Team:UNSW Australia/Human Practices/Commercialisation

Commercialisation


Overview

The UNSW iGEM team explored the commercial potential of our Assemblase enzyme scaffold which acted to guide the direction of our project. We consulted with a number of industry experts to understand how they could see our scaffold fitting into industry and research practices. This resulted in numerous options for metabolic pathways that could be used in our system as commercialisation case studies; including the Taxol, Levofloxacin and Astaxanthin synthesis pathways. By integrating advice from industry experts, we were able to redesign our project to include a focus on scaffolding the enzymes involved in Taxol side-chain synthesis. We designed the relevant DNA sequences for the tagged enzyme fusion proteins that could be involved in this reaction. Furthermore, we applied our enzyme kinetics and diffusion model to theoretically test increased product titre that would be obtained through scaffolding with the Assemblase system.

Relevance

The foundational advance track exists to allow teams to come up with novel solutions to an observed need within the industrial and scientific research communities. For our solution to add value on a larger scale, the team realised that we would have to show how our Assemblase system could impact a metabolic pathway of commercial use. Therefore, we focused on consulting with industry experts to gain an understanding of the target market for our scaffold whilst compiling a short list of applications to which our system could be applied.

Research & Analysis

Indole Acetic Acid

Initially, in the design phase of our project, the indole-3-acetic acid (IAA) biosynthesis pathway was selected as a way of showing how our scaffold could increase product titre. IAA is a plant growth hormone and has been used by previous iGEM teams that have worked on enzyme scaffolding projects, such as ZJU-China 2012 and NUDT-China 2015. This is due to the fact that the pathway is made up of a simple, two-step reaction leading to the easy to quantify product, IAA. To expand on this, we decided to do our own research on the use of IAA in practice.

We contacted Amanda Rollason, a researcher at the PlantBank facillity, Australian Botanic Gardens, who uses tissue culture methods for rainforest species conservation. Rollason informed us their facility the exclusively use indole-3-butyric acid (IBA), another auxin, as they had found in previous experiments that IAA showed no benefits and that IBA was easier to work with. Amanda coordinated our visit to the PlankBank facilities to learn more about their tissue culturing methods with Lotte von Richter , a science facilities coordinator.

Lotte von Richter

Science Facilities Co-ordinator – PlantBank

During the tour of PlantBank, Lotte showed us all the equipment and explained the methods that they use for their tissue culture. We also received some advice as to how we should conduct our own plant experiments .

Figure 1: Pictured (Left to Right): Lotte von Richter, Emily Watson and Bec Schacht (UNSW iGEM members) in PlantBank’s tissue culture room.

After our visit to PlantBank, we decided that the synthesis of IAA using our scaffold was not a worthwhile pathway to commercialise. However, we still wished to validate our scaffold design by demonstrating IAA biosynthesis with our Assemblase system and showing its effects effects on plant growth and development . Applying Lotte’s advice on tissue culturing with aseptic techniques, we were able to more effectively conduct our future plant trials.

Stereoselective Synthesis

Next we approached Professor Paul Groundwater from the University of Sydney, to discuss the potential applications of our scaffold with regards to drug synthesis. His research into the synthesis of novel agents made him an excellent candidate to ask for suggestions on which aspects of the pharmaceutical synthesis industry our system could benefit.

Professor Groundwater highlighted the significance of stereogenic centres as a key candidate for metabolic engineering tools. Many drugs available to consumers have an inflated price due to the industrial synthesis of the compounds resulting in the costly and ineffective separation of the required enantiomers from those with undesirable or potentially toxic chiral structure. Synthesising these drugs through a biocatalytic pathway would remove the need for resolution of the desired compound, potentially reducing the cost of synthesis.




In particular, he mentioned the synthesis of paclitaxel (brand name Taxol) which is a semi-synthetic anti-cancer therapeutic, that is very costly to produce. He prompted us to look further into this pathway, which was significant in catalysing a turning point in the design of our project, away from the indole-3-acetic acid pathway, towards paclitaxel side-chain synthesis.

