggtataattaagttgttagagaaaacgtataaattagggataaact atggaacttatgaaata gattgaaatggtttatctgttaccccgtatcaaaatttaggaggttagttcatatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgt tgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcact actggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgact ttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaagg tgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa	BBa_K2715001	The Ribosomal Binding Site was taken from Clostridium acetobutylicum as it is a well characterized strong RBS driving transcription of the Thiolase gene. The promoter is from a previous team (iGEM2006_Berkeley), part BBa_J23114 which is from a family of constitutive promoters known as “Anderson promoter after the founder Prof. Chris Anderson, J23114 was a relatively weak member compared to the rest of the family. The GFP gene is a commonly used reporter gene as it allows expression to be measured in fluorescence units.
gtgtagtagcctgtgaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagataggataatagaatccatagaaaa tataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgtataaagttgtgtaatttttaaggaggtgtgtta catatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagg gtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggtta tggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatattt ttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaag atggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaa aattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccat tacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggca tggatgaactatacaaataataa	BBa_K2715002	Promoter taken from Clostridium sporogenes ferrodoxin gene, the RBS is also from the ferrodoxin gene.
ttaatgaatttaaagaaatatttacaatagaaatcaaattttagaattaactttattgtaaaatcaataactaagaatatcttaatttatatagaacaaa gtttacatatttatttcagacaacgtctttattcaatcgaagagcaaattaatcaactgagtgtcttcaatttaaaatgttaggaagtgaatgtatatga aaacctaagtagatattagtatattttataaatagaaaggaggatatataaaagagttttagcatttagatgtaaaaatattcaataaaaatattatagt aaaggagaaaatcatatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctg tcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcac tactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaa agaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattg attttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaa agttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtcctttta ccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctggga ttacacatggcatggatgaactatacaaataataa	BBa_K2715003	Clostridium difficile toxin B gene promoter. This was an important promoter to test as it was the target for the asRNA team to reduce toxin production.
cacaaactataatagttaaacatagaaatatgtgtaaattgtgatggaaattattcaaaaacacaaaaatacgtgatgaaggacaaaatgatagagaaaa taagtatcaaaccttaataaatgatttaattgatagtttaaaagttataggaaaaatatataaagaaataaaaacattaaaaaaatataagatatgttta caaattactatcagacaatctccttatctaatagaagagtcaattaactaattgagtatctttaaattgaaatgttaggaagtgatttaaatatgaaaac ttaaattataaaaaatcaatattaatttatttttaaaaaatagaaaggagtgtataagatttattttcaaagtttaaaaaaaagaaaatcaatttaaatt tcagaaggaataaatgtggttatagaagtggatttattatcaaaaataataatactaggaggttcatatgcgtaaaggagaagaacttttcactggagtt gtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttaccctta aatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatat gaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaa gtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaact ataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaact agcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatccc aacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa	BBa_K2715004
tttatggctagctcagtcctaggtacaatgctagcgtatcaaaatttaggaggttagttcatatgcgtaaaggagaagaacttttcactggagttgtccc aattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaattt atttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaac agcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaa gtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataac tcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcag accattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacga aaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa	BBa_K2715114	The Ribosomal Binding Site was taken from Clostridium acetobutylicum as it is a well characterized strong RBS driving transcription of the Thiolase gene. The promoter is from a previous team (iGEM2006_Berkeley), part BBa_J23114 which is from a family of constitutive promoters known as “Anderson promoter after the founder Prof. Chris Anderson, J23114 was a relatively weak member compared to the rest of the family. The GFP gene is a commonly used reporter gene as it allows expression to be measured in fluorescence units.
tttacggctagctcagtcctaggtatagtgctagcgtatcaaaatttaggaggttagttcatatgcgtaaaggagaagaacttttcactggagttgtccc aattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaattt atttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaac agcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaa gtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataac tcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcag accattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacga aaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa	BBa_K2715106	The promoter is from a previous team (iGEM2006_Berkeley), part BBa_J23106 which is from a family of constitutive promoters known as “Anderson promoter after the founder Prof. Chris Anderson, J23106 was a relatively weak member compared to the rest of the family. The Ribosomal Binding Site was taken from Clostridium acetobutylicum as it is a well characterized strong RBS driving transcription of the Thiolase gene. The GFP gene is a commonly used reporter gene as it allows expression to be measured in fluorescence units.