He also suggested that we look into the synthesis of the antimicrobial agent, Levofloxacin, which is also costly to produce, and therefore costly to purchase. Levofloxacin contains one stereocentre, and our complex could benefit its production in the same way it would benefit paclitaxel production, greatly reducing the final product's cost. Through discussing pharmaceuticals that are hard to synthesise the team was able to further brainstorm other pathways involve stereogenic centres, such as the metabolic synthesis of Astaxanthin, a pink pigment that is extensively used in the fisheries industry.

Prof. Paul Groundwater

School of Chemistry – University of Sydney

We approached Prof. Groundwater to discuss the potential future applications of our scaffold in regard to drug synthesis and possible drug delivery. He highlighted the significance of stereogenic centres as a candidate for enzymatic synthesis.

Figure 2: Pictured (Left to Right): Prof. Paul Groundwater; Tobias Gaitt and Rebecca Schacht (UNSW iGEM members); and Prof. Andrew McLachlan, Dean of Pharmacy at the University of Sydney.

Taxol Side-Chain Synthesis

Taxol, the brand name of paclitaxel, is an anticancer drug which is often used in chemotherapy for the treatment of ovarian and breast cancers1. Taxol is traditionally isolated from the Pacific yew tree (Taxus brevifolia) and research into cost-effectively producing Taxol has been ongoing since its isolation in 19672. Prof. Groundwater suggested that we look into the side-chain synthesis of Taxol, due to the production of a racemic mixture in industrial synthesis. To combat the production of a racemic mixture, biosynthetic pathways, such as the one shown for Taxol (Figure 1) can be utilised to ensure the correct stereoisomers are produced1. However, these biosynthetic pathways are often slow and would benefit from co-localisation.

Figure 3: Overview of the Taxol biosynthetic pathway. Source: (Croteau et al., 2006)1.

The enzymes required for synthesis of the Taxol side-chain are Phenylalanine aminomutase (PAM) and Tyrocidine synthase I (S563A) (TycA-S563A). These enzymes have a slow turnover rate (Kcat of 0.015 /s and 0.05 /s respectively) which could be improved through co-localisation and altering the stoichiometry of the reaction, both of which can be achieved using our Assemblase scaffold.




We tested this assumption with our Enzyme Kinetics and Diffusion model, which showed that co-localising the enzymes with our scaffold would potentially lead to a six-fold increase in taxol side-chain yield.

Figure 4: Modelling Results

We have designed the gBlock sequences for attachment of the Taxol synthesis enzymes into our scaffold, but due to lack of time we have not experimentally validated this section of our project. Moving forward we would hope to characterise this pathway experimentally as a good way to also indicate the adaptability of our Assemblase system to different pathways.

Lab Work

gBlock Sequence Design for Assemblase Enzyme Scaffolding

The following method will result in a DNA sequence which can be synthesised, digested, transformed, cloned and expressed to produce Spy/SnoopTagged Enzymes for use with the Assemblase scaffold.

  1. Get the enzyme sequences for the two enzymes from the enzymatic pathway to be scaffolded.
  2. Determine which enzyme is rate-limiting.
  3. (Optional) Open a DNA sequence viewer, such as Benchling, so the sequence can be visualised and annotated.
  4. To both sequences, add the following sequence directly before the start codon: GAATTCGCGGCCGCTTCTAGATGCACCACCACCATCATCATGGAAGTGGC. This sequence contains:
    • iGEM prefix
    • 6xHisTag
    • GSG Linker
  5. To both sequences, delete the stop codon and any DNA which follows.
  6. To the rate limiting enzyme, add the following sequence: GGATCTGGCAAACTTGGGGATATTGAATTTATCAAGGTCAATAAGTAATACTAGTAGCGGCCGCTGCAG. This sequence contains:
    • GSG Linker
    • SnoopTag
    • iGEM suffix
  7. Before proceeding with synthesis and digestion, check the DNA sequence to ensure that it does not contain the restriction sites in the iGEM prefix and suffix (EcoR1, XbaI, SpeI or PstI). If these restriction sites are present, mutate a base in the unwanted restriction site which will result in the same amino acid being produced (synonymous mutation).
  8. Synthesise the DNA.
  9. Follow protocols found on the lab pages, specifically:
    • Digestion
    • Ligation
    • Transformation
    • Protein Production

Minomic Visit

Having investigated areas in which our Assemblase scaffold could be applied, the team decided to get a broader understanding of the commercialisation path we would have to follow. This was enabled through a meeting with Dr. Brad Walsh, the CEO of Minomic, an immuno-oncology company headquartered in Sydney, Australia. Brad’s significant experience in the Australian biological commercialisation space made him an ideal candidate for us to discuss the plausibility of our team commercialising our synthetic biology tool in the future.

Brad explained the products that Minomic is developing, focusing on MiCheck, a prostate cancer diagnosis tool, which works through antibody-mediated analysis of serum samples. From when Minomic attained licence for this product, it took 4.5 years and $25M AUD to take it to market, despite the large quantity of research available verifying both its function and safety. One of Brad’s key messages from this was how important it is to know your target customers before attempting to integrate the product into the market, something we took on board with our product design. He explained how Minomic achieves this through surveys of relevant industry professionals, such as insurers and healthcare practitioners, to ascertain where their device would fit on the industrial market compared to current technologies. Brad advised us moving forward to conduct market analysis in order to suitably determine a market need and prince for our scaffold if we were to scale it up in the future.

Reflecting on this process, in combination with our investigation into intellectual property, we came to realise the extent of the challenge ahead of us if we decided to commercialise our Assemblase system. Although Brad discussed how legal protection enables Minomic to capitalise on their investment into research, the process and loopholes described seem daunting. As such, the UNSW iGEM team decided to focus more on the experimental investigation and characterisation of our system.

One positive takeaway we did get from our consultation with Brad was how arranging enzymes into tethered spatial organisation could have further applications. For example, the possibility of assisting bioremediation through metabolic engineering, or even adapting our system to the drug targeting space. Although these suggestions weren’t directly incorporated into our enzyme-centric design, the suggested applications were in the forefront of our minds as we discussed the future of our project with the wider community.

Integrate

Research into the commercialisation of our scaffold has guided the focus of our project and influenced the experiments we have performed. Through the team’s research into the use of IAA and plant hormones in industry, we have gained information about the commercial applications of IAA. Although the prospects of commercialising our scaffold with a focus on IAA were bleak (due to the discovery that IAA was not widely used in industry), this information pushed the team to explore further applications. Our meeting with Prof. Paul Groundwater gave us a new perspective on the target market of our scaffold. The suggestion to concentrate our research to products wherein chirality is an important factor during synthesis (e.g. Taxol side-chain synthesis and Astaxanthin synthesis) directed our approach to future applications.

This directed our conversation at the symposium that we hosted, where we asked the audience for their opinion on which area they would like to see advanced by tools in synthetic biology. As 46% of the respondents voted for pharmaceutical applications, we decided to make Taxol our preferred commercial case study. Following this decision, we tested the enzymes involved in Taxol side-chain synthesis with our modelling to determine the theoretical increase in product titre which could occur from enzyme scaffolding. We have additionally designed the gBlocks that would be required to integrate the Taxol enzymes into our project, but did not have the time to experimentally validate this section of work. We have put the effort into designing these future experiments for future teams to be able to pick up from where we left off.

Outcomes

  • IAA is not a commercially viable application of our Assemblase system
  • Alternatively, the Taxol-side chain biosynthesis pathway could be used to interest and inspire industry to consider the use of our scaffold due to its high commercial benefits
  • The commercialisation landscape in Australia means it would require a large amount of effort to adapt our Assemblase scaffold into a commercial product

Resources

Guide to create new gBlock sequences for use with our scaffold

gBlock Sequence for 6xHis-PAM-SnoopTag

gBlock Sequence for 6xHis-TycA-S563A-SpyTag

References

  1. Croteau, R., Ketchum, R., Long, R., Kaspera, R. & Wildung, M. Taxol Biosynthesis and Molecular Genetics. Phytochemistry Reviews 5, 75-97 (2006).
  2. IUPAC. Compendium of Chemical Terminology, 2nd ed. (the "Gold Book"). Compiled by A. D. McNaught and A. Wilkinson. Blackwell Scientific Publications, Oxford (1997). XML on-line corrected version: http://goldbook.iupac.org (2006-) created by M. Nic, J. Jirat, B. Kosata; updates compiled by A. Jenkins. ISBN 0-9678550-9-8.
  3. Li, Y., Zhang, G. & Pfeifer, B. Current and emerging options for taxol production. Adv Biochem Eng Biot 148, 405-425 (2015).