ttgacagctagctcagtcctaggtataatgctagcgtatcaaaatttaggaggttagttcatatgcgtaaaggagaagaacttttcactggagttgtccc aattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaattt atttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaac agcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaa gtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataac tcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcag accattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacga aaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa	BBa_K2715119	The promoter is from a previous team (iGEM2006_Berkeley), part BBa_J23119 which is from a family of constitutive promoters known as “Anderson promoter after the founder Prof. Chris Anderson, J23119 was a relatively weak member compared to the rest of the family. The Ribosomal Binding Site was taken from Clostridium acetobutylicum as it is a well characterized strong RBS driving transcription of the Thiolase gene. The GFP gene is a commonly used reporter gene as it allows expression to be measured in fluorescence units.
tttttaacaaaatatattgataaaaataataatagtgggtataattaagttgttagagaaaacgtataaattagggataaactgttttctattaactaaa ctcataaaattttctcctttactataatattttgtaaaataaatgtgcctcaacttagatgttaaggcacatttattttatatattaatgaatttaaaga aatatttacaatagaaatcaaattttagaattaactttattgtaaaatcaataactactcttctttagatattaaagacataaaaacctcctagtattat tatttttgataataaatccacttctataaccacatttattccttctgaaatttaaattgattttcttttttttaaactt	BBa_K2715007
tttttaacaaaatatattgataaaaataataatagtgggtataattaagttgttagagaaaacgtataaattagggataaaaatcttacatttgccattt tttctaactgttttctattaactaaactcataaaattttctcctttactataatattttgtaaaataaatgtgcctcaacttagatgttaaggcacattt attttatatagtgtagtagcctgtgaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagataggataatagaat ccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgtaagtttaaaaaaaagaaaatcaa tttaaatttcagaaggaataaatgtggttatagaagtggatttattatcaaaaataataatactaggaggtttttatgtctttaatatctaaagaagagt taataaaactcgcatatag	BBa_K2715008
tttttaacaaaatatattgataaaaataataatagtgggtataattaagttgttagagaaaacgtataaattagggataaa	BBa_K2715010
gtgtagtagcctgtgaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagataggataatagaatccatagaaaa tataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt	BBa_K2715011
cacaaactataatagttaaacatagaaatatgtgtaaattgtgatggaaattattcaaaaacacaaaaatacgtgatgaaggacaaaatgatagagaaaa taagtatcaaaccttaataaatgatttaattgatagtttaaaagttataggaaaaatatataaaga	BBa_K2715012
ttaatgaatttaaagaaatatttacaatagaaatcaaattttagaattaactttattgtaaaatcaataacta	BBa_K2715013
gtatcaaaatttaggaggttagttcat	BBa_K2715009
ataaagttgtgtaatttttaaggaggtgtgttacat	BBa_K2715020
atcaaaaataataatactaggaggttcat	BBa_K2715022
taaaaatattatagtaaaggagaaaatcat	BBa_K2715024
ctatggaacttatgaaatagattgaaatggtttatctgttacccc	BBa_K2715019
aataaaaacattaaaaaaatataagatatgtttacaaattactatcagacaatctccttatctaatagaagagtcaattaactaattgagtatctttaaa ttgaaatgttaggaagtgatttaaatatgaaaacttaaattataaaaaatcaatattaatttatttttaaaaaatagaaaggagtgtataagatttattt tcaaagtttaaaaaaaagaaaatcaatttaaatttcagaaggaataaatgtggttatagaagtggatttatt	BBa_K2715021
agaatatcttaatttatatagaacaaagtttacatatttatttcagacaacgtctttattcaatcgaagagcaaattaatcaactgagtgtcttcaattt aaaatgttaggaagtgaatgtatatgaaaacctaagtagatattagtatattttataaatagaaaggaggatatataaaagagttttagcatttagatgt aaaaatattcaa	BBa_K2715023
gtaaaataaatgtgcctcaacttagatgttaaggcacatttattttatata	BBa_K2715014
ctcttctttagatattaaagacataaaaacctcctagtattattatttttgataataaatccacttctataaccacatttattccttctgaaatttaaat tgattttcttttttttaaactt	BBa_K2715015
aagtttaaaaaaaagaaaatcaatttaaatttcagaaggaataaatgtggttatagaagtggatttattatcaaaaataataatactaggaggtttttat gtctttaatatctaaagaagagttaataaaactcgcatatag	BBa_K2715016
ctgttttctattaactaaactcataaaattttctcctttactataatatttt	BBa_K2715017
aatcttacatttgccattttttctaactgttttctattaactaaactcataaaattttctcctttactataatatttt	BBa_K2715018

About our sponsors